Archive for the ‘Bone Marrow Stem Cells’ Category

BOSTON--(BUSINESS WIRE)--Gamida Cell Ltd. (Nasdaq: GMDA), the leader in the development of NAM-enabled cell therapy candidates for patients with hematologic and solid cancers and other serious diseases, announces dosing of the first patient in a company-sponsored Phase 1/2 study evaluating a cryopreserved, readily available formulation of GDA-201 for the treatment of follicular and diffuse large B cell lymphomas (NCT05296525).

We are excited to further advance the development of GDA-201, a NAM-enabled natural killer (NK) cell therapy candidate which we believe has the potential to be a new readily available, cryopreserved treatment option for cancer patients with relapsed/refractory lymphoma, said Ronit Simantov, M.D., chief medical and scientific officer of Gamida Cell. Our NK cells elicited an adaptive immune response in patients in the previous investigator-sponsored study with the fresh formulation of GDA-201, potentially leading to durable remissions. We are truly grateful for the contribution of all the participants and clinical collaborators who will allow us to continue studying GDA-201 in this multi-center open label trial.

The Phase 1 portion of the study is a dose escalation phase, designed to evaluate the safety of GDA-201, and will include patients with follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL)/high grade B-cell lymphoma, marginal zone lymphoma or mantle cell lymphoma. The Phase 2 expansion phase is designed to evaluate the safety and efficacy of GDA-201 in 63 patients comprised of two cohorts of patients with either FL or DLBCL. The study will include patients who have relapsed or refractory lymphoma after at least two prior treatments, which may include CAR-T or stem cell transplant.

Interest in NK cell therapies has increased in recent years as a potential alternative to current cell therapies, as NK cells have the potential to be effective in hematological and solid tumors while avoiding common safety issues, said Veronika Bachanova, M.D., Ph.D., University of Minnesota. We are particularly excited about Gamidas cryopreserved formulation of GDA-201, which has potential as a new treatment option for patients.

GDA-201 leverages Gamida Cells proprietary NAM (nicotinamide) technology platform to expand the number and functionality of NK cells to direct tumor cell killing properties and antibody-dependent cellular cytotoxicity (ADCC). In an investigator-sponsored Phase 1/2 study in patients with relapsed or refractory lymphoma, treatment with the fresh formulation of GDA-201 with rituximab demonstrated significant clinical activity. Of the 19 patients with non-Hodgkin lymphoma (NHL), 13 complete responses and one partial response were observed, with an overall response rate of 74% and a complete response rate of 68%. Two-year data on outcomes and cytokine biomarkers associated with survival data demonstrated a median duration of response of 16 months (range 5-36 months) and an overall survival at two years of 78% (95% CI, 51%91%). In this study, GDA-201 was well-tolerated and no dose-limiting toxicities were observed in 19 patients with NHL and 16 patients with multiple myeloma. The most common Grade 3/4 adverse events were thrombocytopenia, hypertension, neutropenia, febrile neutropenia, and anemia. There were no incidents of cytokine release syndrome, neurotoxic events, graft versus host disease or marrow aplasia.

About NAM Technology

Our NAM-enabled technology, supported by positive Phase 3 data for omidubicel, is designed to enhance the number and functionality of targeted cells, enabling us to pursue a curative approach that moves beyond what is possible with existing therapies. Leveraging the unique properties of NAM, we can expand and metabolically modulate multiple cell types including stem cells and NK cells with appropriate growth factors to maintain the cells active phenotype and enhance potency. Additionally, our NAM technology improves the metabolic fitness of cells, allowing for continued activity throughout the expansion process.

About GDA-201

Gamida Cell applied the capabilities of its NAM-enabled cell expansion technology to develop GDA-201, an innate NK cell immunotherapy candidate for the treatment of hematologic and solid tumors in combination with standard-of-care antibody therapies. GDA-201, the lead candidate in the NAM-enabled NK cell pipeline, has demonstrated promising initial clinical trial results. GDA-201 addresses key limitations of NK cells by increasing the cytotoxicity and in vivo retention and proliferation in the bone marrow and lymphoid organs. Furthermore, GDA-201 improves ADCC and tumor targeting of NK cells. There are approximately 40,000 patients with relapsed/refractory lymphoma in the US and EU, which is the patient population that will be studied in the currently ongoing GDA-201 Phase 1/2 clinical trial.

For more information about GDA-201, please visit https://www.gamida-cell.com. For more information on the Phase 1/2 clinical trial of GDA-201, please visit http://www.clinicaltrials.gov.

GDA-201 is an investigational therapy, and its safety and efficacy have not been established by the FDA or any other health authority.

About Gamida Cell

Gamida Cell is pioneering a diverse immunotherapy pipeline of potentially curative cell therapy candidates for patients with solid tumor and blood cancers and other serious blood diseases. We apply a proprietary expansion platform leveraging the properties of NAM to allogeneic cell sources including umbilical cord blood-derived cells and NK cells to create therapy candidates with potential to redefine standards of care. These include omidubicel, an investigational product with potential as a life-saving alternative for patients in need of bone marrow transplant, and a line of modified and unmodified NAM-enabled NK cells targeted at solid tumor and hematological malignancies. For additional information, please visit http://www.gamida-cell.com or follow Gamida Cell on LinkedIn, Twitter, Facebook or Instagram at @GamidaCellTx.

Cautionary Note Regarding Forward Looking Statements

This press release contains forward-looking statements as that term is defined in the Private Securities Litigation Reform Act of 1995, including with respect to: the timing of initiation of the expansion portion of the currently ongoing Phase 1/2 clinical trial of GDA-201, as well as the progress of, and data reported from, this clinical trial; the potentially life-saving or curative therapeutic and commercial potential of Gamida Cells product candidates (including omidubicel and GDA-201); and Gamida Cells expectations for the expected clinical development milestones set forth herein. Any statement describing Gamida Cells goals, expectations, or other projections, intentions or beliefs is a forward-looking statement and should be considered an at-risk statement. Such statements are subject to a number of risks, uncertainties and assumptions, including statements related to: the impact that the COVID-19 pandemic could have on our business; the scope, progress and expansion of Gamida Cells clinical trials and ramifications for the cost thereof; clinical, scientific, regulatory and technical developments; the process of developing and commercializing product candidates that are safe and effective for use as human therapeutics; and the endeavor of building a business around such product candidates. In light of these risks and uncertainties, and other risks and uncertainties that are described in the Risk Factors section and other sections of Gamida Cells Quarterly Report on Form 10-Q, filed with the Securities and Exchange Commission (SEC) on May 12, 2022, and other filings that Gamida Cell makes with the SEC from time to time (which are available at http://www.sec.gov), the events and circumstances discussed in such forward-looking statements may not occur, and Gamida Cells actual results could differ materially and adversely from those anticipated or implied thereby. Although Gamida Cells forward-looking statements reflect the good faith judgment of its management, these statements are based only on facts and factors currently known by Gamida Cell. As a result, you are cautioned not to rely on these forward-looking statements.

Read more:
Gamida Cell Announces Dosing of First Patient in Company-Sponsored Phase 1/2 Study of NK Cell Therapy Candidate GDA-201 - Business Wire

In short, stem cells initiate the production of new tissue cells, which can then replace their diseased counterparts.

Mesenchymal stem cells (MSCs) are adult stem cells found in many areas of the body such as bone marrow. The unique thing about these cells is their compatibility with a range of tissues such as bone, cartilage, muscle, or fat. MSCs respond to injury or disease by migrating to these damaged areas, where they restore tissue function by replacing the damaged cells.

Sign up to our Opinion newsletter

It has recently been shown that the success of MSCs relies on their ability to release cell signals their mechanism to initiate tissue regeneration. These signals are packaged into extracellular vehicles (EVs) which are essentially bubbles of information. These are released by MSCs and taken up by the injured or diseased tissue cells to kickstart their inbuilt process of regeneration.

Through funding from the Royal Society of Edinburgh, research has started into the development of artificial EVs as a viable alternative to cell therapy. These EVs will contain the key molecules released by stem cells when they are responding to injury cues in the body.

The power to induce tissue regeneration would provide a significant new tool in biomedical treatment, such as incorporating EVs into synthetic hydrogels within a wound dressing to encourage and accelerate healing.

Within the lab setting, we have been able to manipulate stem cell cultures to produce EVs with different signal make-ups, and accurately identify their properties.

Controlling and identifying the different make-ups contained in EV signals which in turn induce different cell responses is crucial if we want to operationalise their use in medicine.

We now aim to synthesise artificial vesicles, or bubbles, for different clinical problems, such as, for example, bubbles with potent wound-healing properties that would help our ability to use new artificial stem cell therapy.

The research is underway and it is showing promise that we may be able to harness the regenerative power of stem cells in the near future.

An artificial EV-based approach also has several advantages over stem cell-based therapies, such as having increased potency and greater consistency in treatment, and at a lower cost to carry out.

Both inside and on the surface of the body, we would have the ability to induce a process vital to medical treatment we work with every day and, in turn, open a whole new avenue of possibilities in biomedical science.

Dr Catherine Berry is a reader in the Centre for the Cellular Microenvironment at the University of Glasgow, and a recipient of the Royal Society of Edinburghs personal research fellowship in 2021. This article expresses her own views. The RSE is Scotland's national academy, bringing great minds together to contribute to the social, cultural and economic well-being of Scotland. Find out more at rse.org.uk and @RoyalSocEd.

Here is the original post:
Stem cells: Could we gain the power to induce cell regeneration? Dr Catherine Berry - The Scotsman

The stock price of Verb Technology Company Inc (VERB) an innovative nutraceutical company and a pioneer in the field of stem cell nutrition increased by 15.07% today. Investors responded positively to Stemtech Corporation announcing that Stemtech has adopted a suite of sales enablement software solutions, developed by Verb Technology Company, including verbCRM, VERBs white-labeled interactive video-based customer relationship management application, and verbLIVE, VERBs interactive livestream eCommerce and shoppable video and webinar application, for use in direct selling and customer and prospect communications by its network of Independent Business Partners (IBPs).

Stemtech specializes in creating products and formulas that are patent protected in the U.S. and international markets. And its patented formulas help the release, circulation and migration of the bodys adult stem cells from its bone marrow. The products are all-natural, plant-based, and manufactured under cGMP (Current Good Manufacturing Practices) under the auspices of the Dietary Supplemental Health and Education Act (DSHEA). Stemtechs primary marketing and distribution channel are through a direct sales structure, which offers supplemental and residual income-earning potential to IBPs.

VERB is the leader in interactive video-based sales enablement applications, including interactive livestream eCommerce and shoppable video, webinar, CRM, and marketing applications for enterprises and entrepreneurs., verbCRM, VERBs interactive video-based customer relationship and content management system, will be used as a selling tool by Stemtechs IBPs in marketing its products, acquiring new customers, and strengthening existing customer relationships. And the platform allows users to easily manage, share directly with customers and prospects and through social media, and track interactive content, such as product literature and media, demo videos, and personalized videos.

Plus it provides interaction analytics so IBPs can determine which content is resonating with their prospects and assess overall customer engagement and campaign effectiveness. And this enables IBPs to focus their time and energy more effectively on high-probability sales prospects who have shown interest, thereby increasing their sales conversion rates.

Stemtechs verbCRM implementation also includes VERBs Business Tiles feature, which integrates verbCRM directly into Stemtechs back-office systems, allowing IBPs access to key reports and metrics relevant to improving their business-building efforts natively on the verbCRM app. And verbLIVE, VERBs powerful interactive livestream e-commerce application, will be used by IBPs to engage directly with customers and prospects during live video sessions that allow viewers to quickly buy, receive additional product information, set up appointments, and access other customizable interactive features through clickable in-video buttons.

KEY QUOTES:

We are dedicated to supporting and empowering Stemtechs expansive network of Independent Business Partners by equipping them with the most current and best-in-class digital technology sales tools available. With VERBs sales enablement applications, our IBPs will be able to capitalize on our social media assets and content and more effectively engage with customers and prospects via livestream video to bolster our customer acquisition efforts and increase sales conversion rates.

John Meyer, President and COO of Stemtech

Our select Field IBPs who have been beta testing the new mobile app Stemtech Advance Office, powered by VERB, has been very successful and we are all most excited to launch shortly.

Stemtechs Vice President of Global Performance Sandra Kazickaite

We are thrilled to include Stemtech among the forward-thinking companies that have embraced VERBs interactive video and livestreaming technology to grow sales. VERB has developed a suite of easy-to-use products that create a friction-free, fun, social, and video-based sales experience to enhance customer engagement, while providing real-time viewer engagement analytics for more effective follow-ups that drive sales conversion rates. We are proud to be Stemtechs technology partner to help empower its Independent Business Partners with industry-leading sales enablement tools.

Rory Cutaia, CEO of VERB

Disclaimer: This content is intended for informational purposes. Before making any investment, you should do your own analysis.

Read the original:
Verb Technology (VERB) Stock: Why It Jumped Up 15.07% Today - Pulse 2.0

The new report by Expert Market Research titled, Global Stem Cell Banking Market Report and Forecast 2021-2026, gives an in-depth analysis of the globalstem cell banking market, assessing the market based on its segments like Service type, product type, utilisation, bank type, application, and major regions like Asia Pacific, Europe, North America, Middle East and Africa and Latin America. The report tracks the latest trends in the industry and studies their impact on the overall market. It also assesses the market dynamics, covering the key demand and price indicators, along with analysing the market based on the SWOT and Porters Five Forces models.

Request a free sample copy in PDF or view the report summary@https://bityl.co/CPix

The key highlights of the report include:

Market Overview (2021-2026)

The global stem cell bank market is primarily driven by the advancements in the field of medicine and the rising prevalence of genetic and degenerativediseases. Further, the increasing research and development of more effective technologies for better preservation, processing, and storage of stem cells are aiding the growth. Additionally, rising prevalence of chronic diseases globally is increasing the for advances inmedicaltechnologies, thus pushing the growth further. Moreover, factors such as rising health awareness, developinghealthcare infrastructure, growing geriatric population, and the inflatingdisposableincomes are expected to propel the market in the forecast period.

Industry Definition and Major Segments

Stem cells are undifferentiated cells present in bone marrow,umbilical cordadipose tissue and blood. They have the ability to of differentiate and regenerate. The process of storing and preserving these cells for various application such as gene therapy, regenerative medicine and tissue engineering is known as stem cell banking.

Explore the full report with the table of contents@https://bityl.co/CPiy

By service type, the market is divided into:

Based on product type, the industry can be segmented into:

The market is bifurcated based on utilization into:

By bank type, the industry can be broadly categorized into:

Based on application, the industry can be segmented into:

On the basis of regional markets, the industry is divided into:

1 North America1.1 United States of America1.2 Canada2 Europe2.1 Germany2.2 United Kingdom2.3 France2.4 Italy2.5 Others3 Asia Pacific3.1 China3.2 Japan3.3 India3.4 ASEAN3.5 Others4 Latin America4.1 Brazil4.2 Argentina4.3 Mexico4.4 Others5 Middle East & Africa5.1 Saudi Arabia5.2 United Arab Emirates5.3 Nigeria5.4 South Africa5.5 Others

Market Trends

Regionally, North America is projected to dominate the global stem cell bank market and expand at a significant rate. This can be attributed to increasing research and development for stem cell application in various medical fields. Further, growing investments of pharmaceutical players and development infrastructure are other factors that are expected to stem cell bank market in the region. Meanwhile, Asia Pacific market is also expected to witness fast growth owing to the rapid development in healthcare facilities and increasing awareness of stem cell banking in countries such as China, India, and Indonesia.

Key Market Players

The major players in the market are Cryo-Cell International, Inc., Smart Cells International Ltd., CSG-BIO Company, Inc., CBR Systems Inc., ViaCord, LLC, LifeCell International Pvt. Ltd., and a few others. The report covers the market shares, capacities, plant turnarounds, expansions, investments and mergers and acquisitions, among other latest developments of these market players.

About Us:

Expert Market Research (EMR) is leading market research company with clients across the globe. Through comprehensive data collection and skilful analysis and interpretation of data, the company offers its clients extensive, latest and actionable market intelligence which enables them to make informed and intelligent decisions and strengthen their position in the market. The clientele ranges from Fortune 1000 companies to small and medium scale enterprises.

EMR customises syndicated reports according to clients requirements and expectations. The company is active across over 15 prominent industry domains, including food and beverages, chemicals and materials, technology and media, consumer goods, packaging, agriculture, and pharmaceuticals, among others.

Over 3000 EMR consultants and more than 100 analysts work very hard to ensure that clients get only the most updated, relevant, accurate and actionable industry intelligence so that they may formulate informed, effective and intelligent business strategies and ensure their leadership in the market.

Media Contact

Company Name: Claight CorporationContact Person: Steven Luke, Corporate Sales Specialist U.S.A.Email:sales@expertmarketresearch.comToll Free Number: +1-415-325-5166 | +44-702-402-5790Address: 30 North Gould Street, Sheridan, WY 82801, USAWebsite:https://www.expertmarketresearch.com

Read More Reports:

Cold Pressed Sesame Oil Market: https://freighteurasia.com/global-cold-pressed-sesame-oil-market-to-be-driven-by-the-rising-uses-of-the-oil-in-alternative-medicine-cooking-and-body-massage-in-the-forecast-period-of-2022-2027/

Malaysia Cordial Drink Market: https://freighteurasia.com/malaysia-cordial-drink-market-to-be-driven-by-rising-demand-for-non-alcoholic-and-non-carbonated-beverages-to-aid-the-growth-of-the-cordial-drink-industry-in-malaysia-in-the-forecast-period-of-2021-20/

Sodium Diacetate Market: https://freighteurasia.com/global-sodium-diacetate-market-to-be-driven-by-the-increase-in-the-consumption-of-processed-foods-in-the-forecast-period-of-2021-2026/

Volute Pumps Market: https://freighteurasia.com/global-volute-pumps-market-to-be-driven-by-the-increasing-expenditure-on-infrastructure-development-in-the-forecast-period-of-2021-2026/

Myristic Acid Market: https://freighteurasia.com/global-myristic-acid-market-to-be-driven-by-the-increase-in-the-demand-for-flavoured-foods-and-drinks-in-the-forecast-period-of-2021-2026/

*We at Expert Market Research always thrive to give you the latest information. The numbers in the article are only indicative and may be different from the actual report.

Follow this link:
Global Stem Cell Banking Market To Be Driven At A CAGR Of 13.5% In The Forecast Period Of 2021-2026 This Is Ardee - This Is Ardee

SINGAPORE - A Singaporean doctorwho is one of the top cell therapy experts in the worldhas been appointed to a World Health Organisation (WHO) expert panel.

Dr Mickey Koh is so sought-after in his field that for the past 15 years, he has been holding two jobs in two different countries.

The 56-year-old shuttles between England and Singapore, spending six weeks at a time in London, where he oversees the haematology department and looks after bone marrow transplant patients at St George's University Hospital, before returning to Singapore for a week and a half to head the cell therapy programme at the Health Sciences Authority.

Cell therapy is a growing field of medicine that uses living cells as treatment for a variety of diseases and conditions. This is an increasingly important therapeutic area and both his employers have agreed to his unusual schedule.

Over in London, Dr Koh is head of the Haematology Department at St George's Hospital and Medical School. In Singapore, he is the programme and medical director of the cell and gene therapy facility at the Health Sciences Authority.

In May, Dr Koh was selected to be on the WHO Expert Advisory Panel on Biological Standardisation.

Individuals on the panel have to be invited by WHO to apply, and are well recognised in their respective scientific fields. Eminent names on the panel include the current president of the Paul-Ehrlich-Institut in Germany, which is the country's federal agency, medical regulatory body and research institution for vaccines and biomedicine.

The WHO panel, which is made up of about 25 members, provides detailed recommendations and guidelines for the manufacturing, licensing and standardisation of biological products, which include blood, monoclonal antibodies, vaccines and, increasingly, cell-based therapeutics.

The recommendations and advice are passed on to the executive board of the World Health Assembly, which is the decision-making body of WHO.

Dr Koh's role had to be endorsed by the British government and was a direct appointment by the director-general of WHO.

His appointment as a panel expert will last for a term of four years.

Speaking to The Straits Times, Dr Koh shared his thoughts about the importance of regulation: "We are well aware that there is a very lucrative worldwide market peddling unproven stem cell treatments, where side effects are often unknown, and such unregulated practice can result in serious harm.

"This is already happening. People are claiming that you can use stem cells to treat things like ageing, and even very serious conditions like strokes, without any evidence."

With many medications now taking the form of biologics - a drug product derived from biological sources such as cells - the next wave of treatment would be the utilisation of these cells for the treatment of a wide range of diseases, Dr Koh said.

More:
S'porean doctor, a sought-after top expert in cell therapy, appointed to WHO expert panel - The Straits Times

Presentation

A 17-year-old female presented to a dental school clinic with a chief complaint of a sudden, painless swelling of her gingivae (figures 1 and 2). She had previously gone to a local emergency room. There, her condition was dismissed as a lack of oral hygiene, and she was told to go to a dental provider. The patient had social concerns as she was being ridiculed at school for her condition. She was not pregnant and took no medications. The staff periodontist submitted a large tissue sample to a university pathology lab, and then he performed a gingivectomy on the swollen tissues (figure 3).

In two weeks, the patient returned for a follow-up appointment. The tissue had grown back almost to the original levels (figures 4 and 5). Note the intense red color of the maxillary gingivae.

At this follow-up, the biopsy report was available. Here is a quote from that report: The histomorphology when combined with the clinical presentation and positive staining with MPO and high proliferation index is highly suggestive of acute myeloid or promyelocytic leukemia. The patient should be quickly evaluated by hemo-oncology with this in mind.

Top causes of gingival enlargement and treatment options

Mysterious lesions, Lemonheads, extreme oral herpes, and more

An almost-vague radiodense lesion, mysterious mole, and a tongue top 5

The patient was referred to the University of Floridas Childrens Hospital, where she was treated and went into subsequent remission with chemotherapy. With a timely diagnosis and swift treatment, young people typically respond quickly and favorably. Treatment programs may include chemotherapy, radiation, stem-cell transplant, immunotherapy, or bone marrow transplant.

