Animals

All animal experiments were performed in accordance with the institutional guidelines of the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University (Kyoto, Japan), and all experimental protocols were approved by the same institute. The reporting in this manuscript followed the recommendations in the ARRIVE guidelines. For euthanasia, mice were intraperitoneally administrated with a mixture of Medetomidine (0.3mg/kg body weight), Midazolam (4mg/kg body weight), and Butorphanol (5mg/kg body weight). SM22-Cre mice(Tg (Tagln-cre)1Her/J, Stock# 004746) and dual fluorescent membrane-localized tdTomato/eGFP (mT/mG) mice (B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato, -EGFP)Luo/J, Stock# 007676) were purchased from the Jackson Laboratory. SM22 -Cre mice were bred with flox mT/mG mice to produce mT/mGflox/wt: SM22-Cre+(SM22mT/mG) mice. For embryos, SM22 -Cre mice were paired overnight with flox mT/mG mice. The morning after mating was considered 0.5days post-coitus (dpc).

Male and female SM22mT/mG mice, 610weeks of age, were used as the cell source. CFs were isolated as described previously26. Media and buffers were prepared according to a previous paper26. The descending aortas and inferior venae cavae were cut. The hearts were perfused with EDTA buffer from the right ventricle. The ascending aortas were clamped. The clamped hearts were removed, transferred to a dish containing EDTA buffer, and perfused with EDTA buffer from the left ventricle (LV). The hearts were transferred to a dish of perfusion buffer, and perfused with perfusion buffer from the LV. The hearts were transferred to a dish of collagenase buffer and perfused with collagenase buffer from the LV. The ventricles were transferred to the other dish of collagenase buffer, gently teased apart into pieces, and triturated. Stop solution was added to the cell-tissue cell suspension. The supernatants obtained via gravity settling three times for 10min in perfusion buffer were collected as nonCMs. The nonCMs were centrifuged at 300g for 5min, resuspended in DMEM containing 10% fetal bovine serum (FBS) and penicillinstreptomycin (Wako, #168-23191), plated on cell culture dishes and cultured for 67days. Almost all cells were fibroblasts after the culture.

Bone marrow was extracted from the femurs and tibias of euthanized mice and differentiated in bone marrow macrophage differentiation media (RPMI 1640 containing 10% fetal bovine serum (FBS), penicillinstreptomycin, 20g/mL recombinant mouse M-CSF (Biolegend, #576404), and 0.1mM/L 2-mercaptoethanol (Wako, #133-14571)). Seven days after being harvested, BMDMs were stimulated with recombinant mouse TGF-1 (Biolegend, # 763102) for 1 or 7days, for RNA or for Flow cytometric analysis, respectively. To investigate whether Cre-recombination occurs during the differentiation process from HSCs to BMDMs, bone marrow cells were harvested and cultured in bone marrow macrophage differentiation media containing with TGF-.

Hearts in 6-week-old mice were perfused with cold phosphate-buffered saline (PBS) and 4% paraformaldehyde, removed, and fixed with 4% paraformaldehyde (PFA) for 3h. The hearts of Embryos at 17.5 dpc were removed, washed with cold PBS and fixed with 4% PFA for 3h. The hearts were incubated in 10%, 20% and 30% sucrose diluted in PBS. The samples were then embedded in OCT compound (Sakura Finetek Japan), frozen and stored at 80. Cryosections (8m thick) were obtained using a Leica cryostat.

For immunofluorescence analysis, sections were first washed with PBS, permeabilized with PBS containing 0.1% Triton-X, and washed with PBS containing 0.1% Tween 20. The sections were then incubated in blocking buffer (PBS containing, 0.1% Tween 20, 1% BSA, and 10% normal donkey serum (Jackson ImmunoResearch, #017-000-121)) for 1h at room temperature. Primary antibodies diluted in blocking buffer were added and incubated overnight at 4. The following primary antibodies were used: anti-SMA (1:100) (Goat, Novus Biologicals, #NB300-978), anti-Vimentin (1:100) (rabbit, Cell Signaling Technology, #5741S), anti-CD68 (1:200) (rat, Bio Rad, #MCA1957GA), and anti-CD31 (1:100) (rabbit, Novus Biologicals, # NB100-2284). Then, the slides were washed three times in PBS containing 0.1% Tween 20 for 5min each, and incubated with Alexa Fluor 647 (ThermoFisher, #A-31573 or Abcam, #ab150155) or Alexa Fluor Plus 680 (ThermoFisher, #A32860) against the appropriate species (diluted at 1:500) for 1h at room temperature. The slides were washed three times in cold PBS for 5min each. Finally, the slides were mounted with VECTASHIELD Antifade Mounting Medium with DAPI (Vector Laboratories, #H-1200-10).