Myeloid leukemia involves the rapid growth of myeloid blood cells that build up in the bone marrow and prevent the normal production and maturation process. Promyelocytic leukemia is a more aggressive form of myeloid leukemia. In young individuals, these conditions are most often associated with several chromosomal abnormalities. Sudden gingival enlargement is not an uncommon symptom.1 It may occur in patients with non-Hodgkins lymphoma.2

Certain medications may initiate gingival hyperplasia. It is common in renal transplant patients who are treated with cyclosporine and a calcium channel blocker.3 Other medications such as carbamazepine, phenytoin, topiramate, and valproic acid are all possible triggering agents.4 Finally, certain immunosuppressants have the potential to trigger gingival hyperplasia.

Editors note:This article first appeared inThrough the Loupesnewsletter, a publication of the Endeavor Business Media Dental Group.Read more articlesandsubscribetoThrough the Loupes.

Visit link:
Oral symptoms of systemic pathology in a 17-year-old female - DentistryIQ

Market Overview

Thecell culture media marketis expected to cross USD 4.33 billion by 2027 at a CAGR of8.33%.

Market Dynamics

The markets growth is being fueled by a diverse range of cell culture media applications, increased research and development in the pharmaceutical industry, an increase in the prevalence of chronic diseases, and increased expansion and product launches by major players. Over the last few decades, advancements in cell culture technology have accelerated. It is widely regarded as one of the most dependable, robust, and mature technologies for biotherapeutic product development.

The high cost of cell culture media and the risk of contamination, on the other hand, are impeding the markets growth. However, the growing emphasis on regenerative and personalized medicine is likely to spur growth in the global cell culture media market.

Get Sample Report: https://www.marketresearchfuture.com/sample_request/4462

Competitive Dynamics

The notable players are the Merck KGaA (Germany), Bio-Rad Laboratories, Inc. (US), Thermo Fisher Scientific Inc. (US), Lonza (Switzerland), GE Healthcare (US), Becton, Dickinson and Company (US), HiMedia Laboratories (India), Corning Incorporated (US), PromoCell (Germany), Sera Scandia A/S (Denmark), The Sartorius Group (Germany), and Fujifilm Holdings Corporation (Japan).

Segmental Analysis

The global market for cell culture media has been segmented according to product type, application, and end user.

The market has been segmented by product type into classical media, stem cell media, serum-free media, and others.

Further subcategories of stem cell culture media include bone marrow, embryonic stem cells, mesenchymal stem cells, and neural stem cells.

The market is segmented into four application segments: drug discovery and development, cancer research, genetic engineering, and tissue engineering and biochemistry.

The market is segmented by end user into biochemistry and pharmaceutical companies, research laboratories, academic institutions, and pathology laboratories.

Regional Overview

According to region, the global cell culture media market is segmented into the Americas, Europe, Asia-Pacific, and the Middle East & Africa.

The Americas dominated the global cell culture media market. The large share is attributed to the presence of major manufacturers, rising disease prevalence resulting in increased demand for drugs and other medications, technological advancements in the preclinical and clinical segments, growing public awareness, and high disposable income.

Europe ranks second in terms of market size for cell culture media. Factors such as an increase in the biopharmaceutical sector in the European region, increased government initiatives to promote research to find a cure for the growing number of chronic diseases, an increase in the number of pharmaceutical manufacturers, improving economies, a high disposable income per individual, and increased healthcare spending are all contributing to the markets growth in this region. The European market is expected to be driven by expanding R&D activities and a developing biopharmaceutical sector.

Asia-Pacific held the third-largest market share, owing to the presence of numerous research organizations, low manufacturing costs, low labor costs, developing healthcare infrastructure, and increased investment by American and European market giants in Asian countries such as China and India.

The Middle East and Africa, with limited economic development and extremely low income, held the smallest market share in 2019 but is expected to grow due to growing public awareness and demand for improved healthcare facilities in countries, as well as rising disposable income.

Browse Full Reports: https://www.marketresearchfuture.com/reports/cell-culture-media-market-4462

Related Report: Dysmenorrhea Treatment Market Research Report- Global Forecast to 2027

Syringe and Needle Market Research Report Global Forecast to 2027

Global Medical Robotics Market Research Report- Forecast To 2027

About US:

Market Research Future (MRFR) enable customers to unravel the complexity of various industries through Cooked Research Report (CRR), Half-Cooked Research Reports (HCRR), Raw Research Reports (3R), Continuous-Feed Research (CFR), and Market Research & Consulting Services.

Contact us:

Market Research Future (part of Wantstats Research and Media Private Limited),

99 Hudson Street,5Th Floor, New York,

New York 10013

See more here:
Cell Culture Media Market: Competitive Approach, Breakdown And Forecast by 2027 - Digital Journal

Tecartus (Brexucabtagene Autoleucel) First and Only CAR T in Europe to Receive Positive CHMP Opinion to Treat Adults 26+ with r/r ALL

If Approved, it will Address a Significant Unmet Need for a Patient Population with Limited Treatment Options

SANTA MONICA, Calif.--(BUSINESS WIRE)--Kite, a Gilead Company (Nasdaq: GILD), today announces that the European Medicines Agency (EMA) Committee for Medicinal Products for Human Use (CHMP) has issued a positive opinion for Tecartus (brexucabtagene autoleucel) for the treatment of adult patients 26 years of age and above with relapsed or refractory (r/r) B-cell precursor acute lymphoblastic leukemia (ALL). If approved, Tecartus will be the first and only Chimeric Antigen Receptor (CAR) T-cell therapy for this population of patients who have limited treatment options. Half of adults with ALL will relapse, and median overall survival (OS) for this group is only approximately eight months with current standard-of-care treatments.

Kites goal is clear: to bring the hope of survival to more patients with cancer around the world through cell therapy, said Christi Shaw, CEO, Kite. Todays CHMP positive opinion in adult ALL brings us a step closer to delivering on the promise that cell therapies have to transform the way cancer is treated.

Following this positive opinion, the European Commission will now review the CHMP opinion; the final decision on the Marketing Authorization is expected in the coming months.

Adults with relapsed or refractory ALL often undergo multiple treatments including chemotherapy, targeted therapy and stem cell transplant, creating a significant burden on a patients quality of life, said Max S. Topp, MD, professor and head of Hematology, University Hospital of Wuerzburg, Germany. If approved, patients in Europe will have a meaningful advancement in treatment. Tecartus has demonstrated durable responses, suggesting the potential for long-term remission and a new approach to care.

Results from the ZUMA-3 international multicenter, single-arm, open-label, registrational Phase 1/2 study of adult patients (18 years old) with relapsed or refractory ALL, demonstrated that 71% of the evaluable patients (n=55) achieved complete remission (CR) or CR with incomplete hematological recovery (CRi) with a median follow-up of 26.8 months. In an extended data set of all patients dosed with the pivotal dose (n=78) the median overall survival for all patients was more than two years (25.4 months) and almost four years (47 months) for responders (patients who achieved CR or CRi). Among efficacy-evaluable patients, median duration of remission (DOR) was 18.6 months. Among the patients treated with Tecartus at the target dose (n=100), Grade 3 or higher cytokine release syndrome (CRS) and neurologic events occurred in 25% and 32% of patients, respectively, and were generally well-managed.

About ZUMA-3

ZUMA-3 is an ongoing international multicenter (US, Canada, EU), single arm, open label, registrational Phase 1/2 study of Tecartus in adult patients (18 years old) with ALL whose disease is refractory to or has relapsed following standard systemic therapy or hematopoietic stem cell transplantation. The primary endpoint is the rate of overall complete remission or complete remission with incomplete hematological recovery by central assessment. Duration of remission and relapse-free survival, overall survival, minimal residual disease (MRD) negativity rate, and allo-SCT rate were assessed as secondary endpoints.

About Acute Lymphoblastic Leukemia

ALL is an aggressive type of blood cancer that develops when abnormal white blood cells accumulate in the bone marrow until there isnt any room left for blood cells to form. In some cases, these abnormal cells invade healthy organs and can also involve the lymph nodes, spleen, liver, central nervous system and other organs. The most common form is B cell precursor ALL. Globally, approximately 64,000 people are diagnosed with ALL each year, including around 3,300 people in Europe.

About Tecartus

Please see full FDA Prescribing Information, including BOXED WARNING and Medication Guide.

Tecartus is a CD19-directed genetically modified autologous T cell immunotherapy indicated for the treatment of:

This indication is approved under accelerated approval based on overall response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in a confirmatory trial.

U.S. IMPORTANT SAFETY INFORMATION

BOXED WARNING: CYTOKINE RELEASE SYNDROME and NEUROLOGIC TOXICITIES

Cytokine Release Syndrome (CRS), including life-threatening reactions, occurred following treatment with Tecartus. In ZUMA-2, CRS occurred in 91% (75/82) of patients receiving Tecartus, including Grade 3 CRS in 18% of patients. Among the patients who died after receiving Tecartus, one had a fatal CRS event. The median time to onset of CRS was three days (range: 1 to 13 days) and the median duration of CRS was ten days (range: 1 to 50 days). Among patients with CRS, the key manifestations (>10%) were similar in MCL and ALL and included fever (93%), hypotension (62%), tachycardia (59%), chills (32%), hypoxia (31%), headache (21%), fatigue (20%), and nausea (13%). Serious events associated with CRS included hypotension, fever, hypoxia, tachycardia, and dyspnea.

Ensure that a minimum of two doses of tocilizumab are available for each patient prior to infusion of Tecartus. Following infusion, monitor patients for signs and symptoms of CRS daily for at least seven days for patients with MCL and at least 14 days for patients with ALL at the certified healthcare facility, and for four weeks thereafter. Counsel patients to seek immediate medical attention should signs or symptoms of CRS occur at any time. At the first sign of CRS, institute treatment with supportive care, tocilizumab, or tocilizumab and corticosteroids as indicated.

Neurologic Events, including those that were fatal or life-threatening, occurred following treatment with Tecartus. Neurologic events occurred in 81% (66/82) of patients with MCL, including Grade 3 in 37% of patients. The median time to onset for neurologic events was six days (range: 1 to 32 days) with a median duration of 21 days (range: 2 to 454 days) in patients with MCL. Neurologic events occurred in 87% (68/78) of patients with ALL, including Grade 3 in 35% of patients. The median time to onset for neurologic events was seven days (range: 1 to 51 days) with a median duration of 15 days (range: 1 to 397 days) in patients with ALL. For patients with MCL, 54 (66%) patients experienced CRS before the onset of neurological events. Five (6%) patients did not experience CRS with neurologic events and eight patients (10%) developed neurological events after the resolution of CRS. Neurologic events resolved for 119 out of 134 (89%) patients treated with Tecartus. Nine patients (three patients with MCL and six patients with ALL) had ongoing neurologic events at the time of death. For patients with ALL, neurologic events occurred before, during, and after CRS in 4 (5%), 57 (73%), and 8 (10%) of patients; respectively. Three patients (4%) had neurologic events without CRS. The onset of neurologic events can be concurrent with CRS, following resolution of CRS or in the absence of CRS.

The most common neurologic events (>10%) were similar in MCL and ALL and included encephalopathy (57%), headache (37%), tremor (34%), confusional state (26%), aphasia (23%), delirium (17%), dizziness (15%), anxiety (14%), and agitation (12%). Serious events including encephalopathy, aphasia, confusional state, and seizures occurred after treatment with Tecartus.

Monitor patients daily for at least seven days for patients with MCL and at least 14 days for patients with ALL at the certified healthcare facility and for four weeks following infusion for signs and symptoms of neurologic toxicities and treat promptly.

REMS Program: Because of the risk of CRS and neurologic toxicities, Tecartus is available only through a restricted program under a Risk Evaluation and Mitigation Strategy (REMS) called the Yescarta and Tecartus REMS Program which requires that:

Hypersensitivity Reactions: Serious hypersensitivity reactions, including anaphylaxis, may occur due to dimethyl sulfoxide (DMSO) or residual gentamicin in Tecartus.

Severe Infections: Severe or life-threatening infections occurred in patients after Tecartus infusion. Infections (all grades) occurred in 56% (46/82) of patients with MCL and 44% (34/78) of patients with ALL. Grade 3 or higher infections, including bacterial, viral, and fungal infections, occurred in 30% of patients with ALL and MCL. Tecartus should not be administered to patients with clinically significant active systemic infections. Monitor patients for signs and symptoms of infection before and after Tecartus infusion and treat appropriately. Administer prophylactic antimicrobials according to local guidelines.

Febrile neutropenia was observed in 6% of patients with MCL and 35% of patients with ALL after Tecartus infusion and may be concurrent with CRS. The febrile neutropenia in 27 (35%) of patients with ALL includes events of febrile neutropenia (11 (14%)) plus the concurrent events of fever and neutropenia (16 (21%)). In the event of febrile neutropenia, evaluate for infection and manage with broad spectrum antibiotics, fluids, and other supportive care as medically indicated.

In immunosuppressed patients, life-threatening and fatal opportunistic infections have been reported. The possibility of rare infectious etiologies (e.g., fungal and viral infections such as HHV-6 and progressive multifocal leukoencephalopathy) should be considered in patients with neurologic events and appropriate diagnostic evaluations should be performed.

Hepatitis B virus (HBV) reactivation, in some cases resulting in fulminant hepatitis, hepatic failure, and death, can occur in patients treated with drugs directed against B cells. Perform screening for HBV, HCV, and HIV in accordance with clinical guidelines before collection of cells for manufacturing.

Prolonged Cytopenias: Patients may exhibit cytopenias for several weeks following lymphodepleting chemotherapy and Tecartus infusion. In patients with MCL, Grade 3 or higher cytopenias not resolved by Day 30 following Tecartus infusion occurred in 55% (45/82) of patients and included thrombocytopenia (38%), neutropenia (37%), and anemia (17%). In patients with ALL who were responders to Tecartus treatment, Grade 3 or higher cytopenias not resolved by Day 30 following Tecartus infusion occurred in 20% (7/35) of the patients and included neutropenia (12%) and thrombocytopenia (12%); Grade 3 or higher cytopenias not resolved by Day 60 following Tecartus infusion occurred in 11% (4/35) of the patients and included neutropenia (9%) and thrombocytopenia (6%). Monitor blood counts after Tecartus infusion.

Hypogammaglobulinemia: B cell aplasia and hypogammaglobulinemia can occur in patients receiving treatment with Tecartus. Hypogammaglobulinemia was reported in 16% (13/82) of patients with MCL and 9% (7/78) of patients with ALL. Monitor immunoglobulin levels after treatment with Tecartus and manage using infection precautions, antibiotic prophylaxis, and immunoglobulin replacement.

The safety of immunization with live viral vaccines during or following Tecartus treatment has not been studied. Vaccination with live virus vaccines is not recommended for at least six weeks prior to the start of lymphodepleting chemotherapy, during Tecartus treatment, and until immune recovery following treatment with Tecartus.

Secondary Malignancies may develop. Monitor life-long for secondary malignancies. In the event that one occurs, contact Kite at 1-844-454-KITE (5483) to obtain instructions on patient samples to collect for testing.

Effects on Ability to Drive and Use Machines: Due to the potential for neurologic events, including altered mental status or seizures, patients are at risk for altered or decreased consciousness or coordination in the 8 weeks following Tecartus infusion. Advise patients to refrain from driving and engaging in hazardous activities, such as operating heavy or potentially dangerous machinery, during this period.

Adverse Reactions: The most common non-laboratory adverse reactions ( 20%) were fever, cytokine release syndrome, hypotension, encephalopathy, tachycardia, nausea, chills, headache, fatigue, febrile neutropenia, diarrhea, musculoskeletal pain, hypoxia, rash, edema, tremor, infection with pathogen unspecified, constipation, decreased appetite, and vomiting. The most common serious adverse reactions ( 2%) were cytokine release syndrome, febrile neutropenia, hypotension, encephalopathy, fever, infection with pathogen unspecified, hypoxia, tachycardia, bacterial infections, respiratory failure, seizure, diarrhea, dyspnea, fungal infections, viral infections, coagulopathy, delirium, fatigue, hemophagocytic lymphohistiocytosis, musculoskeletal pain, edema, and paraparesis.

About Kite

Kite, a Gilead Company, is a global biopharmaceutical company based in Santa Monica, California, with manufacturing operations in North America and Europe. Kites singular focus is cell therapy to treat and potentially cure cancer. As the cell therapy leader, Kite has more approved CAR T indications to help more patients than any other company. For more information on Kite, please visit http://www.kitepharma.com. Follow Kite on social media on Twitter (@KitePharma) and LinkedIn.

About Gilead Sciences

Gilead Sciences, Inc. is a biopharmaceutical company that has pursued and achieved breakthroughs in medicine for more than three decades, with the goal of creating a healthier world for all people. The company is committed to advancing innovative medicines to prevent and treat life-threatening diseases, including HIV, viral hepatitis and cancer. Gilead operates in more than 35 countries worldwide, with headquarters in Foster City, California.

Forward-Looking Statements

This press release includes forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995 that are subject to risks, uncertainties and other factors, including the ability of Gilead and Kite to initiate, progress or complete clinical trials within currently anticipated timelines or at all, and the possibility of unfavorable results from ongoing and additional clinical trials, including those involving Tecartus; the risk that physicians may not see the benefits of prescribing Tecartus for the treatment of blood cancers; and any assumptions underlying any of the foregoing. These and other risks, uncertainties and other factors are described in detail in Gileads Quarterly Report on Form 10-Q for the quarter ended March 31, 2022 as filed with the U.S. Securities and Exchange Commission. These risks, uncertainties and other factors could cause actual results to differ materially from those referred to in the forward-looking statements. All statements other than statements of historical fact are statements that could be deemed forward-looking statements. The reader is cautioned that any such forward-looking statements are not guarantees of future performance and involve risks and uncertainties and is cautioned not to place undue reliance on these forward-looking statements. All forward-looking statements are based on information currently available to Gilead and Kite, and Gilead and Kite assume no obligation and disclaim any intent to update any such forward-looking statements.

U.S. Prescribing Information for Tecartus including BOXED WARNING, is available at http://www.kitepharma.com and http://www.gilead.com .

Kite, the Kite logo, Tecartus and GILEAD are trademarks of Gilead Sciences, Inc. or its related companies .

View source version on businesswire.com: https://www.businesswire.com/news/home/20220722005258/en/

Jacquie Ross, Investorsinvestor_relations@gilead.com

Anna Padula, Mediaapadula@kitepharma.com

Source: Gilead Sciences, Inc.

Read more from the original source:
Kite's CAR T-cell Therapy Tecartus Receives Positive CHMP Opinion in Relapsed or Refractory Acute Lymphoblastic Leukemia (r/r ALL) - Gilead Sciences

Josh, Harper and Meagan in June 2022

Two years ago, Meagan stood in a hospital room at Seattle Childrens cradling her 1-year-old daughter, Harper, against her chest. Her fianc, Josh, huddled close to them and kissed the thinning hair on top of their babys head.

A feeding tube was routed through Harpers nose and her eyes were brimming with tears. Exhausted, she snuggled into her moms arms as a photographer took their picture.

Meagan and Josh feared those would be the last photos taken of their baby girl.

Six months before, Harper became seriously ill. After multiple visits to their pediatrician in Yakima, Meagan took her to an emergency room where blood tests revealed Harper had leukemia.

It was shocking, Meagan says. Thirty minutes later we were on an emergency flight to Seattle Childrens.

The family didnt return home for nearly two years.

The type of leukemia Harper had acute lymphoblastic leukemia (ALL) is typically harder to treat and has lower survival rates when it occurs in infants who are less than a year old.

Harpers case was exceptionally challenging. She didnt respond to standard chemotherapy, even after providers added a medication designed to sensitize her leukemia to the treatment.

Her care team, which included Seattle Childrens High-Risk Leukemia Program, believed a stem cell transplant would give Harper the best chance of surviving, but they had to eliminate the majority of her leukemia cells first.

Drs. Kasey Leger and Brittany Lee, Harpers primary oncologists, started her on a novel immunotherapy medication, called blinatumomab, which effectively destroyed many of her ALL cells.

Unfortunately, two weeks later, the team discovered some of Harpers ALL cells had morphed into a different blood cancer acute myeloid leukemia (AML). This rare occurrence, called lineage switch, occurs in less than 5% of infant ALL cases.

It was a roller coaster, Josh says. She didnt do anything they expected her to do. It felt like every day we had to come up with a new plan.

Drs. Leger and Lee gave Harper a different kind of chemotherapy that destroyed the new AML cells. Still, some of her ALL cells remained, so the team gave Harper blinatumomab again which finally suppressed her cancer enough for her to have a stem cell transplant just before her first birthday.

Harper and her mom, Meagan, celebrating Harpers first birthday shortly after her stem cell transplant

The team had done everything they could to get Harper healthy enough for a stem cell transplant, hopeful it would be the treatment that finally cured her. Tragically, Harpers leukemia was back less than a month later.

When leukemia comes back so soon after transplant, patients have very few treatment options, if any, says Dr. Corinne Summers, Harpers stem cell transplant specialist. Many patients will not survive long term.

Harpers parents were terrified they were going to lose her.

Her bone marrow was packed with leukemia, Josh remembers. You could tell the life was slipping out of her and she just looked like it was going to be the end.

After Harpers stem cell transplant failed, the family met with end-of-life specialists and scheduled a special photo session to create memories that they would carry forward

They struggled to decide if they should continue treatment.

How do you know when enough is enough? Meagan says. When do you say, We cant do this to her anymore? Harper couldnt tell us how she was feeling, so it was all our decision.

Meagan and Josh worked closely with the care team to decide what to do next.

Those conversations were emotional for all of us, says Dr. Lee. Thankfully, we had a close, trusting relationship with their family and were able to give recommendations that reflected what they wanted for their daughter and what they felt was most important.

After much consideration, Meagan and Josh decided Harper was strong enough to continue treatment.

Drs. Leger and Lee filed a compassionate use request with the Food and Drug Administration to give Harper an investigational chemotherapy drug called venetoclax. Unfortunately, the treatment didnt work.

Collaborating with the family, the team decided to try giving Harper blinatumomab one more time. There was no evidence suggesting the medication would work so soon after a bone marrow transplant and with such a high burden of leukemia, but within a week it eliminated 98% of Harpers cancer cells.

Family is a critical piece of the team, Dr. Leger says. And Harper is fortunate to have amazing parents who were at her bedside 24/7 and had a beautiful way of advocating for her. They challenged us to leave no stone unturned and partnered with us throughout her treatment to keep figuring out a way forward.

With Harpers leukemia under control, the team searched for a way to wipe out any remaining cancer cells and keep her disease from coming back. Doctors in Childrens Cancer and Blood Disorders Center lead national research groups such as the Childrens Oncology Group, so they have access to trials around the world. However, Harpers care team found the best treatment for her was at Seattle Childrens Hospital, in partnership with Seattle Childrens Therapeutics.

Harpers T-cells were removed through a process called apheresis before they were reprogrammed to target her cancer cells and infused back into her blood

Harper was enrolled in one of Childrens T-cell immunotherapy clinical trials. The treatment involves re-programming a patients T cells (a type of white blood cell) to target and destroy their cancer cells.

After her T-cell therapy, Harper was finally in remission.

Meagan cried with relief when she found out. Harper would not be here right now if it wasnt for everybody at Seattle Childrens, she says. From day one, theyve been comforting and compassionate. They bend over backwards to keep families involved and helped us fight for our child.

To keep her in remission, Harper was given six antigen-presenting cell boosters, which kept her reprogrammed T cells circulating through her blood longer. She received the last booster earlier this year and is still in remission today.

Harper had a very unique disease in that her leukemia manifested as both ALL and AML, says Dr. Leger. Thankfully, we have team members with deep expertise in each of those diseases. Having internationally recognized chemotherapy, transplant and immunotherapy specialists on our team allowed us to be creative with her care when she needed to go beyond the standard pathways.

Today, Harper is a joyful, boisterous 3-year-old who loves experimenting with musical toys and splashing around in her bath or kiddie pool. One of her favorite things to do is grab Meagan by the hair and squish their faces together.

Because of the treatments Harper received at such a young age and the extended time she spent in the hospital, Harper is behind on some developmental milestones like speaking and walking. Still, Meagan and Josh say shes catching up.

Shes starting to bloom and take off and its so nice to see, Meagan says. At the same time, we cant get too comfortable. We know how relentless her disease is and that it could come back one day.

Harper plays in a pool, one of her favorite activities, in June 2022

Harpers family encourages community members to support cancer research at Childrens so that new treatments can be developed for Harper and other kids like her.

Without donors, Harper probably wouldnt be alive right now, Josh says. The treatments she had were developed in just the last few years. If people dont step up and donate, those programs arent there. Those drugs arent invented. Cancer treatment has come a really long way and thats because of donors stepping up to make that happen.

Learn more about Seattle Childrens High-Risk Leukemia Program and Cancer and Blood Disorders Center.

Related

Read more here:
No Stone Unturned: Seattle Children's High-Risk Leukemia Experts Specialize in the Toughest Cases - On the Pulse - On the Pulse - On the Pulse

New Jersey, United States TheStem Cell TherapyMarket research guides new entrants to obtain precise market data and communicates with customers to know their requirements and preferences. It spots outright business opportunities and helps to bring new products into the market. It identifies opportunities in the marketplace. It aims at doing modifications in the business to make business procedures smooth and make business forward. It helps business players to make sound decision making. Stem Cell Therapy market report helps to reduce business risks and provides ways to deal with upcoming challenges. Market information provided here helps new entrants to take informed decisions making. It emphasizes on major regions of the globe such as Europe, North America, Asia Pacific, Middle East, Africa, and Latin America along with their market size.

Such unique Stem Cell Therapy Market research report offers some extensive strategic plans that help the players to deal with the current market situation and make your position. It helps in strengthening your business position. It offers better understanding of the market and keep perspective to aid one remain ahead in this competitive market. Organizations can gauze and compare their presentation with others in the market on the basis of this prompt market report. This market report offers a clarified picture of the varying market tactics and thereby helps the business organizations gain bigger profits. You get a clear idea about the product launches, trade regulations and expansion of the market place through this market report.

Get Full PDF Sample Copy of Report: (Including Full TOC, List of Tables & Figures, Chart) @https://www.verifiedmarketresearch.com/download-sample/?rid=24113

Key Players Mentioned in the Stem Cell Therapy Market Research Report:

Osiris Therapeutics Medipost Co. Ltd., Anterogen Co. Ltd., Pharmicell Co. Ltd., HolostemTerapieAvanzateSrl, JCR Pharmaceuticals Co. Ltd., Nuvasive RTI Surgical Allosource

Stem Cell TherapyMarket report consists of important data about the entire market environment of products or services offered by different industry players. It enables industries to know the market scenario of a particular product or service including demand, supply, market structure, pricing structure, and trend analysis. It is of great assistance in the product market development. It further depicts essential data regarding customers, products, competition, and market growth factors. Stem Cell Therapy market research benefits greatly to make the proper decision. Future trends are also revealed for particular products or services to help business players in making the right investment and launching products into the market.

Stem Cell TherapyMarket Segmentation:

Stem Cell Therapy Market, By Cell Source

Adipose Tissue-Derived Mesenchymal Stem Cells Bone Marrow-Derived Mesenchymal Stem Cells Cord Blood/Embryonic Stem Cells Other Cell Sources

Stem Cell Therapy Market, By Therapeutic Application

Musculoskeletal Disorders Wounds and Injuries Cardiovascular Diseases Surgeries Gastrointestinal Diseases Other Applications

Stem Cell Therapy Market, By Type

Allogeneic Stem Cell Therapy Autologous Stem Cell Therapy

Inquire for a Discount on this Premium Report@ https://www.verifiedmarketresearch.com/ask-for-discount/?rid=24113

For Prepare TOC Our Analyst deep Researched the Following Things:

Report Overview:It includes major players of the Stem Cell Therapy market covered in the research study, research scope, market segments by type, market segments by application, years considered for the research study, and objectives of the report.

Global Growth Trends:This section focuses on industry trends where market drivers and top market trends are shed light upon. It also provides growth rates of key producers operating in the Stem Cell Therapy market. Furthermore, it offers production and capacity analysis where marketing pricing trends, capacity, production, and production value of the Stem Cell Therapy market are discussed.

Market Share by Manufacturers:Here, the report provides details about revenue by manufacturers, production and capacity by manufacturers, price by manufacturers, expansion plans, mergers and acquisitions, and products, market entry dates, distribution, and market areas of key manufacturers.

Market Size by Type:This section concentrates on product type segments where production value market share, price, and production market share by product type are discussed.

Market Size by Application:Besides an overview of the Stem Cell Therapy market by application, it gives a study on the consumption in the Stem Cell Therapy market by application.

Production by Region:Here, the production value growth rate, production growth rate, import and export, and key players of each regional market are provided.

Consumption by Region:This section provides information on the consumption in each regional market studied in the report. The consumption is discussed on the basis of country, application, and product type.

Company Profiles:Almost all leading players of the Stem Cell Therapy market are profiled in this section. The analysts have provided information about their recent developments in the Stem Cell Therapy market, products, revenue, production, business, and company.

Market Forecast by Production:The production and production value forecasts included in this section are for the Stem Cell Therapy market as well as for key regional markets.

Market Forecast by Consumption:The consumption and consumption value forecasts included in this section are for the Stem Cell Therapy market as well as for key regional markets.

Value Chain and Sales Analysis:It deeply analyzes customers, distributors, sales channels, and value chain of the Stem Cell Therapy market.

Key Findings:This section gives a quick look at the important findings of the research study.

For More Information or Query or Customization Before Buying, Visit @ https://www.verifiedmarketresearch.com/product/stem-cell-therapy-market/

About Us: Verified Market Research

Verified Market Research is a leading Global Research and Consulting firm that has been providing advanced analytical research solutions, custom consulting and in-depth data analysis for 10+ years to individuals and companies alike that are looking for accurate, reliable and up to date research data and technical consulting. We offer insights into strategic and growth analyses, Data necessary to achieve corporate goals and help make critical revenue decisions.

Our research studies help our clients make superior data-driven decisions, understand market forecast, capitalize on future opportunities and optimize efficiency by working as their partner to deliver accurate and valuable information. The industries we cover span over a large spectrum including Technology, Chemicals, Manufacturing, Energy, Food and Beverages, Automotive, Robotics, Packaging, Construction, Mining & Gas. Etc.

We, at Verified Market Research, assist in understanding holistic market indicating factors and most current and future market trends. Our analysts, with their high expertise in data gathering and governance, utilize industry techniques to collate and examine data at all stages. They are trained to combine modern data collection techniques, superior research methodology, subject expertise and years of collective experience to produce informative and accurate research.

Having serviced over 5000+ clients, we have provided reliable market research services to more than 100 Global Fortune 500 companies such as Amazon, Dell, IBM, Shell, Exxon Mobil, General Electric, Siemens, Microsoft, Sony and Hitachi. We have co-consulted with some of the worlds leading consulting firms like McKinsey & Company, Boston Consulting Group, Bain and Company for custom research and consulting projects for businesses worldwide.

Contact us:

Mr. Edwyne Fernandes

Verified Market Research

US: +1 (650)-781-4080UK: +44 (753)-715-0008APAC: +61 (488)-85-9400US Toll-Free: +1 (800)-782-1768

Email: sales@verifiedmarketresearch.com

Website:- https://www.verifiedmarketresearch.com/

Here is the original post:
Stem Cell Therapy Market Size, Scope, Growth Opportunities, Trends by Manufacturers And Forecast to 2029 This Is Ardee - This Is Ardee

Introduction

Stem cells are highly specialized cell types with an impressive ability to self-renew, able to transform into one or even more specific cell types that play a significant role in the regulation and tissue healing process.17 To self-renew, a stem divides into two identical daughter stem cells and a progenitor cell and the embryonic and adult cells contain stem cells.1,2,8

Curing patients with serious medical conditions has been the focus of all disciplines of medical research for many years. Stem cell treatment has evolved into a highly exciting and progressed field of scientific research. Major advances have recently been introduced in fundamental and translational stem-cell-based treatment studies. As stem cell research progressed, many therapeutic options were investigated. The development of therapeutic procedures has sparked a great deal of interest.1,9 Humanity has known for many years that it is possible to regenerate lost tissue. Recently, the regenerative medicine research has taken hold, defying the tremendous scientific advances in the molecular biology sciences only. Technological advances provide limitless opportunities for transformational and potentially restorative therapies for many of humanitys most illnesses. A variety of human organs have successfully yielded stem cells. Besides this, the cell therapy is rapidly bringing good advancements in the healthcare system, intending to restore and possibly replace injured tissue, as well as organs, and ultimately restore the functional capacity of the body.2,10,11

The stem cells can be obtained from various sources of Adult (Adult body tissues), Embryonic (Embryos), Mesenchyma (Connective tissue or stroma), and Induced pluripotent stem [ips] cells (Skin cells or tissue-specific cells).3,68,1215

Due to various stem cells cellular characteristics, the therapeutic clinical possibilities of stem-cell-based treatment are considered promising. These cells can regrow and restore various types of body tissues, for this reason, they are recognized as precursor cells to all kinds of cells.15 The following are the distinguishing features: 1. Self-renewal- Divide without distinction to generate an infinite supply, 2. Multi-potency- One mature cell may distinguish more than one, 3. Pluripotency- Create all sorts of cells except for embryonic membrane cells, 4. Toti- potency- Produce various sorts of cells, including embryonic stem cells.1,2,6,7,16

Stem cells are essential human cells that really can self-renew and make a distinction into particular mature cell types.3,6 The different types of stem cells are embryonic, induced pluripotent, and adult kind of cell types. They all share the important feature of self-renewal, and the ability to discern themselves. It should be mentioned that, the stem cells are not homogeneous, but instead appear in a progressive order. Totipotent stem cells are the most basic and immature stem cells. The above cells can form a complete embryo and also extra-embryonic tissue. This one-of-a-kind efficiency is only present for a short period, starting with ovum development and completing whenever the embryo achieves the 4 to 8 cell phases. Having followed that, cells that divide until they approach the blastocyst, about which point they end up losing their totipotency and acquire a pluripotent character trait, at which cells can only distinguish through each embryonic germ stack. After a few divisions, the pluripotency character trait starts to fade and the distinguishing ability has become more lineage constrained, where its cells are becoming multipotent, indicating they could only transform into the cells connected to a cell or tissue of origin.10 Many researchers believe that adult stem cells should be used in stem cell therapies.6,17

The stem cells can be transformed into a wide range of specialized functional cell types.3,18 In response to injury or maturation, those same stem cells can propagate in massive quantities.19 Adult, embryonic, and induced pluripotent stem cells are examples of stem cell-based therapies.14,15,1921 The stem cells, due to their capability to distinguish the specific cell types requisite for a diseased tissue regeneration, can provide an effective solution, while tissue and organ transplantation are considered necessary.10 The sophistication of stem cell-based treatment interventions, on the other hand, probably leads researchers to seek stable, credible, and readily available stem cell sources capable of converting into numerous lineages. As an outcome, it is critical to exercise caution when selecting the type of stem cells to be used in therapeutic trials.12,14,22

Only with the explosive growth of basic stem cell research in recent years, the comparatively recent study sector of Translational Research had also grown exponentially, starting to build on major research knowledge and insight to advance new therapies. Once the necessary regulatory clearances have been obtained, the clinical translation process can start. Translational research is important because it acts as a filtration system, ensuring that only safe and effective therapeutic approaches start making it to the clinic.23 Recent research illustrating, the successful application of stem cell transplantation to patient populations suggests that, such restorative approaches have been used to address a wide variety of complicated ailments of future concerns.19,24

Currently, clinical trials are available for a variety of stem cell-based treatments based on adult stem cells. To date, the WHO International Clinical Experiments Registration process has recorded more than 3000 experiments involved based on adult stem cells. Furthermore, preliminary trials involving novel and intriguing pluripotent stem cell therapies have been registered. These studies findings will assist the ability to comprehend and the timeframes required to obtain effective treatments and it will contribute to a better knowledge of the different disorders or abnormalities.10

The role of stem cells in modern medicine is vital, both for their widespread application in basic research and for the opportunities they provide for developing new therapeutic strategies in clinical practice.6,16 In recent times, the number of studies involving stem cells has expanded tremendously. Globally, thousands of studies claiming to use stem cells in experimental therapies have now been in the investigation field. This may give the impression that such treatments have already been shown to be extremely effective in the context of healthcare. Despite some promising results, the vast majority of stem cell-based therapeutic applications are still in the experimental stage itself.6,25

The stem cells are a valuable resource for understanding organogenesis as well as the bodys continual regenerative capacity. These cells have brought up enormous anticipations among doctors, investigators, patients, and the public at large because of their ability to distinguish into a variety of cell types.25 These cells are necessary for living beings for a variety of reasons and can play a distinguishable role. Several stem cells can play all cell types roles, and when stimulated effectively, they can also repair damaged tissue. This capability has the potential to save lives as well as treat human injuries and tissue destruction. Moreover, different kinds of stem cells could be used for several purposes, including tissue formation, cell deficiency therapeutic interventions, and stem cell donation or retrieval.3,6,26

New research demonstrating that the successful application of stem cell treatments to patients has expressed hope that such regenerative strategies might very well one day is being used to address a wide variety of problematic ailments. Furthermore, clinical trials incorporating stem cell-based therapeutics have advanced at an alarming rate in recent years. Some of these studies had a significant impact on a wide range of medical conditions.10 As a regenerative medicine strategy, cell-based treatment is widely regarded as the most fascinating field of study in advanced science and medicine. Such technological innovation paves the way for an infinite number of transformational and potentially curable solutions to some of humanitys most pressing survival issues. Moreover, it is gradually becoming the next major concern in medical services.11

Modern data, which shows that the successful stem cell transplantation in beneficiaries has raised hopes on the certain rejuvenating approaches, will one day be used to treat many different types of challenging chronic conditions.24 Preliminary data from highly innovative investigations have documented that the prospective advancement of stem cells provides a wide range of life-threatening ailments that have so far eluded current medical therapy.2,10,11 Furthermore, clinical trials involving stem cell-based therapies have advanced at an unprecedented rate. Many of these studies had a significant impact on various disorders.19 Despite the increasing significance of articles concerning viable stem cell-based treatments, the vast majority of clinical experiments have still yet to receive full authorization for stem cell treatments confirmation.11,12,27

Even though the first case of AIDS were noted nearly 27 years ago, and the etiologic agent was noticed 25 years ago, still for the effective control of the AIDS pandemic continues to remain elusive.28 The HIV epidemic started in 1981 when a new virus syndrome defined by a weakened immune system was revealed in human populations across the globe. AIDS showed up to have a substantial reduction in CD4+ cell counts and also elevated B-cell multiplication.15,2831

The agent that causes AIDS, later named HIV, is a retroviral disease with a genomic structural system made up of 2 identical single-stranded RNA particles.3234 According to the Centres for Disease Control and Prevention, with over 1.1 million Americans are presently infected with the virus.31 Compromised immune processes in HIV and AIDS, as well as partial immune restoration, barriers are confirmed for HIV disease eradication. Innovative developmental strategies are essential to maximizing virus protection and enabling the host immune response to eliminate the virus.35

The progression of HIV infection in humans is divided into the following stages of acute infection, chronic infection, and AIDS.15,36 During the acute infection phase, the circulation has a high viral replication, is extremely infectious, that may or may not demonstrate flu-like clinical signs. In the chronic stage, the viral load is lesser than in the acute stage, and individuals are still infectious but may be symptomless. The patient has come to the end stage of AIDS whenever the CD4+ cell count begins to fall below 200 cells/mm or even when opportunistic infections are advanced.15,36

There are currently two types of HIV isolated HIV-1 and HIV-2.15,37,38 However, HIV-1 is the most common cause of AIDS throughout the world, while HIV-2 is only found in a few areas of an African country. Although both virions can cause AIDS, HIV-2 infection is much more likely to occur in central nervous system disorder.15 Besides this, HIV-2 seems to be less infectious than HIV-1, and HIV-2 infection induces AIDS to develop more slowly. Even though both HIV-1 and HIV-2 have a comparable genetic structure comprised of group-specific antigen, polymerase, and envelope genes, their genome organizational structures are differed.15,3739

HIV infiltrates immune cell types, CD4+ T cell types, and monocytes, resulting in a drop in T-cell counts below a critical level and the failure of cell-mediated immune function.15,40 The glycoprotein (gp120) observed in the virion envelope comes into contact with the CD4 particle with high affinity, allowing HIV to infect T cells. By interacting with their co-receptors, CXCR4 and CCR5, the virus infiltrates T cells and monocytes. The retrovirus uses reverse transcriptase to convert its RNA into DNA after attaching it to and entering the host cell. These newly replicated DNA copies then exit the host cell and infect other cells.15,40,41

HIV-1 is a retrovirus and belongs to a subset of retroviruses known as lentiviruses.38,42 Infection is the most common global health concern around the world.15 It has destroyed the millions of peoples health and continues to wreak havoc on the individual health of millions more. The pandemic of HIV-1 is the most devastating plague in the history of humans, as well as a significant challenge in the areas of medicine, public health, and biological science of research activities.34,43 Antiretroviral therapy is the only treatment that is commonly used. This is not a curative treatment; it must be used for the rest of ones life.15 Although antiretroviral therapy has reduced significantly HIV intensity and transmission, the virus has not been eradicated, and its continued presence can lead to additional health issues.44

Infection with the human immunodeficiency virus necessitates entry into target cells, such as through adhesion of the viral envelope to CD4 receptor sites.43 Cellular antiviral responses fail to eliminate the virus, resulting in a gradual depletion of CD4+ T cells and, finally, a severely compromised immune functioning system. Unfortunately, there is no cure for the virus that destroys immunity.4447 In advanced HIV infection, memory T-cell depletion primarily affects cellular and adaptive immune responses, with a minor impact on innate immune responses.48 Globally, 37.7 million people were living with HIV in 2020, and with 1.5 million individuals are infected with the virus.49 The advancement of stem cell therapy and the conduct of implemented clinical trials have revealed that stem cell treatment has high hopes for a range of medical conditions and implementations.15

Stem cell treatment has shown impressive outcomes in HIV management and has the potential to have significant implications for HIV treatment and prevention in the future. In HIV patients, stem cell therapy helps to suppress the viral load even while enabling antiretroviral regimens to be tapered. Interestingly, this practice led to a significant improvement in procedure outcomes soon after starting antiretroviral treatment.15 Stem cell transplantation can alleviate a wide variety of diseases that are currently incurable. They could also be used to create a novel anti-infection therapy strategic plan and to enhance the treatment of immunologic conditions such as HIV infection. HIV wreaks havoc on immune system cells.30,50

The virus infects and replicates within T-helper cells (T-cells), which are white immune system cells. T-cells are also referred to as CD4 cells. HIV weakens a persons immune system over time by pulverizing more CD4 cells and multiplying itself. More pertinently, if the individual has been unable to obtain anti-retroviral medicine, he will progressively fail to control the infectious disease and illnesses.3,15,42

Despite 36 years of scientific research, investigators are still trying to cure human HIV and its potential problem, AIDS.3,5153 HIV continues to face unconquerable dangers to human survival. This virus has developed the potential to avoid anti-retroviral therapy and tends to result in victim death.52 Investigators are still looking for effective and all-encompassing treatment for HIV and its complexity, AIDS.54 This massive amount of data revealed potential AIDS treatment targets.55 Thousands of research projects have yielded a great deal of information on the elusive AIDS life cycle to date.5456 These massive amounts of data supplied possible targets for AIDS treatment.33,55,56 In HIV-infected patients, using stem cell therapy can augment the process of keeping the viral load stagnant by permitting antiretroviral regimens to be tapered.15

Overall, stem cell-based strategies for HIV and AIDS treatment have recently emerged and have become a key area of research. Ideally, effective stem cell-based therapeutic approaches might have several benefits.30 Clinical studies encompassing stem cell therapy have shown substantial therapeutic effects in the treatment of various autoimmune, degenerative, and genetic problems.15,25 Substantial progress has been developed in the treatment of HIV infection using stem cell-based techniques.30

Successfully treated, clinical studies have shown that total tissue recovery is feasible.15,57 In the early 1980s, the first stem cell transplants were accomplished on HIV-positive patients who were unsure of their viral disease. Following the above preliminary aspects, many HIV-positive patients with concurrent malignant tumours or other hematologic disorders underwent allogeneic stem cell transplantation around the world.42 After ART became a common treatment option for patients,58,59 the procedures prognosis improved dramatically. In addition, a retrospective study of 111 HIV+ transplant patients demonstrated a mildly lower overall survivorship performance in comparison to an HIV-uninfected comparison group.60

Earlier, the primary problem for people living with HIV and AIDS was immunodeficiency caused by a loss of productive T-cells. Some clinicians intended to replenish lost lymphocytes through adoptive cell transplants in the initial days before efficacious antiretroviral therapy options were available. Immunologically, it is relatively simple in an isogeneic condition, as illustrated on HIV-positive individuals with just a correlating identical twin who received T-lymphocytes and stem cell transfusions to rebuild the weak immune status of the patient.60 Cell therapy transfusion may be used to remove resting virion genomes from CD4+ immune cells and macrophages mostly through genome-editing or cytotoxic anti-viral cells.15,60 Cell technology and stem cell biological reprogramming developments have made a significant contribution to novel strategies that may give confidence to HIV healing process.3 However, human embryonic stem cells can be distinguished into significant HIV target cells, according to several research findings.30,61,62

Initially, stem cell transplantation was believed to influence the clinical significance of HIV infection, but viral regulation was not accomplished in the discipline. Moreover, improvements in stem cell transplants utilizing synthetic or natural resistant cell resources, in combination with novel genetic manipulative tactics or the advancement of cytotoxic anti-HIV effector cells, have significantly accelerated this sector of HIV cell management.60 Multiple techniques are being introduced to overcome HIV, either through protecting cells from infectious disease or by continuing to increase immune responses to the viral infection.30 The various methods are as follows: Bone marrow stem cells Therapies, Autologous stem cell transplantations, Hematopoietic stem cell transplantation, Genetical modifications of Hematopoietic stem cells (HSCT), HSCT and HAART therapeutic approach, Human umbilical cord mesenchymal stem cell transplantation, Mesenchymal stem/stromal cells (MSCs) applications, CCR5 Delta32/Delta32 Stem-Cell Transplantation, CRISPR and stem cell applications, Induced Pluripotent Stem Cells applications.