Immunofluorescence images were acquired on an Axio Observer (Carl Zeiss) (5objective) or SP8 Falcon (Leica) (63objective) and analyzed with Zen software (Carl Zeiss) or LAS X (Leica), respectively.

Single cardiac cell suspensions were generated as described previously27. Hearts were perfused with cold PBS and finely minced and digested in Hanks Balanced Salt Solution (HBSS) with Collagenase 2 (500 U/ml) (Worthington Biochemical, #LS004176) for 30min at 37C. Next, the hearts were digested in HBSS with Collagenase/Dispase (1mg/mL) (Merck, #11097113001) for 20min at 37C. To deactivate the enzymes, the samples were washed with cold HBSS. The solutions were passed through a 40m cell strainer (Corning, #352340). Red blood cell lysis was performed with ACK lysis buffer (0.16M ammonium chloride, 10mM Potassium bicarbonate and 0.1mM EDTA). The samples were washed with FACS buffer (HBSS with 25mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 2% FBS and 2mM ethylenediaminetetraacetic acid (EDTA)) and resuspended in 300 L of FACS buffer. Heart samples were blocked with TruStain FcX Plus (0.5 L/100 L) (Biolegend, #156604) for 5min at 4.

Peripheral blood samples were collected from the inferior vena cava of anesthetized mice using a heparin-contained syringe. Red blood cell lysis was performed with ACK lysis buffer. The samples were washed with FACS buffer and resuspended. Peripheral blood samples were blocked with TruStain FcX Plus for 5min at 4.

Bone marrow cells were obtained by flushing femurs and tibias with RPMI supplemented with 25mM HEPES and 10% FBS. The suspensions were passed through a 40m cell strainer. After the red blood cells were lysed, the samples were washed with FACS buffer and resuspended.

BMDMs were collected after harvesting as described before and were blocked with TruStain FcX Plus for 5min at 4.

Cells were stained with monoclonal antibodies at 4C for 20min in the dark. The samples were washed twice, and the final resuspension was made in 500 L of FACS buffer. 7-AAD was used to exclude dead cells. Flow cytometric analysis was performed on BD FACS ARIAII platforms. Complete lists of antibodies and flow cytometry gating strategies are provided in Supplementary Tables 1 and 2, respectively.

Total RNA was isolated and purified using TRIzol reagent (ThermoFisher), and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, #FSQ-301) in accordance with the manufacturer's instructions. For quantitative real-time PCR (qRTPCR), specific genes were amplified using 40 cycles with Thunderbird SYBR qPCR mix (Toyobo, #QPS-201) and StepOnePlus (ThermoFisher). Expression was normalized to the housekeeping gene18rS. Gene-specific primers are described as follows:

18rS forward, CTCAACACGGGAAACCTCAC; 18rS reverse, AGACAAATCGCTCCACCAAC; Tagln forward, CAACAAGGGTCCATCCTACGG; Tagln reverse, ATCTGGGCGGCCTACATCA; Acta2 forward, TGACGCTGAAGTATCCGATAGA; Acta2 reverse, CGAAGCTCGTTATAGAAAGAGTGG; Col1a1 forward, AATGGCACGGCTGTGTGCGA; and Col1a1 reverse, AACGGGTCCCCTTGGGCCTT.

For the Flow cytometric analysis, the lines represent the means and standard error of the samples. Differences between two groups were compared by Students t test as a parametric comparison test. For the RTPCR experiments, one-way ANOVA followed by Tukeys test was performed for multiple comparisons. The bars represent mean of the samples. The analysis and plots were generated using the ggplot2 package and R software. A P value<0.05 was considered statistically significant.

More:
Smooth muscle protein 22-Cre recombination in resting cardiac fibroblasts and hematopoietic precursors | Scientific Reports - Nature.com

Comments are closed.