According to the findings, circulating replicative HIV remains the most significant threat to effective AIDS therapy. As a result, a method for conferring resistance to circulating HIV particles is required. The effective viral burden in the human body would be significantly reduced if it were possible to defeat reproducing HIV particles.43,44 For the treatment of AIDS, a restorative approach that relies on bone marrow stem cells has been suggested.52 The proposed treatment method captures and eventually destroys circulating HIVs using receptor-integrated red blood cells. Red blood cell membranes can be equipped with the CD4 receptor and the C-C chemokine receptor type 5 and C-X-C chemokine receptor type 4 co-receptors, which will selectively bind circulating HIV particles.15,30,32,33,43,44,46,6365

The term autologous pertains to blood-forming stem cells obtained from the patient for use as a source of fresh blood cells followed by high-dose chemotherapeutic agents.66 Lymphoma is still the biggest cause of mortality in HIV patients. Autologous stem cell recovery or transplantation with high-dose treatments has long been supported as a treatment for certain types of cancer in HIV-negative patients, including leukaemia and lymphoma. Individuals over the age of 65, as well as those with health problems such as HIV, were excluded from initial transfusion experiments. Moreover, the treatment regimen mortality of transplantation has also been reduced significantly due to its use of peripheral blood stem cells rather than bone marrow and the use of newer marginal conditioning therapeutic strategies. HIV-infected clients may be able to utilize enough stem cells for an autologous transplant advancement in HIV management. High-dose Autologous stem cell transplant (ASCT) treatments are better than conventional treatment in people with relapsed non-Hodgkin lymphoma, according to randomized trial evidence. Similarly, studies on HIV-negative people with Hodgkin Lymphoma have shown that ASCT would provide patients with repetitive illness with long-term progression-free survival.66,67 Even so, the clinical trial on Allogeneic Hematopoietic Cell Transplant for HIV Patients with Hematologic Malignancies report was explained as, the cell-associated HIV DNA and inducible infectious virus were not detectable in the blood of patients who attained complete chimerism.68

The study on long-term multilineage engraftment of autologous genome-edited hematopoietic stem cells in nonhuman primates report findings was Genome editing in hematopoietic stem and progenitor cells (HSPCs) is a potential innovative approach for the treatment of numerous human disorders. This report shows that genome-edited HSPCs engraft and contribute to multilineage repopulation following autologous transplantation in a clinically relevant large animal model, which is an important step toward developing stem cell-based genome-editing therapeutics for HIV and possibly other illnesses.69

Research on comprehensive virologic and immune interpretation in an HIV-infected participant again just after allogeneic transfusion and analytical interruption of antiretroviral treatment findings are the instance of HIV-1 cure having followed allogeneic stem cell transplantation (allo-SCT), resulting allo-SCTs in HIV-1 positive participants have failed to cure the disease. It describes adjustments in the HIV reservoir in a single chronically HIV-infected client who had undergone allo-SCT for acute lymphoblastic leukaemia treatment and was obtaining suppressive antiretroviral treatment.

To estimate the size of the HIV-1 reservoir and describe viral phylogenetic and phenotypic modifications in immune cells, the investigators just used leukapheresis to obtain peripheral blood mononuclear cells (PBMCs) from a 55-year-old man with chronic HIV infection prior and after allo-SCT. Once HIV-1 was found to be unrecognizable by numerous tests, including the PCR measurement techniques both of overall and fully integrated HIV-1 DNA, recompilation virus precise measurement by significant cell input quantifiable viral outgrowth assay, and in situ hybridization of intestine tissue, the client accepted to an analytic treatment interruption (ATI) with recurrent clinical observing on day 784 post-transplantation. He continued to remain aviremic off ART until ATI day 288, once a reduced virus rebound of 60 HIV-1 copies/mL resulted, which expanded to 1640 HIV-1 copies/mL five days later, urging ART reinitiation. Rebounding serum HIV-1 action sequences were phylogenetically distinguishable from pro-viral HIV-1 DNA discovered in circulating PBMCs before transplantation. It was indicated that allo-SCT tends to result in significant reductions in the magnitude of the HIV-1 reservoir and a >9-month ART-free cessation from HIV-1 multiplication.34

The Impact of HIV Infection on Transplant Outcomes after Autologous Peripheral Blood Stem Cell Transplantation: A Retrospective Study of Japanese Registry Data reported as ASCT is a successful treatment option for HIV-positive patients with non-Hodgkin lymphoma and multiple myeloma (MM). HIV infection was associated with an increased risk of overall mortality and relapse after ASCT for NHL in a study population.70

The procedure of delivering hematopoietic stem cells mostly through intravenous infusion to restore normal haematopoiesis or treat cancer is known as hematopoietic stem cell transplantation.71 There has recently been a rise in the desire to develop strategies for treating HIV/AIDS diseases employing human hematopoietic stem cells,30 along with this Hutter and Zaia were evaluated the background of Haematopoietic stem cell transplantation (HSCT) in HIV-infected individuals.42

Attempts to use HSCT as a technique for immunologic restoration in AIDS patients or as a therapeutic intervention for malignant tumours were initially insufficient. Regretfully, in the absence of sufficient ART, HSCT seemed to have no impact on the evolution of HIV infection, and the majority of the patients ended up dead of rapidly deteriorating immunosuppression or reoccurring lymphoma or leukaemia. A specific instance report described how an un-associated, matched donor supplied allogeneic HSCT to a patient with refractory lymphoma. The virus was unrecognizable by isolating or PCR of peripheral blood mononuclear cells commencing on day 32 after transplantation. Although HIV-1 was unrecognizable by cultural environment or PCR of several tissues examined at mortem, the patient died of recurring lymphoma on day 47. Another client who obtained both allogeneic HSCT and zidovudine had similar results, with HIV-1 becoming unnoticeable in the blood by PCR analysis. In some other particular instances, a 25-year-old woman with AIDS who obtained an allogeneic HSCT from a corresponding, unfamiliar donor after controlling with busulfan and cyclophosphamide and ART with zidovudine and IFN-2 regimen continued to live for 10 months before falling victim to adult respiratory distress. However, PCR testing of autopsy tissues revealed that they were HIV-1 negative.72

Recent research discovered significant progress towards the clinical application of stem cell-based HIV therapeutic interventions, principally illustrating the opportunity to effectively undertake a large-scale phase two HSC-based gene therapy experiment. In this investigation, the research team used autologous adult HSCs that had been transduced to a retroviral vector that usually contains a tat-vpr-specific anti-HIV ribozyme to develop cells that were less vulnerable to productive infection,73 whereas vector-containing cells have been discovered for extended periods (more than 100 weeks in most people) and CD4+ T cell gets counted were significantly high within anti-HIV ribozyme treating people group compared with the placebo group, the impacts on viral loads were minimal. The studys success, even so, is based on the realization that a stem cell-based strategy like this is being used as a more conventional and efficacious therapeutic approach.30 Some other latest clinical studies used a multi-pronged RNA-based strategic plan which included a CCR5-targeted ribozyme, an shRNA targeting tat/rev transcripts, and a TAR segment decoy.74

These crucial research findings are explained on lentiviral-based gene therapy vectors that can genetically manipulate both dividing and non-dividing HSCs and are less likely to cause cellular changes than murine retro-viral-based vectors. Long-term engraftment and multipotential haematopoiesis have been demonstrated in vector-containing and expressing cells, according to the researchers. Whereas the antiviral effectiveness was not reviewed, the results demonstrate the strategys protection, which helps to expand well for the possibility of a lentiviral-based approach in the upcoming years.30

A further approach, with a different emphasis, has been started up in the hopes of trying to direct immune function to target specific HIV to overcome barriers to attempting to clear the virus from the patient's body. These strategies use gene treatment innovations on peripheral blood cells to biologically modify cells so that they assert a receptor or chimeric particle that enables them to especially target a specific viral antigen,75 deception of HIV-infected peoples peripheral blood T cells raises issues to be addressed, such as the effects of ongoing HIV infection and ex vivo modification on the capabilities and lifetime of peripheral blood cells. Further to that, the above genetically manipulated cells would demonstrate their endogenous T cell receptors, and the representation of the newly introduced receptor could outcome in cross-receptor pairing, resulting in self-reactive T cells. Most of these deficiencies could be countered by enabling specific developmental strategies to take place that can start generating huge numbers of HIV-specific cells in a renewable, consistent way that can restore defective natural immune activity against HIV.30

One strategy being recognized is the application of B cells obtained from HSCs to demonstrate anti-HIV neutralizing specific antibodies. While animal studies have shown that neutralizing antibodies could protect against infection, and extensively neutralizing antibodies have been noticed in some HIV-infected persons, safety from a single engineered antibody might be exceptional.76,77 Realizing antibody binding and virus neutralization may assist in the development of chimeric receptors or single-chain therapeutic antibodies with recognition domains for other techniques that identify cellular immunity against HIV-infected cells.78,79 Thereby, genetically modifying HSCs to generate B cells that produce neutralizing anti-HIV specific antibodies, or engineering HSCs to enable multipotential haematopoiesis of cells that express a chimeric cellular receptor usually contains an antibody recognition domain, indicate one arm of an HSC-based engineered immunity process.30

A further technique of using HSCs that were genetically altered with molecularly cloned T-cell receptors or chimeric molecules particular to HIV to yield antigen-specific T cells. The basic difference in this strategy is that the cells produced from HSCs after standard advancement in the bone marrow and thymus are made subject to normal central tolerance modalities and are antigen-specific naive cells, and therefore do not have the ex-vivo manipulation and impaired functioning or exhaustion problems that other external cell modification methods would have. In this context, the latest actual evidence research using a molecularly cloned T cell receptor particular to an HIV-1 Gag epitope in the aspect of HLA-A*0201 revealed that HSC altered in this ability can progress into fully functioning, mature HIV specialized CD8+ T cells in human thymic tissue that conveys the acceptable constrained HLA-A*0201 particles.80 This explores the possibility of genetically engineering HSCs with a molecularly cloned receptor and signifies a step toward a better understanding and application of initiated T cell responses, which would probably result in the eradication of HIV infection from the body, similar to the natural immune function of other virus infections and pathogenic organisms.30

In an allogeneic transplantation, donor stem cells replace the patients cells.66 Allogeneic hematopoietic stem cell transplantation (HSCT) has appeared as one of the most potent treatment possibilities for many people who suffer from hemopoietic system carcinomas and non-malignant ailments.81 Both HIV-cured people have received HSCT utilizing CCR5 132 donor cells.82,83 This implies that HIV eradication necessitates a decrease in the viral reservoir through the myeloablative procedures,8486 Having followed that, immune rebuilding with HIV-resistant cells was carried out to prevent re-infection.45 The possibility of adoptive transfer of ex vivo-grown, virus-specific T-cells to prevent and control infectious diseases (eg, Cytomegalovirus and EBV) in immunocompromised patients helps to make adoptive T-cell treatment a feasible strategy to inhibit HIV rebound having followed HSCT.81,87,88

The Engineered Zinc Finger Protein Targeting 2LTR Inhibits HIV Integration in Hematopoietic Stem and Progenitor Cell-Derived Macrophages: In Vitro Study, the researchers investigated the efficacy and safety of 2LTRZFP in human CD34+ HSPCs. Researchers used a lentiviral vector to transduce 2LTRZFP with the mCherry tag (2LTRZFPmCherry) into human CD34+ HSPCs. The study findings suggest that the anti-HIV-1 integrase scaffold is an enticing antiviral molecule that could be utilised in human CD34+ HSPC-based gene therapy for AIDS patients.89

The fundamental element of HIV management is stem cell genetic modification, which involves genetically enhanced patient-derived stem cells to overcome HIV infection. In this sector, numerous experimental studies, in vitro as well as in vivo examinations, and positive outcomes for AIDS patients have been conducted.65,74 Genetic engineering for HIV-infected individuals can provide a once-only intervention that minimizes viral load, restores the immune system, and minimizes the accumulated toxicities concerned with highly active antiretroviral therapy (HAART).73 HSCs can be genetically altered, permitting for the addition of exogenous components to the progeny that protects them from direct infectious disease and/or enables them to target a specific antigen. Besides that, HSC-based strategies can enhance multilineage hemopoietic advancement by re-establishing several arms of the immune function. Eventually, as HSCs can be produced autologously, immunologic tolerance is typically high, enabling effective engraftment and subsequent distinction into the fully functioning mature hematopoietic cells.30

The utilization of human HSCs to rebuild the immune function in HIV disease is one application that tries to preserve newly formed cells from HIV infection, while another attempts to develop immune cells that attack HIV infected cells. While each initiative has many different aspects at the moment, they represent huge attention to HIV/AIDS therapies that, most likely when integrated with the other therapeutic approaches, would result in the body trying to overcome the obstacles needed for the virus to be effectively cleaned up.30

While HSC transplantation technique and processes are not accurately novel, as they are commonly and effectively used to address a wide variety of haematological diseases and malignant neoplasms,90 trying to combine them with a gene therapeutic strategy represents a unique and possibly potent therapeutic approach for HIV and AIDS-related ailments. As the results of HIV-infected patients who obtained autologous HSCT continued to improve, there was growing interest in genetically altered stem cells that were tolerant to HIV disease. Multiple logistical challenges have impeded the advancement of genetically modified hematopoietic stem cells as a conceivable therapeutic option for HIV/AIDS.72,73

UCLAs Eli and Edythe Broad Center for Restorative Medicine and Stem Cell Studies is one bit closer to constructing an instrument to arm the bodys immune system to attack and defeat HIV. Dr. Kitchen et al are the first ones to disclose the use of a chimeric antigen receptor (CAR), a genetically manipulated molecule, in blood-forming stem cells. In the experiment, the research team introduced a CAR gene into blood-forming stem cells, which were then moved into HIV-infected mice that had been genetically programmed. The scientists found that CAR-carrying blood stem cells efficiently transformed into fully functioning T cells that have the ability to kill HIV-infected cells in mice. The outcome was an 80-to-95 percentage reduction in HIV levels, suggesting that stem-cell-based genetic engineering with a CAR might be a viable and effective approach for treating HIV infection among humans. The CAR initiative, according to Dr. Kitchen, is much more able to adapt and ultimately more efficient, which can conceivably be used by others. If any further experiment showcases keep promising, the scientists expect that a practice based on their strategy will be accessible for clinical development within the next 510 years.91

HSCT and HAART therapeutic approaches in treating HIV/AIDS as the emergence of highly active antiretroviral therapy (HAART) in the 1990s improved survival rates of HIV infection, leading to a major dramatic drop in the occurrence of AIDS and AIDS-related mortalities. As an outcome, there is much less involvement with using HSCT as a therapy for HIV infection.28,33,43,67,86

A randomized clinical trial of human umbilical cord mesenchymal stem cell transplant among HIV/AIDS immunological non responders investigation, the researchers examined the clinical efficacy of transfusion of human umbilical cord mesenchymal stem cells (hUC-MSC) for immunological non-responder clients with long-term HIV disease who have an unmet medical need in the aspect of effective antiretroviral therapy. From May 2013 to March 2016, 72 HIV-infected participants were admitted in this stage of the randomized, double-blind, multi-center, placebo-controlled dose-determination investigation. They were either given a high dose of hUC-MSC of 1.5106/kg body weight as well as small doses of hUC-MSC of 0.5106/kg body weight, or a placebo application. During the 96-week follow-up experiment, interventional and immunological character traits were analysed. They found that hUC-MSC therapy was both safe and efficacious among humans. There was a significant rise in CD4+ T counts after 48 weeks of treatment in both the high-dose (P 0.001) and low-dose (P 0.001) groups, but no changes in the comparison group.92

One interesting invention made by a team of UC Davis investigators is the recognition of a particular form of stem cell that can minimize the quantity of the virus that tends to cause AIDS, thus dramatically increasing the bodys antiviral immune activity. Mesenchymal stem/stromal cells (MSCs) furnish an incredible opportunity for a creative and innovative, multi-pronged HIV cure strategic plan by augmenting prevailing HIV potential treatments. Even while no antivirals have been used, MSCs have been able to increase the hosts antiviral responses. MSC therapeutic approaches require specialized delivery systems and good cell quality regulation. The studys findings lay the proper scientific foundation for future research into MSC in the ongoing treatment of HIV and other contagious diseases in the clinical organization.35

Infection with HIV-1 necessitates the existence of both specific receptors and a chemokine receptor, particularly chemokine receptor 5 (CCR5).46 Resistance to HIV-1 infection is attained by homozygozygozity for a 32-bp removal in the CCR5 allele.93 In this investigation, stem cells were transplanted in a patient with severe myeloid leukaemia and HIV-1 infection from a donor who was homozygous to Chemokine receptor 5 delta 32. The client seemed to have no viral relapses after 20 months of transplantation and attempting to stop antiretroviral medicine. This finding highlights the essential role that CCR5 tries to play in HIV-1 infection maintenance.86

In comparison, additional HIV-1-infected people who have received allogeneic stem cell transplants with cells from CCR5 truly wild donors did not have long-term relapses from HIV-1 rebound, with 2 of these patients trying to report viral reoccurrence 12 as well as 32 weeks after analytic treatment interruption, respectively. Among these 2 patients, allogeneic stem cell transplantation probably reduced but did not eliminate latently HIV-infected cells, enabling persistent viral reservoirs to activate viral rebound. This viewpoint may not rule out the potential that allogeneic hematopoietic stem cell transplantation might result in a much more comprehensive or near-complete elimination of viral reservoirs, enabling long-term drug-free relapse of HIV-1 infection in some contexts.84 As just one report demonstrated a decade earlier, a curative treatment for HIV-1 remained elusive. The Berlin Patient has undergone 2 allogeneic hematopoietic stem cell transplantations to cure his acute myeloid leukaemia utilizing a potential donor with a homozygous genetic mutation in HIV coreceptor CCR5 (CCR532/32).15,34,46,64,65,72,82,84,86,9496 Other similar studies with CCR5 receptor targets are as follows: Automated production of CCR5-negative CD4+-T cells in a GMP compatible, clinical scale for treatment of HIV-positive patients,97 Mechanistic Models Predict Efficacy of CCR5-Deficient Stem Cell Transplants in HIV Patient Populations,98 Conditional suicidal gene with CCR5 knockout.99

Clustered regularly interspaced short palindromic repeats CRISPR/Cas9 is a promising gene editing approach that can edit genes for gain-of-function or loss-of-function mutations in order to address genetic abnormalities. Despite the fact that other gene editing techniques exist, CRISPR/Cas9 is the most reliable and efficient proven method for gene rectification.100103

Genome engineering employing CRISPR/Cas has proven to be a strong method for quickly and accurately changing specific genomic sequences. The rise of innovative haematopoiesis research tools to examine the complexity of hematopoietic stem cell (HSC) biology has been fuelled by considerable advancements in CRISPR technology over the last five years. High-throughput CRISPR screenings using many new flavours of Cas and sequential and/or functional outcomes, in specific, have become more effective and practical.104,105

The power of the CRISPR/Cas system is that it can specifically and efficiently target sequences in the genome with just a single synthetic guide RNA (sgRNA) and a single protein. Cas9 is directed to the specific DNA sequence by the sgRNA, which causes double stranded breaks and activates the cells DNA repair processes. Non-homologous end joining can cause insertiondeletion (indel) substitutions at the target location, whereas homology-directed repair can use a template DNA to insert new genetic material.104,106

The possibility for CRISPR/Cas9 to be used in the hematopoietic system was emphasised as pretty shortly after it was initiated as a new genome editing method.106,107 The efficiency with which CRISPR-mediated alteration can be used to evaluate hematopoietic stem/progenitor and mature cell function via transplantation. As a result, hematopoietic research has significantly advanced with the implementation of these technologies. Whilst single-gene CRISPR/Cas9 programming is a significant tool for testing gene function in primary hematopoietic cells, high-throughput screenings potentially offer CRISPR/Cas9 an even greater advantage in hematopoietic research.104

While understanding human haematological disorders requires the ability to mimic diseases, the ultimate goal is to transfer this innovation into therapies. Despite significant advancements in CRISPR technology, there are still barriers to overcome before CRISPR/Cas9 can be used effectively and safely in humans. CRISPR has also been used to target CCR5 in CD34+ HSPCs in an effort to make immune cells resistant to HIV infection, as CCR5 is an important coreceptor for HIV infection.104

CRISPR is a modern genome editing technique that could be used to treat immunological illnesses including HIV. The utilization of CRISPR in stem cells for HIV-related investigation, on the other end, was ineffective, and much of the experiment was done in vivo. The new research idea is about increasing CRISPR-editing efficiencies in stem cell transplantation for HIV treatment, as well as its future perspective. The possible genes that enhance HIV resistance and stem cell engraftment should be explored more in the future studies. To strengthen HIV therapy or resistance, double knockout and knock-in approaches must be used to build a positive engraftment. In the future, CRISPR/SaCas9 and Ribonucleoprotein (RNP) administration should be explored in the further investigations.108 As well as some different title studies were explained the effectiveness of the CRISPR gene editing technology on the management of HIV/AIDS including: CRISPR view of hematopoietic stem cells: Moving innovative bioengineering into the clinic,104 CRISPR-Edited Stem Cells in a Patient with HIV and Acute Lymphocytic Leukaemia,109 Sequential LASER ART and CRISPR Treatments Eliminate HIV-1 in a Subset of Infected Humanized Mice,110 Extinction of all infectious HIV in cell culture by the CRISPR-Cas12a system with only a single crRNA,111 HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells,112 CRISPR-Cas9 Mediated Exonic Disruption for HIV-1 Elimination,113 RNA-directed gene editing specifically eradicates latent and prevents new HIV-1 infection,114 CRISPR/Cas9 Ablation of Integrated HIV-1 Accumulates Pro viral DNA Circles with Reformed Long Terminal Repeats,115 CRISPR-Cas9-mediated gene disruption of HIV-1 co-receptors confers broad resistance to infection in human T cells and humanized mice,116 Inhibition of HIV-1 infection of primary CD4+ T-cells by gene editing of CCR5 using adenovirus-delivered CRISPR/Cas9,117 Transient CRISPR-Cas Treatment Can Prevent Reactivation of HIV-1 Replication in a Latently Infected T-Cell Line,118 CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection,119 CRISPR/Cas9-Mediated CCR5 Ablation in Human Hematopoietic Stem/Progenitor Cells Confers HIV-1 Resistance In Vivo.109

Induced pluripotent stem cells (iPSCs) have significantly advanced the field of regenerative medicine by allowing the generation of patient-specific pluripotent stem cells from adult individuals. The progress of iPSCs for HIV treatment has the potential to generate a continuous supply of therapeutic cells for transplantation into HIV-infected patients. The title of the study is reported on Generation of HIV-1 Resistant and Functional Macrophages from Hematopoietic Stem Cellderived Induced Pluripotent Stem Cells. In this investigation, researchers used human hematopoietic stem cells (HSCs) to produce anti-HIV gene expressing iPSCs for HIV gene therapy. HSCs were dedifferentiated into constantly growing iPSC lines using 4 reprogramming factors and a combination anti-HIV lentiviral vector comprising a CCR5 shRNA and a human/rhesus chimeric TRIM5 gene. After directing the anti-HIV iPSCs toward the hematopoietic lineage, a large number of colony-forming CD133+ HSCs were acquired. These cells were distinguished further into functional end-stage macrophages with a normal phenotypic profile. Upon viral challenge, the anti-HIV iPSC-derived macrophages displayed good protection against HIV-1 infection. Researchers have clearly shown how iPSCs can establish into HIV-1 resistant immune cells and explain their prospective use in HIV gene and cellular therapies.120

Some other similar titles of the studies reported on the effectiveness of IPSCs on HIV/AIDS managements are as follows: Generation of HIV-Resistant Macrophages from IPSCs by Using Transcriptional Gene Silencing and Promoter-Targeted RNA,121 Generation of HIV-1-infected patients gene-edited induced pluripotent stem cells using feeder-free culture conditions,122 A High-Throughput Method as a Diagnostic Tool for HIV Detection in Patient-Specific Induced Pluripotent Stem Cells Generated by Different Reprogramming Methods,123 Genetically edited CD34+ cells derived from human iPS cells in vivo but not in vitro engraft and differentiate into HIV-resistant cells,124 Engineered induced-pluripotent stem cell-derived monocyte extracellular vesicles alter inflammation in HIV humanized mice,125 Sustainable Antiviral Efficacy of Rejuvenated HIV-Specific Cytotoxic T Lymphocytes Generated from Induced Pluripotent Stem Cells.126

Recently, one HIV patient appeared to be virus-free after having undergone a stem-cell transfusion in which their WBCs were changed with HIV-resistant variations.84 Timothy Ray Brown also noted as the Berlin patient, who is still virus-free, was the first individual to undertake stem-cell transplantation a decade earlier. The most recent patient, like Brown, had a type of leukaemia that was vulnerable to chemo treatments. They required a bone marrow transplantation, which involved removing their blood cells and replacing them with stem cells from a donor cell.5,31,34,41,127130 Rather than simply choosing a suitable donor, Ravindra Gupta et al chose one who already had 2 copies of a mutant within the CCR5 gene,128,131 which provides resistance to HIV infection.3

Additionally, this gene encodes for a specific receptor of white blood cells that are assisted in the bodys immunological responses. The transplant, according to Guptas team, completely replaced the clients White cells with HIV-resistant forms.41,83 Cells in the patients blood disrupted expressing the CCR5 receptor, making it unfeasible for the clients form of HIV to infect the above cells again. The scientists determined that the virus had been cleared from the patients blood after the transplantation. Besides that, after 16 months, the client has withdrawn antiretroviral treatment. The infection was not detected in the most recent follow-up, which occurred 18 months after the treatment was discontinued. Adam, also known as the London patient, was the second person to be cured of HIV as a result of a stem cell transfusion. This discovery is an important step forward in HIV research because it may aid in the detection of potential future therapeutic interventions. It must be noted, but even so, that this is not an extensively used HIV treatment. For HIV-infected patients, antiretroviral drugs have been the foremost therapeutic option.3,31,41,94,129,130 It also encourages many investigators and clinicians to look at the use of stem cells in the treatment of a wide range of serious medical conditions. The reprogramming abilities of stem cells, as well as their accessibility, have created a window of opportunity in medical research. The clinical utility of stem cells is forecast to expand rapidly in the coming years.

On Feb 15, 2022, scientific researchers confirmed that a woman had become the 3rd person in history to be successfully treated for HIV, the virus that causes AIDS, after just receiving a stem-cell transfusion that has used cells from cord blood. Within those transplant recipients, adult hematopoietic stem cells have been used; these are stem cells that eventually develop into all blood cell types, which include white blood cells, these are a vital component of the immune framework. Even so, the woman who had fairly recently been completely cured of HIV infection had a more unique experience than that of the 2 men who were actually cured before her.132

The clients physician, Dr. JingMei Hsu of Weill Cornell Medicine in New York, informed them that, she had been discharged from the hospital just 17 days after her procedure was performed, even with no indications of graft vs host ailment. The woman was HIV-positive but also had acute myeloid leukaemia, a blood cancer of the bone marrow that affects blood-forming cells. She had likely received cord blood as a successful treatment for both her cancer and HIV once her doctors decided on a potential donor well with HIV-blocking gene mutation. Cord blood comprises a high accumulation of hematopoietic stem cells; the blood is obtained during a childs birth and donated by the parents.132

The patients donor was partly nearly matched, and she received stem cells from a close family member to enhance her immune function after the transfusion. The procedure was performed on the woman in August of 2017. She chose to discontinue taking antiretroviral drugs, the standardized HIV intervention, 37 months upon her transfusion. After more than 14 months, there is no evidence of the viral infection or antibodies against it in her blood. Umbilical cord blood, in reality, is much more commonly accessible and simpler to try to match to beneficiaries than bone marrow. Perhaps, some research suggests that the method could be more available to HIV patients than bone marrow transplantation. Nearly 38 million people worldwide are infected with HIV. The potential for using partly matched umbilical cord blood transplantation increases the chances of choosing appropriate suitable donors for these clients considerably.132

It is really exciting to see the earlier terminally ill diseases of being effectively treated. In recent times, there has been a surge of focus on stem cell research.3 Stem cell therapy advancements in inpatient care are receiving a growing amount of attention.20 HIV/AIDS has been and remains a significant health concern around the world. Effective control of the HIV pandemic will necessitate a thorough understanding of the viruss transmission.32

Despite concerns about full compliance and adverse reactions, HAART has demonstrated to be able to succeed and is a sign specifically targeted form of treatment against HIV advancement. As illustrated by the first case of HIV infection relapse attained by bone marrow transplant, anti-HIV HPSC-based stem cell treatment and genotype technology have established a possible future upcoming technique to try to combat HIV/AIDS.

Investigators have conducted experiments with engineering distinct anti-HIV genetic traits trying to target different phases of HIV infection utilizing advanced scientific modalities. In numerous in vivo and in vitro animal studies, HSPCs and successive mature cells were secured from HIV infection by trying to target genetic factors in the infection. Anti-HIV gene engineering of HSPCs is safe and efficacious.15

The number of stem-cell-based research trials has risen in recent years. Thousands of studies claiming to use stem cells in experimental therapies have been registered worldwide. Despite some promising results, the majority of clinical stem cell technologies are still in their early life. These achievements have drawn attention to the possibility of the potential and advancement of various promising stem cell treatments currently in development.11

HIV remains a major danger to humanity. This virus has developed the ability to evade antiretroviral medication, resulting in the death of individuals. Scientists are constantly looking for a treatment for HIV/AIDS that is both effective and efficient.52 The 1st treatments in HIV+ clients were conducted in the early 1980s, even though they were cognizant of their viral disease. Following these early cases, allogeneic SCT was used to treat HIV+ patients with associated cancer or other haematological disorders all over the world. Stem cell transplantation developments have also stimulated the improvement of innovative HIV therapeutic approaches, especially for large goals like eradication and relapse.60

Numerous stem cell therapy progressions have been recognized with autologous and allogeneic hematopoietic stem cell transplantation, as well as umbilical cord blood mesenchymal stem cell transplant in AIDS immunologic non-responders. Whereas this sector continues to advance and distinguishing directives for these cells become much more effective, totipotent stem cells such as hESC and the recently reported induced pluripotent stem cells (iPSC) could be very useful for genetic engineering methods to counter hematopoietic abnormalities such as HIV disease.133135

Immunocompromised people are at a higher risk of catching life-threatening diseases. The perseverance of latently infected cells, which is formed by viral genome inclusion into host cell chromosomes, is a significant challenge in HIV-1 elimination. Stem cell therapy is producing impressive patient outcomes, illustrating not only the broad relevance of these strategies but also the huge potential of cell and gene treatment using adult stem cells and somatic derivative products of pluripotent stem cells (PSCs).

Stem cells have enormous regeneration capacity, and a plethora of interesting therapeutic uses are on the frontier. This is a highly interdisciplinary scientific field. Evolutionary biologists, biological technicians, mechanical engineers, and others that have evolved novel concepts and decided to bring them to medical applications are required to make important contributions. Further to that, recent advancements in several different research areas may contribute to stem cell application forms that are novel. Several hurdles must be conquered, however, in the advancement of stem cells. On the other hand, this discipline appears to be a promising and rapidly expanding research area.

Stem cell-based approaches to HIV treatment resemble an innovative approach to trying to rebuild the ravaged bodys immune system with the utmost goal of eliminating the virus from the body. We will probably see effective experiments from the next new generation of stem cell-based strategies shortly, which will start serving as a base for the further development and use of these techniques in a range of treatment application areas for other chronic diseases.

My immense pleasure was mentioned to family members and friends, who supported and encouraged me in every activity.

There was no funding for this work.

The authors declare that they have no conflicts of interest in relation to this work.

1. Zakrzewski W, Dobrzyski M, Szymonowicz M, Rybak Z. Stem cells: past, present, and future. Stem Cell Res Ther. 2019;10:68. doi:10.1186/s13287-019-1165-5

2. Nadig RR. Stem cell therapy hype or hope? A review. J Conserv Dent JCD. 2009;12:131138. doi:10.4103/0972-0707.58329

3. Tasnim KN, Adrita SH, Hossain S, Akash SZ, Sharker S. The prospect of stem cells for HIV and cancer treatment: a review. Pharm Biomed Res. 2020;6:1726.

4. Weissman IL. Translating stem and progenitor cell biology to the clinic: barriers and opportunities. Science. 2000;287:14421446. doi:10.1126/science.287.5457.1442

5. Pernet O, Yadav SS, An DS. Stem cellbased therapies for HIV/AIDS. Adv Drug Deliv Rev. 2016;103:187201. doi:10.1016/j.addr.2016.04.027

6. Kolios G, Moodley Y. Introduction to stem cells and regenerative medicine. Respir Int Rev Thorac Dis. 2013;85:310.

7. Ebrahimi A, Ahmadi H, Ghasrodashti ZP, et al. Therapeutic effects of stem cells in different body systems, a novel method that is yet to gain trust: a comprehensive review. Bosn J Basic Med Sci. 2021;21:672701. doi:10.17305/bjbms.2021.5508

8. Introduction stem cells. Available from: https://www.dpz.eu/en/platforms/degenerative-diseases/research/introduction-stem-cells.html. Accessed December 19, 2021.

9. Hu J, Chen X, Fu S. Stem cell therapy for thalassemia: present and future. Chin J Tissue Eng Res. 2018;22:3431.

10. Aly RM. Current state of stem cell-based therapies: an overview. Stem Cell Investig. 2020;7:8. doi:10.21037/sci-2020-001

11. Chari S, Nguyen A, Saxe J. Stem cells in the clinic. Cell Stem Cell. 2018;22:781782. doi:10.1016/j.stem.2018.05.017

12. De Luca M, Aiuti A, Cossu G, Parmar M, Pellegrini G, Robey PG. Advances in stem cell research and therapeutic development. Nat Cell Biol. 2019;21:801811. doi:10.1038/s41556-019-0344-z

13. Hipp J, Atala A. Sources of stem cells for regenerative medicine. Stem Cell Rev. 2008;4:311. doi:10.1007/s12015-008-9010-8

14. Bobba S, Di Girolamo N, Munsie M, et al. The current state of stem cell therapy for ocular disease. Exp Eye Res. 2018;177:6575. doi:10.1016/j.exer.2018.07.019

15. Khalid K, Padda J, Fernando RW, et al. Stem cell therapy and its significance in HIV infection. Cureus. 2021;13. doi: 10.1038/d41586-019-00798-3

16. Gq D, Morrell CN, Tarango C. Stem cells: roadmap to the clinic. J Clin Invest. 2010;121:120. doi:10.1172/JCI39828

17. Prentice DA. Adult Stem Cells. Circ Res. 2019;124:837839. doi:10.1161/CIRCRESAHA.118.313664

18. McKee C, Chaudhry GR. Advances and challenges in stem cell culture. Colloids Surf B Biointerfaces. 2017;159:6277. doi:10.1016/j.colsurfb.2017.07.051

19. Prez Lpez S, Otero Hernndez J. Advances in stem cell therapy. In: Lpez-Larrea C, Lpez-Vzquez A, Surez-lvarez B, editors. Stem Cell Transplantation. New York, NY: Springer US; 2012:290313.

20. Zhang F-Q, Jiang J-L, Zhang J-T, Niu H, X-Q F, Zeng -L-L. Current status and future prospects of stem cell therapy in Alzheimers disease. Neural Regen Res. 2020;15:242250. doi:10.4103/1673-5374.265544

21. Hu L, Zhao B, Wang S. Stem-cell therapy advances in China. Hum Gene Ther. 2018;29:188196. doi:10.1089/hum.2017.224

22. Tadlock D Stem cell basics introduction; 19.

23. Poulos J. The limited application of stem cells in medicine: a review. Stem Cell Res Ther. 2018;9:1. doi:10.1186/s13287-017-0735-7

24. Madl CM, Heilshorn SC, Blau HM. Bioengineering strategies to accelerate stem cell therapeutics. Nature. 2018;557:335342. doi:10.1038/s41586-018-0089-z

See the rest here:
PROMISING STEM CELL THERAPY IN THE MANAGEMENT OF HIV & AIDS | BTT - Dove Medical Press

Global Mesenchymal Stem Cells Market Size is expected to be worth USD 2,600.5 million by 2027, with a CAGR of 7.1% over the forecasting years, according to Acumen Research & Consulting

The development of stem cell therapies to address serious medical conditions has significantly increased in recent years. In this regard, consistent advancement in the environment of stem cell treatments is expected to drive tremendous attention in the mesenchymal stem cells market. The market for mesenchymal stem cells is expected to increase dramatically in the future years. Extensive Research and development activities based on mesenchymal stem cells are propelling the markets rapid potential expansion. These cells are also being employed increasingly frequently in tissue engineering. As a result of many factors, the global mesenchymal stem cells market is expected to see new demand possibilities in the coming years.

Mesenchymal stem cells (MSCs) are multipotent stem cells, which can capable of converting into a variety of cellular structures such as adipocytes, chondrocytes, osteoblasts, and myocytes. MSCs have the ability to drastically alter their environment, demonstrating anti-fibrotic and anti-inflammatory properties while secreting chemicals that enhance the tissue healing. MSCs are advantageous to other stem cell technologies for a number of purposes, especially its immune-privileged status, which makes them a suitable cell type for allogenic transplantation. Moreover, mesenchymal stem cells (MSCs) comprise intimal cells that have the ability to self-renew and develop into a variety of lineages. It can be isolated from a variety of tissues, including endometrial polyps, bone marrow, menstrual blood, adipose tissue, and the umbilical cord. It is the most commonly used cell type in regenerative medicine to address neurological issues, diabetes, heart ischemia, and musculoskeletal and cartilage disorders.

Get Free Sample Report Copy : https://www.acumenresearchandconsulting.com/request-sample/2629

Global Mesenchymal Stem Cells Market Dynamics

The increasing utilization of mesenchymal stem cells (MSCs) in the aged population for the treatment of different diseases and disabilities is favorably impacting the global mesenchymal stem cell market size. The increasing medicinal evaluation of mesenchymal stem cells for the dealing of various illness, including musculoskeletal and cartilage disorders, and autoimmune problems, is expected to drive the global mesenchymal stem cells market growth. As per the investigation, these stem cells promote angiogenesis in the heart and help to reduce chronic inflammation. Pre-clinical investigations for employing mesenchymal stem cells to address cardiovascular disorders, liver ailments, and tumors are expected to open up overseas customers for the mesenchymal stem cells market trend. Furthermore, due to the regenerative potential, ease of separation, and immunoregulatory features of these stem cells, mesenchymal stem cell therapy has emerged as a feasible technique for the treatment of inflammatory, chronic, degenerative, and autoimmune diseases.

Rising Drug Discovery and Development activities around the globe are Fueling the Market Growth

Stem cell biology is a rapidly expanding field of study that has made substantial contributions to a wide range of scientific disciplines, including tissue regeneration and cell therapy treatment. In recent years, one of the most promising applications of mesenchymal stem cell biology has been drug discovery and development. Stem cells are quickly being exploited in creative ways to improve medication research, with applications ranging from academic circles to biotechnological start-ups to major pharmaceutical companies. Mesenchymal stem cells (MSCs) have the potential to be a valuable tool in drug discovery and development, as indicated by their ability to impact immune system response.

Report Customization: https://www.acumenresearchandconsulting.com/request-customization/2629

Market Segmentation

According to Acumen Research and Consulting, the global mesenchymal stem cells industry is fragmented into application, and product type. By application, the segment has been classified into myocardial and cardiovascular infarction, drug discovery and development, injuries, and others. By product type, the segment is further segmented into rat, mouse, human, and others.

Mesenchymal Stem Cells Market Regional Overview

The mesenchymal stem cells industry is divided into five regions including Asia-Pacific, Europe, North America, Latin America, as well as the Middle East and Africa. According to the mesenchymal stent cells market forecast, the North American region is expected to gain a significant market share in the coming periods. Increased utilization for clinical trials, medication research, and development, as well as the safety and efficacy of mesenchymal stem cells for chronic conditions, are driving market expansion in North America. Furthermore, organizations are concentrating on monetizing mesenchymal stem cells and delivering them to successful disease recovery treatment. This crucial element will continue to drive market expansion in North America over the anticipated timeframe.

Furthermore, the Asia-Pacific region is expected to experience considerable growth in the global market. Factors contributing to the regions growth include increased use of stem cell treatments as a result of consumers low expendable income and limited financial assistance for high-end procedures, which is expected to raise the use of mesenchymal stem cells technologies throughout the projected timeframe.

Get Premium Report Copy For This : https://www.acumenresearchandconsulting.com/buy-now/0/2629

Mesenchymal Stem Cells Market Players

Some of the significant mesenchymal stem cells market companies are R&D Systems, Inc., Axol Bioscience, Cytori Therapeutics, Inc., BrainStorm Cell Therapeutics Inc., Stemedica Cell Technologies, Inc., Cell Applications, Inc., Cyagen Biosciences, STEMCELL Technologies Inc., and Celprogen, Inc.

About Acumen:

Acumen Research and Consulting is a global provider of market intelligence and consulting services to information technology, investment, telecommunication, manufacturing, and consumer technology markets. ARC helps investment communities, IT professionals, and business executives to make fact based decisions on technology purchases and develop firm growth strategies to sustain market competition. With the team size of 100+ Analysts and collective industry experience of more than 200 years, Acumen Research and Consulting assures to deliver a combination of industry knowledge along with global and country level expertise.

Contact Us:

Mr. Frank WilsonAcumen Research and ConsultingUSA: +13474743864India: +918983225533E-mail:[emailprotected]

See more here:
Mesenchymal Stem Cells Market Size is Projected to Reach at USD 2600.5 Million by 2027 at a CAGR of 7.1%, Driven by Rising Prevalence of Hepatitis...

This bone marrow market report provides details of new recent developments, trade regulations, import export analysis, production analysis, value chain optimization, market share, impact of domestic and localised market players, analyses opportunities in terms of emerging revenue pockets, changes in market regulations, strategic market growth analysis, market size, category market growths, application niches and dominance, product approvals, product launches, geographic expansions, technological innovations in the market. To gain more info on the bone marrow market contact Data Bridge Market Research for anAnalyst Brief,our team will help you take an informed market decision to achieve market growth.

The bone marrow market is expected to gain market growth in the forecast period of 2021 to 2028. Data Bridge Market Research analyses that the market is growing with the CAGR of 5.22% in the forecast period of 2021 to 2028 and is estimated to reach 13,899.60 USD Million by 2028. The growing amount of bone marrow diseases will help in escalating the growth of the bone marrow market. Bone marrow transplant also referred to as hematopoietic stem cell. It is a soft vascular tissue present in the interior of long bones. It comprises of two types of stem cells, that are hematopoietic and mesenchymal stem cells. Bone marrow is mainly responsible for the haematopoiesis, (formation of blood cells), production of lymphocytes, and the storage of fats. The bone marrow transplant is the last alternative generally recommended by the physicians in the cases of fatal bone marrow diseases and bone or skin cancer.

Get a Sample PDF of the report https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-bone-marrow-market

Major factors that are boosting the growth of the bone marrow market in the forecast period are the growing of the incidences of non-Hodgkin and Hodgkin lymphoma, thalassemia, and leukemia, along with the common bone marrow diseases around the world, the developments in the technology and the enhancing of the healthcare infrastructure. Furthermore, the advancing signs of bone marrow transplant for heart and neuronal disorders, increasing funding in the logistic services and the growing per capita of the healthcare expenses are some of the other factors anticipated to further propel the growth of the bone marrow market in the coming years. However, the high expenditure for the treatment, shortage of the bone marrow donors and instability of the repayment are few of the factors further responsible for the impeding the growth of the bone marrow market in the near future.

Bone MarrowMarket Scope and Market Size

The bone marrow market is segmented on the basis of transplantation type, disease indication and end user. The growth amongst these segments will help you analyse meagre growth segments in the industries, and provide the users with valuable market overview and market insights to help them in making strategic decisions for identification of core market applications.

To Gain More Insights into the Market Analysis, Browse Summary of the Research Report@ https://www.databridgemarketresearch.com/reports/global-bone-marrow-market

Bone MarrowMarket Country Level Analysis

The bone marrow market is analysed and market size insights and trends are provided by country, transplantation type, disease indication and end user as referenced above. The countries covered in the bone marrow market report are the U.S., Canada and Mexico in North America, Germany, France, U.K., Netherlands, Switzerland, Belgium, Russia, Italy, Spain, Turkey, Rest of Europe in Europe, China, Japan, India, South Korea, Singapore, Malaysia, Australia, Thailand, Indonesia, Philippines, Rest of Asia-Pacific (APAC) in the Asia-Pacific (APAC), Saudi Arabia, U.A.E, South Africa, Egypt, Israel, Rest of Middle East and Africa (MEA) as a part of Middle East and Africa (MEA), Brazil, Argentina and Rest of South America as part of South America.

Europe dominates the bone marrow market because of the occurrence of the increasing number of innovative healthcare centers. Furthermore, the healthcare systems have introduced the bone marrow transplant in their contributions and the state-of-the-art public facilities which will further boost the growth of the bone marrow market in the region during the forecast period. North America is projected to observe significant amount of growth in the bone marrow market because of the growing cases of chronic diseases such as blood cancer. Moreover, the increasing of the geriatric population is one of the factors anticipated to propel the growth of the bone marrow market in the region in the coming years.

The country section of the bone marrow market report also provides individual market impacting factors and changes in regulation in the market domestically that impacts the current and future trends of the market. Data points such as consumption volumes, production sites and volumes, import export analysis, price trend analysis, cost of raw materials, down-stream and upstream value chain analysis are some of the major pointers used to forecast the market scenario for individual countries. Also, presence and availability of global brands and their challenges faced due to large or scarce competition from local and domestic brands, impact of domestic tariffs and trade routes are considered while providing forecast analysis of the country data.

Competitive Landscape and Bone MarrowMarket Share Analysis

The bone marrow market competitive landscape provides details by competitor. Details included are company overview, company financials, revenue generated, market potential, investment in research and development, new market initiatives, global presence, production sites and facilities, production capacities, company strengths and weaknesses, product launch, product width and breadth, application dominance. The above data points provided are only related to the companies focus related to bone marrow market.

The major players covered in the bone marrow market report are AGendia, Agilent Technologies, Inc., Ambrilia Biopharma Inc., Astellas Pharma Inc., diaDexus, Illumina, Inc., QIAGEN, F Hoffmann-La Roche Ltd, Sanofi, Stryker Corporation, PromoCell GmbH, STEMCELL Technologies Inc., Lonza, ReachBio LLC, AllCells, ATCC, Lifeline Cell Technology., Conversant bio, HemaCare, Mesoblast Ltd., Merck KGaA, Discovery Life Sciences., ReeLabs Pvt. Ltd., Gamida Cell, among other domestic and global players. Market share data is available for global, North America, Europe, Asia-Pacific (APAC), Middle East and Africa (MEA) and South America separately. DBMR analysts understand competitive strengths and provide competitive analysis for each competitor separately.

Browse the complete table of contents at https://www.databridgemarketresearch.com/toc/?dbmr=global-bone-marrow-market

Related Reports:

Allogenic Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/global-allogenic-stem-cell-therapy-market

Cancer Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/global-cancer-stem-cell-therapy-market

North America Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/north-america-stem-cell-therapy-market

Europe Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/europe-stem-cell-therapy-market

Asia-Pacific Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/asia-pacific-stem-cell-therapy-market

Middle East and Africa Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/middle-east-and-africa-stem-cell-therapy-market

Asia-Pacific Drug-Device Combination Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/global-drug-device-combination-market

About Data Bridge Market Research:

An absolute way to forecast what future holds is to comprehend the trend today! Data Bridge Market Research set forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge endeavours to provide appropriate solutions to the complex business challenges and initiates an effortless decision-making process. Data Bridge is an aftermath of sheer wisdom and experience which was formulated and framed in the year 2015 in Pune.

Data Bridge Market Research has over 500 analysts working in different industries. We have catered more than 40% of the fortune 500 companies globally and have a network of more than 5000+ clientele around the globe. Data Bridge adepts in creating satisfied clients who reckon upon our services and rely on our hard work with certitude. We are content with our glorious 99.9 % client satisfying rate.

Contact Us:-

Data Bridge Market Research

US: +1 888 387 2818

UK: +44 208 089 1725

Hong Kong: +852 8192 7475

Email:- corporatesales@databridgemarketresearch.com

View post:
Bone Marrow Market Global Projection By Key Players AGendia, Agilent Technologies, Inc., Ambrilia Biopharma Inc Analysis and Forecast to 2028 ...

Animals

All animal experiments were performed in accordance with the institutional guidelines of the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University (Kyoto, Japan), and all experimental protocols were approved by the same institute. The reporting in this manuscript followed the recommendations in the ARRIVE guidelines. For euthanasia, mice were intraperitoneally administrated with a mixture of Medetomidine (0.3mg/kg body weight), Midazolam (4mg/kg body weight), and Butorphanol (5mg/kg body weight). SM22-Cre mice(Tg (Tagln-cre)1Her/J, Stock# 004746) and dual fluorescent membrane-localized tdTomato/eGFP (mT/mG) mice (B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato, -EGFP)Luo/J, Stock# 007676) were purchased from the Jackson Laboratory. SM22 -Cre mice were bred with flox mT/mG mice to produce mT/mGflox/wt: SM22-Cre+(SM22mT/mG) mice. For embryos, SM22 -Cre mice were paired overnight with flox mT/mG mice. The morning after mating was considered 0.5days post-coitus (dpc).

Male and female SM22mT/mG mice, 610weeks of age, were used as the cell source. CFs were isolated as described previously26. Media and buffers were prepared according to a previous paper26. The descending aortas and inferior venae cavae were cut. The hearts were perfused with EDTA buffer from the right ventricle. The ascending aortas were clamped. The clamped hearts were removed, transferred to a dish containing EDTA buffer, and perfused with EDTA buffer from the left ventricle (LV). The hearts were transferred to a dish of perfusion buffer, and perfused with perfusion buffer from the LV. The hearts were transferred to a dish of collagenase buffer and perfused with collagenase buffer from the LV. The ventricles were transferred to the other dish of collagenase buffer, gently teased apart into pieces, and triturated. Stop solution was added to the cell-tissue cell suspension. The supernatants obtained via gravity settling three times for 10min in perfusion buffer were collected as nonCMs. The nonCMs were centrifuged at 300g for 5min, resuspended in DMEM containing 10% fetal bovine serum (FBS) and penicillinstreptomycin (Wako, #168-23191), plated on cell culture dishes and cultured for 67days. Almost all cells were fibroblasts after the culture.

Bone marrow was extracted from the femurs and tibias of euthanized mice and differentiated in bone marrow macrophage differentiation media (RPMI 1640 containing 10% fetal bovine serum (FBS), penicillinstreptomycin, 20g/mL recombinant mouse M-CSF (Biolegend, #576404), and 0.1mM/L 2-mercaptoethanol (Wako, #133-14571)). Seven days after being harvested, BMDMs were stimulated with recombinant mouse TGF-1 (Biolegend, # 763102) for 1 or 7days, for RNA or for Flow cytometric analysis, respectively. To investigate whether Cre-recombination occurs during the differentiation process from HSCs to BMDMs, bone marrow cells were harvested and cultured in bone marrow macrophage differentiation media containing with TGF-.

Hearts in 6-week-old mice were perfused with cold phosphate-buffered saline (PBS) and 4% paraformaldehyde, removed, and fixed with 4% paraformaldehyde (PFA) for 3h. The hearts of Embryos at 17.5 dpc were removed, washed with cold PBS and fixed with 4% PFA for 3h. The hearts were incubated in 10%, 20% and 30% sucrose diluted in PBS. The samples were then embedded in OCT compound (Sakura Finetek Japan), frozen and stored at 80. Cryosections (8m thick) were obtained using a Leica cryostat.

For immunofluorescence analysis, sections were first washed with PBS, permeabilized with PBS containing 0.1% Triton-X, and washed with PBS containing 0.1% Tween 20. The sections were then incubated in blocking buffer (PBS containing, 0.1% Tween 20, 1% BSA, and 10% normal donkey serum (Jackson ImmunoResearch, #017-000-121)) for 1h at room temperature. Primary antibodies diluted in blocking buffer were added and incubated overnight at 4. The following primary antibodies were used: anti-SMA (1:100) (Goat, Novus Biologicals, #NB300-978), anti-Vimentin (1:100) (rabbit, Cell Signaling Technology, #5741S), anti-CD68 (1:200) (rat, Bio Rad, #MCA1957GA), and anti-CD31 (1:100) (rabbit, Novus Biologicals, # NB100-2284). Then, the slides were washed three times in PBS containing 0.1% Tween 20 for 5min each, and incubated with Alexa Fluor 647 (ThermoFisher, #A-31573 or Abcam, #ab150155) or Alexa Fluor Plus 680 (ThermoFisher, #A32860) against the appropriate species (diluted at 1:500) for 1h at room temperature. The slides were washed three times in cold PBS for 5min each. Finally, the slides were mounted with VECTASHIELD Antifade Mounting Medium with DAPI (Vector Laboratories, #H-1200-10).

Immunofluorescence images were acquired on an Axio Observer (Carl Zeiss) (5objective) or SP8 Falcon (Leica) (63objective) and analyzed with Zen software (Carl Zeiss) or LAS X (Leica), respectively.

Single cardiac cell suspensions were generated as described previously27. Hearts were perfused with cold PBS and finely minced and digested in Hanks Balanced Salt Solution (HBSS) with Collagenase 2 (500 U/ml) (Worthington Biochemical, #LS004176) for 30min at 37C. Next, the hearts were digested in HBSS with Collagenase/Dispase (1mg/mL) (Merck, #11097113001) for 20min at 37C. To deactivate the enzymes, the samples were washed with cold HBSS. The solutions were passed through a 40m cell strainer (Corning, #352340). Red blood cell lysis was performed with ACK lysis buffer (0.16M ammonium chloride, 10mM Potassium bicarbonate and 0.1mM EDTA). The samples were washed with FACS buffer (HBSS with 25mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 2% FBS and 2mM ethylenediaminetetraacetic acid (EDTA)) and resuspended in 300 L of FACS buffer. Heart samples were blocked with TruStain FcX Plus (0.5 L/100 L) (Biolegend, #156604) for 5min at 4.

Peripheral blood samples were collected from the inferior vena cava of anesthetized mice using a heparin-contained syringe. Red blood cell lysis was performed with ACK lysis buffer. The samples were washed with FACS buffer and resuspended. Peripheral blood samples were blocked with TruStain FcX Plus for 5min at 4.

Bone marrow cells were obtained by flushing femurs and tibias with RPMI supplemented with 25mM HEPES and 10% FBS. The suspensions were passed through a 40m cell strainer. After the red blood cells were lysed, the samples were washed with FACS buffer and resuspended.

BMDMs were collected after harvesting as described before and were blocked with TruStain FcX Plus for 5min at 4.

Cells were stained with monoclonal antibodies at 4C for 20min in the dark. The samples were washed twice, and the final resuspension was made in 500 L of FACS buffer. 7-AAD was used to exclude dead cells. Flow cytometric analysis was performed on BD FACS ARIAII platforms. Complete lists of antibodies and flow cytometry gating strategies are provided in Supplementary Tables 1 and 2, respectively.

Total RNA was isolated and purified using TRIzol reagent (ThermoFisher), and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, #FSQ-301) in accordance with the manufacturer's instructions. For quantitative real-time PCR (qRTPCR), specific genes were amplified using 40 cycles with Thunderbird SYBR qPCR mix (Toyobo, #QPS-201) and StepOnePlus (ThermoFisher). Expression was normalized to the housekeeping gene18rS. Gene-specific primers are described as follows:

18rS forward, CTCAACACGGGAAACCTCAC; 18rS reverse, AGACAAATCGCTCCACCAAC; Tagln forward, CAACAAGGGTCCATCCTACGG; Tagln reverse, ATCTGGGCGGCCTACATCA; Acta2 forward, TGACGCTGAAGTATCCGATAGA; Acta2 reverse, CGAAGCTCGTTATAGAAAGAGTGG; Col1a1 forward, AATGGCACGGCTGTGTGCGA; and Col1a1 reverse, AACGGGTCCCCTTGGGCCTT.

For the Flow cytometric analysis, the lines represent the means and standard error of the samples. Differences between two groups were compared by Students t test as a parametric comparison test. For the RTPCR experiments, one-way ANOVA followed by Tukeys test was performed for multiple comparisons. The bars represent mean of the samples. The analysis and plots were generated using the ggplot2 package and R software. A P value<0.05 was considered statistically significant.

More:
Smooth muscle protein 22-Cre recombination in resting cardiac fibroblasts and hematopoietic precursors | Scientific Reports - Nature.com

The Global Rheumatoid Arthritis Stem Cell Therapy Market is replete with new growth opportunities and expansion avenues. There has been an increase in the use of products and services falling under the ambit of Rheumatoid Arthritis Stem Cell Therapy, giving a thrust to the growth of the global Rheumatoid Arthritis Stem Cell Therapy market. The unprecedented use of these products can be attributed to the increasing paying capacity of the masses.

Furthermore, in the absence of robust or utilitarian alternatives, the demand within the global Rheumatoid Arthritis Stem Cell Therapy market is projected to reach new heights of recognition. It is worthwhile to mention that the global Rheumatoid Arthritis Stem Cell Therapy market is treading along a lucrative pathway due to favorable government legislations.

To get in-depth insights Request for Brochure here https://www.factmr.com/connectus/sample?flag=B&rep_id=1001

The COVID-19 pandemic has changed narratives related to growth and expansion across several key industries. Therefore, the Rheumatoid Arthritis Stem Cell Therapy market is also battling the cons of supply chain disruptions and procurement issues. Over the course of the next quarter, market players could be investing in new technologies to recover from the shocks of the pandemic.

The global market for rheumatoid arthritis stem cell therapy is highly fragmented. Examples of some of the key players operating in the global rheumatoid arthritis stem cell therapy market include Mesoblast Ltd., Roslin Cells, Regeneus Ltd, ReNeuron Group plc, International Stem Cell Corporation, TiGenix and others.

Through the latest research report on Rheumatoid Arthritis Stem Cell Therapy market, the readers get insights on:

Share Your Requirements & Get Customized Reports: https://www.factmr.com/connectus/sample?flag=RC&rep_id=1001

Tentatively, the global rheumatoid arthritis stem cell therapy market can be segmented on the basis of treatment type, application, end-user, and geography.

Based on treatment type, the global rheumatoid arthritis stem cell therapy market can be segmented into:

Based on application, the global rheumatoid arthritis stem cell therapy market can be segmented into:

Based on the distribution channel, the global rheumatoid arthritis stem cell therapy market can be segmented into:

Based on geography, the global rheumatoid arthritis stem cell therapy market can be segmented into:

The study further identifies major manufacturing trends, technologies that will be commercialized

Reasons to choose a Fact.MR:

For In-depth Analysis & Business Strategy, Buy a Copy of this Report: https://www.factmr.com/checkout/1001

About Fact. MR

Market research and consulting agency with a difference! Thats why 80% of Fortune 1,000 companies trust us for making their most critical decisions. We have offices in US and Dublin, whereas our global headquarter is in Dubai. While our experienced consultants employ the latest technologies to extract hard-to-find insights, we believe our USP is the trust clients have in our expertise. Spanning a wide range from automotive & industry 4.0 to healthcare & retail, our coverage is expansive, but we ensure even the most niche categories are analyzed. Reach out to us with your goals, and well be an able research partner.

Contact:US Sales Office :11140 Rockville PikeSuite 400Rockville, MD 20852United StatesTel: +1 (628) 251-1583E-Mail:sales@factmr.com

Corporate Headquarter:Unit No: AU-01-H Gold Tower (AU),Plot No: JLT-PH1-I3A,Jumeirah Lakes Towers,Dubai, United Arab Emirates

Read more:
Growing Prevalence & Recurrence Of Rheumatoid Arthritis Is Expected To Growth Of The Rheumatoid Arthritis Stem Cell Therapy Market Designer Women...

Theglobal cell therapy marketsize was valued atUSD 8.1 billion in 2021and is estimated to reachUSD 23.9 billion by 2030, growing at a CAGR of 14.5% over the forecast period. The development of precision medicine and advancements in cellular therapies in context to their efficiency & manufacturing are expected to be major drivers for the market. Moreover, the development of stem cell banking facilities and resultant enhancement of stem cells production, storage, and characterization are also expected to improve the volumetric capabilities of the market at a global level, which is anticipated to directly translate into revenue for this market at a larger level. Ongoing technological advancements in the parent and ancillary markets for stem and non-stem cells usage are expected to reinforce the demand over the forecast period. There are fewer commercialized cellular therapy products in the current market than the number of research products. This is partly due to stringent regulations and the high cost of stem cells.

Get Full PDF Sample Copy of Report:https://www.marketstatsville.com/request-sample/cell-therapy-market

Cell lines, such as Induced Pluripotent Stem Cells (iPSC) and human Embryonic Stem Cells (hESC) are recognized as having high growth potential; as a result, many research entities and companies are making significant investments in R&D pertaining to iPSC- and hESC-derived products.

Pricing of stem cell transplantation varies from region to region. For instance, the cost of transplantation in the U.S. is higher than that in Germany or China. In March 2018, Alofisel by TiGenix received approval for marketing in Europe. This was the first allogeneic stem cell therapy to be approved in Europe. Furthermore, revenue for certain products varies for the country; for instance, products like INVOSSA received approval for marketing in Korea but have yet to receive marketing authorization in the U.S. Growth is also influenced by the commercialization of unauthorized stem cell treatments revenue generation.

Global Cell Therapy Market Definition

Therapy in which viable cells are injected, grafted, or implanted into a patient to effectuate a medicinal effect is known ascell therapy; for instance, In immunotherapy, T-cells capable of fighting cancer cells via cell-mediated immunity are transplanted, and stem cells are grafted to regenerate diseased tissues.

Cellular therapies hold a great therapeutic promise across various clinical applications. This has resulted in substantial global investments in research and their clinical translation. Rapid advances in stem cell research have the potential to fulfill the unmet demand of pharmaceutical entities, biotech entities, and doctors in disease management. Several unknown therapies are in clinical development.

Furthermore, government and private funding agencies are constantly offering grants to support projects at various stages of clinical trials, increasing the number of ongoing clinical trials.

Research on human embryonic stem cells is ethically controversial. Harvesting embryonic stem cells involves the destruction of human embryos, raising a moral concern. In addition, stringent regulations for obtaining Intellectual Property Rights (IPR) for products or materials used in research are major restraints for commercializing these services. Ethical approval should be obtained to store cell lines and tissues in biorepositories to avoid the usage of tissue for illegal purposes or to identify proxy diseases to claim insurance. Moreover, controversies surrounding the use of embryonic stem cells for research impede the market growth in several regions

The study categorizes the cell therapy market based on use type and therapy type at the regional and global levels.

The analysis of the cell therapy market is based on the use of stem cells for clinical and research purposes. The research-use segment dominated the market for the global cell therapy market and accounted for the largest revenue share of 58.3% in 2021. Currently, cell therapies (stem & non-stem cells) are majorly being used for research projects, which in turn, has led to a large revenue share of this segment in 2021. Cell-based therapies are all possibilities for the replacement, repair, restoration, and regeneration of damaged tissues, cells, and organs. As an alternative to traditional treatment strategies, researchers are investing heavily in developing effective and safe cell-based treatments.

As per the CGT Catapult database of clinical trials, 59 cell and gene therapy trials are ongoing in the UK. Out of all therapeutic areas, oncology has the highest number of ongoing clinical trials. T cells, CD34+ and CD133+ stem cells, mesenchymal stem/stromal cells are some predominantly employed cell types for clinical investigation. Neural cells, bone marrow mononuclear cells, fibroblasts, cornea cells, antigen-presenting cells, epithelial cells, and chondrocytes are some other cells that are being explored for the development of cell therapies.

Make an Enquire before Purchase @:https://www.marketstatsville.com/buy-now/cell-therapy-market?opt=2950

Asia Pacificaccounts for the highestCAGR during the forecast period

Based on the regions, the global cell therapy market has been segmented across North America, AsiaPacific, Europe, South America, and the Middle East & Africa.In the Asia Pacific, the market for cell therapy is anticipated to witness a lucrative growth rate of 15.5% over the forecast period. Advancements in stem cell therapy in Asian countries are observed to be better than those in the U.S. This has resulted in Asia leading stem cell research. Several stem cell consortiums in Asian countries aim to ensure coordinated and focused R&D programs. Moreover, patients from western countries migrate to Asian countries for treatment, owing to the flexible legal framework.

Companies from Japan, South Korea, India, China, Taiwan, Singapore, and the rest of Asia were active participants in the conference. In addition, the large regional population and untapped potential present in the region have resulted in global firms entering the market. Moreover, this region offers relatively inexpensive manufacturing & operating units for conducting research. These factors are expected to play a major role in expanding the stem cell market in this region.

The cell therapy market is mildly concentrated in nature with few numbers of global players operating in the market such as Kolon TissueGene, Inc., Anterogen Co., Ltd., JCR Pharmaceuticals Co., Ltd., Castle Creek Biosciences, Inc., MEDIPOST, Osiris Therapeutics, Inc., PHARMICELL Co., Ltd, Tameika Cell Technologies, Inc., Cells for Cells, NuVasive, Inc., Vericel Corporation, and Celgene Corporation.

Request for Complete TOC and Figures & Graphs @https://www.marketstatsville.com/table-of-content/cell-therapy-market

Originally posted here:
Cell Therapy Market With Manufacturing Process and CAGR Forecast by 2030 Designer Women - Designer Women

Returning home after a Fathers Day trip to New York City with his daughter in 2016, Scott Kesel thought he had come down with the flu. Bloodwork showed his blood platelets were lower than normal. He followed up with his regular physician and was given the news: he had chronic myelomonocytic leukemia (CMML).

CMML is a rare type of blood cancer that starts in the bone marrow, where blood cells are made. It can involve other areas of the body. There are only about 1,100 cases in the U.S. each year and its more common in people over age 60.

As a Canandaigua resident, Scott started his cancer journey at Wilmot Cancer Institutes Sands Cancer Center at F.F. Thompson. His oncologist laid out all the options: chemo and a stem cell transplant.

Knowing he would need a transplant, his team at Sands had him transfer to Wilmots Hematology team, where he began seeing Jason Mendler, M.D., and his transplant doctor, Omar Aljitawi, M.B.B.S.

He had chemotherapy at Wilmot, where he got to know the infusion nursing staff.

They have put a mindset in place thats so beneficial to the patient, he says.

For a stem cell transplant, his brother was the closest match they could find, although he was only a half-match. That left the option for a haplo-identical transplant available. Historically, it was required to have a closer match in order to do a transplant. With a haploidentical transplant, the donor is only half-matched. Its a newer procedure that is not available at all transplant centers, but the doctors at Wilmot have been performing the surgery since 2015.

He underwent the transplant but, unfortunately, in Scotts case, it didnt work.

For a short period, Scott went to another institution for a clinical trial. Unfortunately, that didnt work either. He developed pancreatitis and had to drop out of the trial. He also experienced cold agglutinin disease, which caused his immune system to attack his red blood cells. Cold temperatures can trigger it and he had to stay at Wilmot for about a month in a temperature-controlled room, set at 80 degrees at all times, to overcome it.

Once that resolved, the team at Wilmot suggested another treatment option to try on Scotts leukemia: a transplant with stem cells from an umbilical cord donation. Umbilical cord blood stem cells came from Australia and Spain to try to save Scotts life. He had only two cord blood units available and he needed both to have a successful transplant, which was his only viable chance to potentially cure his leukemia. Along with the cord blood, he also had radiation therapy with Louis Constine, M.D.

He had nothing but good things to say about the team that took care of him while he was hospitalized on Wilmot Cancer Centers sixth floor, the Blood and Marrow Transplant Unit.

It was exceptional. They were so friendly and accommodating right from the very beginning, he says. It wasnt limited to nurses. Theres medical technicians on the floor that were so friendly and became very good friends.

Scott Kesel (right) with Jason Mendler, M.D., at the 2019 Wilmot Warrior Walk

Thankfully, this time the transplant took. As of June 2022, Scott has been in remission for three-and-a-half years. He credits his team for getting him there.

Its an incredible group of people, he says.

But its not just his team hes grateful for. He appreciates that his life has returned basically back to normal, despite the tumultuous COVID pandemic that happened shortly after his transplant.

Hes gotten back to work and to hobbies he enjoys outside work.

I happen to be the worlds greatest tuba playing car salesman, he jokes.

This summer and fall, he has 28 gigs lined up, with different music groups around the region to keep him busy, and he looks forward to hunting and fishing during his free time.

For it all, he feels fortunate.

You have to be grateful for the outcome, he says. I got a lot of support remotely from people in my community who used the opportunity to promote bone marrow registration and blood drives, which was awful nice.

He adds, Im grateful that I ended up at Wilmot. I really couldnt have been in a better place.

Original post:
'World's Greatest Tuba-Playing Car Salesman' Bounces Back after Leukemia, Thanks to Wilmot Team - URMC

Preclinical evaluation of FasT CAR-T cellsFasT CAR-T (F-CAR-T) proliferation in vitro

To characterize the in vitro proliferative capacity of F-CAR-T cells, F-CAR-T and C-CAR-T cells were manufactured in parallel (Supplementary Methods, and Fig. S1) using T-cells from 6 B-ALL patients. To investigate the ex vivo proliferation of F-CAR-T, frozen CD19 F-CAR-T and C-CAR-T cells from each patient were thawed and stimulated with irradiated CD19-expressing K562 cells. The number of CD19-targeting CAR-T cells was then determined during the course of cell expansion in vitro. As shown in Fig. 1A, upon CD19 antigen stimulation, F-CAR-T proliferation was much more robust compared to C-CAR-T proliferation. On day 17 post co-culture, F-CAR-T expanded 1205.61226.3 fold (MeanSD), while C-CAR-T expanded only 116.437.2 fold (MeanSD), (p=0.001). To characterize the mechanism underlying the superior proliferative ability of F-CAR-T, we purified CD19+ CAR-T cells from both F-CAR-T and C-CAR-T. The expression of genes involved in cell proliferation, cell cycle, and apoptosis was analyzed using Nanostring (detailed gene sets are in Table S2). Gene expression profiles showed higher F-CAR-T expression scores for genes associated with cell cycle regulation (F-CAR-T vs. C-CAR-T, p<0.01) and lower expression scores for apoptosis-related genes (F-CAR-T vs. C-CAR-T, p<0.05) in F-CAR-T cells (Fig. S2A).

A Ex vivo cell proliferation of F-CAR-T and C-CAR-T derived from B-ALL patients (n=6) (***P=0.001, F-CAR-T vs. C-CAR-T, d17, unpaired student two-tailed t-test). B Tscm, Tcm, and Tem were characterized by surface staining of CD45RO and CD62L and analyzed with flow cytometry (***P<0.001 comparing F-CAR-T and C-CAR-T). C T-cell exhaustion was characterized by PD-1, LAG3, and TIM-3 staining; Statistical analyses of the percentage of PD1+ LAG3+ Tim3+ (***P<0.001, comparing F-CAR-T and C-CAR-T), unpaired student two-tailed t-test). D RTCA assay was used to examine the specific killing of HeLa-CD19 cells. Growth of target HeLa-CD19 or HeLa cells were monitored dynamically. E CD19+ target Nalm6-Luc cells or F Raji-Luc cells were co-cultured with either F-CAR-T or C-CAR-T for 6h. Target cell killing efficacy was calculated by luciferase activity. NS, P>0.05 F-CAR-T vs. C-CAR-T (unpaired student t-test, two-tailed). F-CAR-T FasT CAR-T, C-CAR-T conventional CAR-T, Tcm (CD45RO+CD62L+) T central memory cells, Tem (CD45RO+CD62L) T effector memory cells, Tscm (CD45ROCD62L+) T stem cell memory, PD1 programmed cell death protein 1, TIM-3 T cell immunoglobulin and mucin domain containing-3, LAG3 lymphocyte-activation gene 3, RTCA real-time cell analyzer, E:T effector cells: target cells, NT normal T-cell.

Phenotypes of unstimulated F-CAR-T from three healthy donors were analyzed by flow cytometry. The CD45ROCD62L+ population was 45.7%2.2% which was comparable to the un-transduced T-cells (data not shown). Upon stimulation with CD19+ tumor cells for 9 days, C-CAR-T central memory cells (Tcm, CD45RO+CD62L+ and effector memory cells (Tem, CD45RO+CD62L) were 56.62%11.97% and 40.48%9.70%, respectively, among the C-CAR-T cells (Fig. 1B and Figs. S2B and S2). In contrast, Tcm cells (87.92%4.36%) was predominant in F-CAR-T, with only a small fraction of Tem (7.84%3.79%). In addition, F-CAR-T cells demonstrated more abundant T stem cell memory (Tscm) (3.841.22% vs 2.342.48%, p<0.05) than C-CAR-T cells. We also examined the exhaustion status of the stimulated CAR-T cells. A higher percentage of PD-1+LAG3+Tim3+T-cells were detected in the C-CAR-T (11.19%2.54%) compared to F-CAR-T (3.59%2.51%, p<0.001) (Fig. 1C). Together these data indicated that the F-CAR-T exhibited a younger phenotype and was less exhausted compared to C-CAR-T.

We used a real-time cell analyzer (RTCA) assay to measure the cytotoxicity of F-CAR-T and C-CAR-T against CD19+ cells in vitro. F-CAR-T and C-CAR-T killing of Hela-CD19 target cells were comparable using this assay (Fig. 1D). Similar levels of IFN- and IL-2 production were also observed (Fig. S2D). In a luciferase-based cytotoxicity assay, CD19+ B leukemia cell lines, Raji and Nalm6, were both effectively killed to similar or better levels at different E:T ratios (Fig. 1E, F).

To compare the in vivo cytotoxicity of F-CAR-T and C-CAR-T, severe immunodeficient NOG mice were engrafted with Raji-luciferase cells. One week after the tumor grafts were established, F-CAR-T and C-CAR-T were intravenously injected at various doses. The engrafted tumors progressed aggressively in control groups with either vehicle alone or control T-cells (Fig. 2A). In contrast, F-CAR-T or C-CAR-T treatment greatly suppressed tumor growth in a dose-dependent manner (Fig. 2A). In the high dose group (2106/mice), both F-CAR-T and C-CAR-T eliminated the tumor rapidly. However, in the low dose group (5105/mice), F-CAR-T showed more effective tumor-killing compared to C-CAR-T. On day 20, mice in the low dose F-CAR-T group became tumor-free, while C-CAR-T treated mice exhibited tumor relapse (Fig. 2A). We examined the CAR-T cell expansion in vivo after infusion. As shown in Fig. 2B, both F-CAR-T and C-CAR-T began to expand in the peripheral blood 7 days after infusion. C-CAR-T cell numbers reached their peak on day 14 and receded on day 21. In contrast, the F-CAR-T cell number peaked on day 21 and declined to a baseline level on day 28. F-CAR-T not only persisted longer but also underwent 26 folds greater expansion than C-CAR-T (Fig. 2B).

A Raji-Luc cell engraftment NOG mice were given high dose (2106/mice, n=3) and low dose (5105/mice, n=3) F-CAR-T/C-CAR-T along with control groups. Tumor growth was monitored with IVIS scan once every 3 days; B CAR-T expansion in peripheral blood of mice was analyzed by flow cytometry (n=6). ***P<0.001 for F-CAR-T HD vs. C-CAR-T HD; F-CAR-T LD vs. C-CAR-T LD; F-CAR-T HD vs. F-CAR-T LD; C-CAR-T HD vs. C-CAR-T LD (two-way ANOVA statistical analysis); C Schematic of the Nalm6 (1106) xenograft model, CAR-T (2106) infused 1 day after cyclophosphamide (20mg/kg) treatment. Bone marrow infiltration of F-CAR-T was analyzed 10 days after CAR-T infusion (n=3); D CD45+CD2 F-CAR-T vs. C-CAR-T in peripheral blood of mice were analyzed by flow cytometry; *P<0.05 (unpaired student two-tailed t-test). IVIS in vivo imaging system, PB peripheral blood, i.v. intravenous, HD high dose, LD low dose, Cy cyclophosphamide; *p<0.05; #: number.

We examined the BM infiltration of F-CAR-T cells after infusion into Nalm6-bearing mice (Fig. 2C). A larger population of CAR-T cells was observed 10 days after infusion in BM in F-CAR-T infused group than that in the C-CAR-T group (p<0.05) (Fig. 2D), suggesting F-CAR-T cells possessed a better BM homing capability than C-CAR-T.

The chemokine receptor CXCR4 is known to be critical for BM homing of T-cells [25, 26]. Indeed, a higher percentage of CXCR4+ T cells were detected in F-CAR-T than in the C-CAR-T. Interestingly, this phenotype was more pronounced for CD4+ T cells than CD8+ T cells (Fig. S3A). In a two-chamber system, more F-CAR-T cells could be detected in the lower chamber than their C-CAR-T counterparts (Fig. S3B).

Between Jan. 2019 and Oct. 2019, 25 pediatric and adult patients with CD19+R/R B-ALL were enrolled onto our phase 1 trial, including two patients who had relapsed following a prior allo-HSCT. Patient characteristics are detailed in Table 1. The median age of patients was 20 (range: 344) years old. Twenty patients were >14 years old, and five were 14 years old. The median percentage of pre-treatment BM blasts was 9.05% (range: 0.1982.9%). As our pre-clinical studies demonstrated that F-CAR-T cells had a superior expansion capability as compared to C-CAR-T, we infused a relatively low doses of F-CAR-T cells, ranging from 104105 cells/kg: 3.0104 cells/kg (n=2), 6.5 (5.867.43)104 cells/kg (n=9), 1.01 (1.01.16)105 cells/kg (n=12), 1.52(1.471.56)105 cells/kg (n=2), (Fig. S4). The median time from apheresis to the infusion of CD19+F-CAR-T cells was 14 days (range: 1220). Although the manufacturing time of F-CAR-T was next day, the quality control time and detailed final product releases including sterility testing require a minimum of 710 days to complete. In addition, transportation of cell products requires approximately two days. Of the 25 patients who received CD19 F-CAR-T infusion, 22 (88%) received bridging chemotherapy between apheresis and lymphodepleting chemotherapy to control rapid disease progression (Table S3).

F-CAR-T cells were manufactured successfully for all patients. The mean transduction efficiency of F-CAR-T was 35.4% (range: 13.170.3%) (Fig. S5A). Both CD4+/CAR+ (mean, 49.6%; range: 13.673.2%) and CD8+/CAR+ (mean, 41.5%; range: 20.677.7%) subsets were present in the CD3+CAR+ T cell subsets of all products. The mean proportion of Tscm, Tem, and Tcm cells in the CD3+CAR+ T cell subsets of all products was 23.3% (range: 3.5545.3%), 33.2% (range: 17.267.9%), and 36.1% (range: 20.758.1%), respectively (Fig. S5B). F-CAR-T products exerted significant IFN- release and cytotoxic effects against the CD19+ cell line HELA-CD19 (Fig. S5, C, D).

All 25 infused patients experienced adverse events (AEs) of any grade, with 25 (100%) experiencing grade 3 or higher adverse events. No grade 5 events related to F-CAR-T treatment were observed (Table 2).

CRS occurred in 24 (96%) patients with 18 (72%) grade 12 CRS,6 (24%) of grade 3, and no grade 4 or higher CRS (Fig. S6). In the >14 years old group, 16/20 (80%) patients developed mild CRS, and only 2/20 (10%) developed grade 3 CRS. For 14 years old patients, 2/5 (40%) had mild CRS, yet 3/5 (60%) experienced grade 3 CRS (Table S4). ICANS was observed in 7 (28%) patients, with 2 (8%) grade 3 ICANS occurring in patients >14 years old and 5 (20%) grade 4 ICANS all occurring in patients 14 years old. No grade 5 ICANS was developed (Fig. S7 and Table S4). The most frequent presentation of CRS was fever, particularly a high fever of >39C. The first onset of CRS symptoms occurred between day 3 and 8 post-CAR-T infusion with a median onset at day 4 (range: 110 days). The most common symptoms of ICANS were seizure (5/7) and depressed consciousness (5/7). The median time to ICANS onset from CAR-T cell infusion was 7 days (range: 58), and the median time to resolution was 2 days (Fig. S7). All CRS and ICANS events were managed including early intervention when fever of 39C persisted for 24h. Sixteen (64%) patients received tocilizumab with a median total dose of 160mg (range: 160320mg). Twenty-one (84%) patients received corticosteroids including dexamethasone (median total dose, 43mg; range: 4127mg) and or methylprednisolone (median total dose, 190mg; range: 401070mg). The vast majority of these patients discontinued corticosteroids within 2 weeks. The change in IL-6, IFN-, IL-10, and GM-CSF levels after infusion are selectively shown in Fig. S8. The peak levels of these four cytokines were observed between day 710. Among all 21 cytokines examined, only post-infusion IL-6 levels were associated with moderate to severe CRS and/or ICANS (Figs. S9 and S10).

Superior in vivo proliferation and persistence of F-CAR-T compared to C-CAR-T cells were observed regardless of dose levels. The median peak level was reached on day 10 (range: 714 days) with 1.9105 transgene copies/g of genomic DNA (range: 0.225.2105 transgene copies/g of genomic DNA) by qPCR and 83 F-CAR-T cells per l blood (range: 42102 F-CAR-T cells per l blood) by FCM (Fig. 3A, B). No significant differences were observed among the different dose groups in the mean F-CAR-T copies peak (Fig. 3C). Importantly, there was no significant difference in the mean F-CAR-T copies peak between patients who received corticosteroids compared to those who did not (Fig. 3D).

A F-CAR-T cells in peripheral blood by qPCR. Purple, dose level 1; black, dose level 2; blue, dose level 3; red, dose level 4; B F-CAR-T cells in peripheral blood by flow cytometry. Purple, dose level 1; black, dose level 2; blue, dose level 3; red, dose level 4; C Comparison of the mean peak copy number of F-CAR-T cells in peripheral blood at each dose level. Statistical significance was determined by the MannWhitney test. D Comparison of the mean peak copy number of F-CAR-T cells in peripheral blood with or without steroids. Statistical significance was determined by the MannWhitney test.

Fourteen days after F-CAR-T cell infusion, all patients achieved morphologic CR including 2/25 with CR and 23/25 CR with incomplete hematologic recovery (CRi), which further improved to 11/25 CR and 14/25 CRi 28 days post F-CAR-T (Table 1 and Fig. 4). More importantly, 23/25 (92%) had the minimal residual disease (MRD)-negative remission on day 14 and day 28 after F-CAR-T treatment. Patients achieving remission through CAR-T were given the option to proceed to allo-HSCT. With a median time of 54 days (range: 4581 days) post F-CAR-T infusion, 20 of 23 patients with MRD-negative status decided to pursue consolidative allo-HSCT including one patient who received a 2nd transplant. As of 18 October 2021, with a median follow-up duration of 693 days (range: 84973 days) among the 20 patients who had received allo-HSCT, one patient relapsed on day 172 and died 3 months after relapse, and four patients died from transplant-related mortality (TRM) including infection (n=3) and chronic GVHD (n=1) on day 84, day 215, day 220, and day 312, respectively. The other 15 patients remained in MRD-negative CR with a median remission duration of 734 days (range: 208973) except for one who became MRD-positive on day 294 with CD19+ disease. Among the other three patients (F05, F06, F16), one remained in MRD-negative CR on day 304, one remained in MRD-negative CR until day 303, received allo-HSCT but died from an infection on day 505, and one was lost to follow-up after day 114. Two patients who had MRD-positive CR after infusion withdrew from the study on day 42 and day 44, respectively, to seek other studies.

Clinical outcomes and consolidative allo-HSCT for the 25 patients who were treated with F-CAR-T therapy are shown. On day 28, 23/25 patients achieved MRD-negative CR/CRi. With a median time of 54 days (range: 4581) post F-CAR-T infusion, 20 of 23 patients with MRD-negative status received consolidative allo-HSCT. Among the 20 patients, 1 patient (F23) relapsed on day 172 and died 3 months after relapse. Four patients (F04, F09, F11, F12) died from transplant-related mortality (TRM) including infection (n=3) and chronic GVHD (n=1) on day 84, day 215, day 220, and day 312, respectively. The remaining 15 patients were in MRD-negative CR except for one (F18) who became MRD-positive on day 294. Among the other 3 patients (F05, F06, F16), 1 remained MRD-negative CR on day 304, 1 remained in MRD-negative CR until day 303, received allo-HSCT, and subsequently died from an infection on day 505. One patient was lost to follow-up after day 114. MRD minimal residual disease, CR complete remission, Allo-HSCT allogeneic hematopoietic stem cell transplantation.

F-CAR-T/T ratio in cerebrospinal fluid (CSF) was evaluated by FCM in 13/25 patients with available samples (Table S5). Between days 10 and 32, 9 patients were found to have considerable F-CAR-T penetration in their CSF, ranging from 40.65 to 79.2%, including 4 who developed severe ICANS. Among the other 4 patients, F-CAR-T cell abundance in the CSF ranged from 1.29% to 3.57%, and none experienced severe ICANS. Patients with higher levels of CAR-T in PB on day 10 consistently had higher levels of CAR-T in CSF with the exception of patient F15. Notably, CAR-T cells were still detectable in the CSF on day 101 with a 2.36% CAR-T/T ratio in patient F06, who also had undetectable circulating CAR-T cells at the same time.

In addition, concentrations of seven cytokines (IL-1b, IL-6, IL-10, IFN-, TNF-, MCP-1, and GM-CSF) in CSF samples from the above 10 of 13 patients were measured. Specifically, IL-1b was not detected in any of the 10 patients, and only one patient had detectable GM-CSF. For the other five cytokines, patients with severe ICANS had higher IL-6 levels in contrast to patients without severe ICANS, and the difference between the median level of IL-6 among these two groups of patients was statistically significant (Fig. S11). We did not observe significant differences among the other 4 cytokines between the two groups of patients. No clear relation between the CSF cytokine levels and the F-CAR-T/T % was observed.

View post:
Next-day manufacture of a novel anti-CD19 CAR-T therapy for B-cell acute lymphoblastic leukemia: first-in-human clinical study | Blood Cancer Journal...

Ulcerative colitis, or UC, is a form of inflammatory bowel disease characterized by chronic and relapsing large intestine inflammation. Genetics account for only a minority of UC cases; hence, to develop treatments, researchers need to understand better the environmental contributions to this condition.

Gut microbes are in perpetual contact with the gastrointestinal tract, so they comprise important but poorly defined environmental variables contributing to UC development. Many studies have reported changes in gut microbiome composition in patients with UC compared to healthy individuals. While that suggests a potential role for gut microbes in UC pathogenesis, researchers have yet to pinpoint the causative microbes and associated bacterial proteins.

Dennis Wolans lab at Scripps Research is interested in identifying small-molecule activators and inhibiting bacterial enzymes involved in proliferation of human disease. Wolan said he was curious about what bacterial enzymes of the microbiome contribute to UC development.

Many publications have focused on the role of the microbiome in both health and disease states, he said. Most of these were focused on the taxonomical and phylogenic differences in the microbiome. But what about the associated bacterial proteins? What proteins are these gut bacteria making in disease conditions, and how are these interacting with the human body?

One protein of interest was serine proteases, a type of proteolytic enzyme that cleaves peptides at the serine amino acid. Researchers long have recognized that they coordinate many physiological processes and play key roles in regulating the inflammatory response. Previous studies have suggested increased proteolytic activity in microbial samples harvested from people with inflammatory disorders such as UC and Crohns disease.

Peter ThuyBuon, a graduate student and later a postdoc in the Wolan lab, led a project to study differential protein expression in healthy and UC fecal samples. He and the team described the project in a recent paper in the journal Molecular & Cellular Proteomics. In addition to standard mass spectrometry, ThuyBuon used a small molecular approach called affinity-based proteomic profiling to target and enrich for different types of proteases in the fecal samples.

We showed that there were 176 discrete host and microbial protein groups differentially enriched between healthy and UC patients, Wolan said. Furthermore, further enrichment of these proteins showed significantly higher levels of serine proteases in UC patients.

This finding has inspired exciting future research questions. For example, are elevated serine proteases the driver of UC or merely the effect of UC disease progression?

There is a lot of exciting work to be done using these findings, Wolan said. Future molecular studies should focus on how serine proteases might be contributing to UC and whether their levels can be manipulated to modify disease progression.

Functional proteomics has shown the potential role of serine proteases in UC. Future steps will include drug discovery and design of small-molecule regulators of bacterial enzymes.

Wolan said, Ultimately, the moderation of microbiome distribution in UC via external small-molecule intervention can serve as a foundation for UC prevention and treatment.

Read more here:
Proteases implicated in ulcerative colitis - ASBMB Today

The very thought of getting someone elses poop transfused in your body may make you cringe but stool transplant has not only helped patients with gastrointestinal tract issues, it has also saved those who have had bone marrow transplants.

At Deenanath Mangeshkar Hospitals Centre of Excellence in Infectious Diseases and Department of Haematology, Pune, seven of the 11 patients of bone marrow transplants developed Clostridium difficile infection. They were treated with faecal microbial transplant (FMT), also referred to as stool transplant, over the past year.

Research worldwide has shown that a faecal transplant can restore healthy bacteria in the lower intestine which can help control Clostridium difficile or C. diff. According to the Johns Hopkins University School of Medicine, FMT can be more effective than antibiotics for keeping C. diff in check in some cases.

Since C. diff infection can recur and cause colitis (inflammation in the colon), FMT restores good and healthy bacteria, said Dr Parikshit Prayag, infectious disease consultant and in-charge of the Centre of Excellence in Infectious Diseases at Deenanath Mangeshkar hospital.

Dr Sameer Melinkeri, head of the department of haemotology at the hospital, said C. diff infection-related diarrhoea can occur in a normal setting in which antibiotics can be used for treatment. However, antibiotic treatment for recurrent infections can involve one or more courses of medication and their effectiveness comes down with each subsequent bout. FMT can arrest such infections post bone marrow transplant as it can be life-threatening, he added.

FMT is also done for certain disease conditions like Graft vs host disease (GvHD). Most people who undergo a bone marrow transplant suffer from blood cancer. Graft vs host disease can occur at any time after an allogeneic transplant where the donated bone marrow or peripheral stem cells can attack the recipients body. It can develop in the GI tract, skin or liver, Dr Prayag said.

Latest research published in the Journal of International Medical Research and others has shown how FMT is a promising treatment for patients with steroid-resistant GvHD. We have seen clinically relevant results in six of our patients, Dr Prayag said.

So, who can be donors? They are selected based on certain parameters. They should not be immune-compromised or have taken antibiotics over the past six months, says Dr Sampada Patwardhan, head of the department of microbiology at the hospital. Donor screening has to be done carefully. We need to rule out infections, she said.

Procedures on the transplant delivery methods may vary like colonoscopy and use of nasojejunal tube. The recovery may take a week or more and in most cases there are at least two weekly installations of the stool (in liquid form).

Very few centres conduct FMT and among them, the centre at Deenanath Hospital actively treats cases involving bone marrow transplants. At a recent virtual meeting of the International Society of Blood Transfusion, Dr Prayag made a strong case for encouraging stool transplants. The condition of C. diff is also underdiagnosed in the country as there isnt adequate infrastructure to correctly detect the problem, he pointed out.

In fact, FMT is being touted as a treatment option for many gut health issues. In an opinion article published on June 30 in the journal Trends in Molecular Medicine, a team from Harvard Medical School and Brigham and Womens Hospital (BWH) proposes that individuals bank samples of their own gut microbiota when they are young and healthy for potential use later in life in an autologous FMT.

A report in Science Daily quotes corresponding author Yang-Yu Liu, an associate professor of medicine at Harvard and an associate scientist in the Channing Division of Network Medicine at BWH, as saying, The idea of rewilding the human microbiome has taken off in recent years and has been hotly debated from medical, ethical and evolutionary perspectives. It is still unknown if people in industrialized societies can gain some health benefit by restoring their microbiome to an ancestral state. In this paper, we proposed a way to rejuvenate the human gut microbiome.

The report also listed OpenBiome, a non-profit stool bank based in Somerville, Massachusetts, as the first stool bank to offer an option for individuals to bank their own stool for future treatment of C. diff infection. Yang and his colleagues are now looking at if this treatment can be used for other diseases.

Conceptually, the idea of stool banking for autologous FMT is similar to when parents bank their babys cord blood for possible future use. However, there is greater potential for stool banking, and we anticipate that the chance of using stool samples is much higher than for cord blood. But there are many practical issues to implementing this idea, Yang is quoted as saying, hinting at optimal storage and cryopreservation issues.

Read the rest here:
Cutting Edge: Poop therapy can save your gut, and your life - The Indian Express

Clusters of the earliest hematopoietic cells being born in the walls of the umbilical artery of a mouse embryo. The cells colored in red represent embryonic multipotent progenitor cells (eMPPs). Credit: Sachin H. Patel/Boston Childrens Hospital

Barcoding studies discovered two independent sources for blood cells in mice. If confirmed in humans, our understanding of blood cancers, bone marrow transplants, and the aging immune system will change.

The origins of our blood may not be quite what we thought. Using cellular barcoding in mice, groundbreaking research finds that blood cells originate not from one type of mother cell, but two, with potential implications for blood cancers, bone marrow transplant, and immunology. Fernando Camargo, PhD, of the Stem Cell Program at Boston Childrens Hospital led the study, published in the journal Nature on June 15, 2022.

Historically, people have believed that most of our blood comes from a very small number of cells that eventually become blood stem cells, also known as hematopoietic stem cells, says Camargo, who is also a member of the Harvard Stem Cell Institute and a professor at Harvard University. We were surprised to find another group of progenitor cells that do not come from stem cells. They make most of the blood in fetal life until young adulthood, and then gradually start decreasing.

The researchers are now following up to see if the findings also apply to humans. If so, these cells, known as embryonic multipotent progenitor cells (eMPPs), could potentially inform new treatments for boosting aging peoples immune systems. They could also shed new light on blood cancers, especially those in children, and help make bone marrow transplants more effective.

Camargos team applied a barcoding technique they developed several years ago. Using either an enzyme known as transposase or CRISPR gene editing, they inserted unique genetic sequences into embryonic mouse cells in such a way that all the cells descended from them also carried those sequences. This enabled the team to track the emergence of all the different types of blood cells and where they came from, all the way to adulthood.

Previously, people didnt have these tools, says Camargo. Also, the idea that stem cells give rise to all the blood cells was so embedded in the field that no one attempted to question it. By tracking what happened in mice over time, we were able to see new biology.

Through barcoding, the researchers found that eMPPs, as compared with blood stem cells, are a more abundant source of most lymphoid cells important to the immune responses, such as B cells and T cells. Camargo believes the decrease in eMPPs that they observed with age may explain why peoples immunity weakens as they get older.

Were now trying to understand why these cells peter out in middle age, which could potentially allow us to manipulate them with the goal of rejuvenating the immune system, says Camargo.

In theory, there could be two approaches: extending the life of eMPP cells, perhaps through growth factors or immune signaling molecules, or treating blood stem cells with gene therapy or other approaches to make them more like eMPPs.

Camargo is also excited about the potential implications for better understanding and treating blood cancers. For example, myeloid leukemias, striking mostly older people, affect myeloid blood cells such as granulocytes and monocytes. Camargo thinks these leukemias may originate from blood stem cells, and that leukemias in children, which are mostly lymphoid leukemias, may originate from eMPPs.

We are following up to try to understand the consequences of mutations that lead to leukemia by looking at their effects in both blood stem cells and eMPPs in mice, he says. We want to see if the leukemias that arise from these different cells of origin are different lymphoid-like or myeloid-like.

Finally, the recognition that there are two types of mother cells in the blood could revolutionize bone marrow transplant.

When we tried to do bone marrow transplants in mice, we found that the eMPPs didnt engraft well; they only lasted a few weeks, says Camargo. If we could add a few genes to get eMPPs to engraft long term, they could potentially be a better source for a bone marrow transplant. They are more common in younger marrow donors than blood stem cells, and they are primed to produce lymphoid cells, which could lead to better reconstitution of the immune system and fewer infection complications after the graft.

Reference: Lifelong multilineage contribution by embryonic-born blood progenitors by Sachin H. Patel, Constantina Christodoulou, Caleb Weinreb, Qi Yu, Edroaldo Lummertz da Rocha, Brian J. Pepe-Mooney, Sarah Bowling, Li Li, Fernando G. Osorio, George Q. Daley and Fernando D. Camargo, 15 June 2022, Nature.DOI: 10.1038/s41586-022-04804-z

Sachin H. Patel, MD, PhD, of the Stem Cell Program (now at University of California San Francisco) and Constantina Christodoulou, PhD (now at Bristol Myers Squibb) were co-first authors on the paper. The study was funded by the National Institutes of Health (HL128850-01A1, P01HL13147), the Evans MDS Foundation, the Alex Lemonade Foundation, the Leukemia and Lymphoma Society, and the Howard Hughes Medical Institute. The authors declare no competing interests.

Here is the original post:
The Origins of Our Blood May Not Be What We Thought - SciTechDaily

Wilmington, Delaware, United States: The global bone marrow aspirate concentrates market was valued around US$ 130.0 Mn in 2016 is anticipated to register a stable CAGR of over 5.0% during forecast period of 2017 to 2025, according to a new report published by Transparency Market Research (TMR) titled Bone Marrow Aspirate Concentrates Market Global Industry Analysis, Size, Share, Growth, Trends, and Forecast, 20172025. Growth of the global bone marrow aspirate concentrates market is driven by increased prevalence of and incidences of orthopedic diseases, and sports injuries, along with high growth of the cosmetic surgery industry and increasing applications of the BMAC products in the cosmetic and orthopedic surgeries. The bone marrow aspirate concentrates market in Asia Pacific is expanding with a high potential to grow registering a CAGR above 6.0% on the backdrop of unmet clinical needs, rising geriatric population, large patient pool, favorable government regulations, development in health care sector, and increased focus on research and developmental activities.

Request Brochure of Report - https://www.transparencymarketresearch.com/sample/sample.php?flag=B&rep_id=40451

Increase in incidences of Osteoarthritis on the backdrop of rising geriatric population to drive market growth

According to a collaborative survey conducted by the United Nations and the World Health Organization, 1.2 billion people in China are suffering from OA, of which more than 55% are aged 60 years or above. On the backdrop of such a huge patient base, there has been several developments in the field orthopedic surgery. Bone marrow-derived stem cell treatment is considered a promising and advanced therapy. It reduces the injury healing time in orthopedic diseases to five to six weeks from four to six months in case of surgery. Reduction in the healing time is a factor likely to propel the Bone Marrow Aspirate Concentrates market during the forecast period. However, pain associated with the treatment, lack of product approval, and preference for alternative treatments are negatively affecting the market growth. Moreover, high investments in R&D and clinical trials, slow approval processes entailing sunken costs, and marginal returns on investment (RoI) for stakeholders are primary concerns faced by manufacturer further hampering growth of the market.

Request Sample of Report - https://www.transparencymarketresearch.com/sample/sample.php?flag=S&rep_id=40451

Rise in the Number of BMAC Assisted Procedures to Boost Growth of Bone Marrow Aspirate Concentrates Accessories Segment

The product type segment is fragmented into bone marrow aspirate concentrates systems and bone marrow aspirate concentrates accessories. The bone marrow aspirate concentrates accessories segment is anticipated to carry major share of the market on the backdrop of rise in number of BMAC assisted procedures. Cell therapies have been used extensively over the past decade for a variety of medical applications to restore cellular function and enhance quality of life. Owing to the differentiation property, stem cells are being used for repair and regeneration of bone. Moreover, increase in awareness about hygiene and risk of cross-contamination in developing countries such as Brazil, China and India are expected to increase the use of single-use Jamshidi needles for bone marrow stem cell procedures. This is likely to fuel the growth of the accessories segment in the near future.

Request for Analysis of COVID-19 Impact on Bone Marrow Aspirate Concentrates Market - https://www.transparencymarketresearch.com/sample/sample.php?flag=covid19&rep_id=40451

Orthopedic Surgery Application to Dominate the Global Bone Marrow Aspirate Concentrates Market

The application segment of global bone marrow aspirate concentrates market is divided into orthopedic surgery, wound healing, chronic pain, peripheral vascular disease, dermatology, and others applications. Of which, orthopedic surgery segment is anticipated to dominate the market owing to rising geriatric population, and surge in incidences of osteoarthritis around the globe. The dermatology segment is anticipated to expand at the highest CAGR of over 6.0% during forecast period of 2017 to 2025 owing to current boom in the industry, increase in disposable income, and technological advancements in the market. The utilization of the regenerative ability of fibroblasts and keratinocytes from human skin has formed new ways to develop cell-based therapies for patients. Moreover, capacity of bone marrow derived extra-cutaneous cells is being researched for its plasticity in regenerating skin; it is likely to lead to the future growth of cell therapies in dermatology.

Rise in Healthcare Expenditure to Fuel Growth of Hospitals & Clinics End-user Segment

In terms of end-users, market is divided into hospitals & clinics, pharmaceutical & biotechnology companies, Contract Research Organizations (CROs) & Contract Manufacturing Organizations (CMOs), and academic & research institutes. The hospitals & clinics segment dominated the bone marrow aspirate concentrates market in 2016. The trend is expected to continue during the forecast period. The hospitals & clinics segment is likely to be followed by the biotechnology & biopharmaceutical companies segment in terms of market share during the forecast period. The segment is anticipated to hold more than 8.0% of market share in 2016. Growth of the segment is attributed to increasing number of biotechnology companies and rising partnerships among the market players to expand global presence.

Make an Enquiry Before Buying - https://www.transparencymarketresearch.com/sample/sample.php?flag=EB&rep_id=40451

Large Patient Pool in Developing Countries Like China, India, Brazil, and Taiwan to Create More Opportunities in the Market

Geographically, global bone marrow aspirate concentrates market is divided into major five geographical regions, including North America, Europe, Asia-Pacific, Latin America and Middle East and Africa. North America is anticipated to hold major share of the market owing to technological advancements and regulatory approval for new devices, awareness about stem cell therapy, and rise in number of cosmetic surgical procedures. While, Asia Pacific orthopedic market is at a pivotal point today, which was valued around US$ 19 Million in 2016 and anticipated to derive massive and augmented growth. The orthopedic market in Asia, including bone graft, spine, and bone substitute, is anticipated to grow more than twice as fast as the overall orthopedic market which will further boost growth of BMAC market in the region.

Semi-consolidated Market with 3-4 key Players Operating in the BMAC Systems Market Segment

Key players covered in this report are Terumo Corporation (Terumo BCT), Ranfac Corp., Arthrex, Inc., Globus Medical, Inc., Cesca Therapeutics Inc., MK Alliance Inc. (TotipotentSC), and Zimmer Biomet Holdings, Inc. Companies operating in the global market for bone marrow aspirate concentrates are focusing on in-licensing and collaboration agreements to put new products in the developing markets like Asia Pacific, and Latin America. For instance, in August 2017, Cesca Therapeutics Inc. announced a distribution agreement with Boyalife WSN Ltd., a China based company. Through this agreement, Boyalife WSN Ltd. will distribute Cescas innovative biobanking and point-of-care solutions in China, India, Singapore, and the Philippines. As India and China represent two of the fastest growing economies in the world, successful penetration of these regions can generate more market opportunity to the companies.

More Trending Reports by Transparency Market Research

Brucellosis Vaccine Market: https://www.transparencymarketresearch.com/brucellosis-vaccines-market.html

Solitary Fibrous Tumor Treatment Market: https://www.transparencymarketresearch.com/solitary-fibrous-tumor-treatment-market.html

Post operative Pain Therapeutics Market: https://www.transparencymarketresearch.com/postoperative-pain-therapeutics-market.html

ACL Reconstruction Procedures Market: https://www.transparencymarketresearch.com/acl-reconstruction-procedures-market.html

CAR T cell Therapy Market: https://www.transparencymarketresearch.com/car-t-cell-therapy-market.html

Retinal Vein Occlusion Market: https://www.transparencymarketresearch.com/retinal-vein-occlusion-market.html

Adrenocorticotropic Hormone [ACTH] Market: https://www.transparencymarketresearch.com/adrenocorticotropic-hormone-market.html

Veterinary Supplements Market: https://www.transparencymarketresearch.com/veterinary-supplements-market.html

About Us

Transparency Market Research is a global market research firm offering the latest market research reports and business consulting services. Our exclusive blend of quantitative forecasting and trends analysis provides forward-looking insights for thousands of decision makers. Our experienced team of Analysts, Researchers, and Consultants use proprietary data sources and various tools & techniques to gather and analyze information.

Our data repository is continuously updated and revised by a team of research experts, so that it always reflects the latest trends and information. With a broad research and analysis capability, Transparency Market Research employs rigorous primary and secondary research techniques in developing distinctive data sets and research material for business reports.

Contact Us

Rohit Bhisey

Transparency Market Research Inc.

CORPORATE HEADQUARTER DOWNTOWN,

1000 N. West Street,

Suite 1200, Wilmington, Delaware 19801 USA

Tel: +1-518-618-1030

USA Canada Toll Free: 866-552-3453

Email: sales@transparencymarketresearch.com

Website: https://www.transparencymarketresearch.com/

Continue reading here:
Bone Marrow Aspirate Concentrates Market: Increasing Use in Orthopedic Surgery Applications to Drive Sales in the Global Market - BioSpace

Non-Hodgkins Lymphoma, also known as NHL, is a cancer that starts in the white blood cells in the lymphatic system. White blood cells are responsible for shielding the body from germs and is critical to the immune system. When cancer cells start multiplying in these lymphocytes, the tumours can spread throughout the body, eventually attacking every organ.

NHL is a broader term used to define the various lymphomas affecting the lymphatic system, including the lymph nodes and lymph tissue. Lymphoma can begin anywhere in the body, wherever the lymphatic tissue is found and is mainly seen in adults. Lymph nodes, spleen, adenoids, tonsils, bone marrow, thymus, and digestive tract are where the Lymphoma can start before affecting the entire system.

Classification of Lymphomas

There are several types of Non-Hodgkins Lymphoma, and while classifying a Lymphoma, the doctors consider a few points. Lymphomas can be categorized based on:

The type of lymphocyte the Lymphoma emerged from.

Structure of Lymphoma under the microscope.

The features of chromosomes in the lymphoma cell, and

Presence of specific proteins on the surface of the cancer cells.

Types of Lymphomas

The types of lymphomas are distinguished based on the type of the lymphocytes affected. There are two basic types of lymphocytes The T-cells and the B-cells. T cells protect us from infection and the B cells create antibodies to neutralize the infection- causing germs.

The types of lymphoma include:

The Chronic Lymphocytic Leukemia or CLL is cancer of the blood and bone marrow, and it generally progresses slower when compared to other types of leukemia. In this type of cancer, the white blood cells get affected and are often seen in older adults. Chronic lymphocytic leukemia doesnt present with any symptoms at the initial stages, but swollen lymph nodes, coupled with fatigue, fever, and unintended weight loss are some common signs.

Closely related to the CLL is Small Lymphocytic Lymphoma, or SLL, found in the lymph nodes and the spleen.

A rare type of cancer, Cutaneous B-cell Lymphoma, begins in white blood cells, specifically in one kind of germ-fighting lymphocyte called B cells or B lymphocytes. This cancer presents itself as a thick bump, the same as ones skin color or pink or purple, and is located under the skin.

Also known as CTCL, the Cutaneous T cell Lymphoma begins in the white blood cells but in T lymphocytes, attacking the skin. CTCL often presents with rash, redness on the skin, scaly patches, and small tumours under the skin.

Follicular Lymphoma is a sluggish or a slow-growing type of cancer and is often found in people aged above 60. These cancers occur either in lymph nodes or in the bone marrow. If not treated on time, follicular lymphomas can grow fast, diffusing large B-cells.

Causes of Non-Hodgkins Lymphoma

It is tough to pinpoint a single causative factor for Non-Hodgkins Lymphoma. This cancer begins either in B cells or T cells in the lymphatic system.

Most Common Risk Factors

Patients on immunosuppressive medications administered after an organ transplant are at high risk of developing Non-Hodgkins Lymphoma.

Patients with a history of certain viruses and bacterial infections, including HIV, Epstein-Barr, and Helicobacter pylori, are prone to this type of cancer.

Overexposure to certain chemical compounds in pesticides used for killing insects may up the risk of Lymphoma.

Though Non-Hodgkins Lymphoma can happen at any age, it is often diagnosed in people above 60 years of age.

Diagnosis

Non-Hodgkins Lymphoma is diagnosed through blood tests and imaging tests like CT, MRI and PET-CT. Minimally invasive diagnostic procedures like lymph node tests, bone marrow tests, and lumbar puncture are also done for collecting samples and reviewing them in labs for accurate diagnosis.

Treating Non-Hodgkins Lymphoma

Chemotherapy:

Chemotherapy is the first line of treatment for this type of cancer. It is often administered as a part of a bone marrow transplant where high dosage of chemotherapy kills cancer cells and act as a precursor to the transplant.

Radiation Therapy

Radiation therapy which involves high-powered energy beams being used to target cancer cells is recommended in the case of indolent NHL. It is used subsequently in chemotherapy, often aimed at the affected lymph nodes to curtail its progression.

Targeted Drug Therapy

Targeted drug therapy uses certain medications that block abnormalities in the cancer cells and make them die and is often combined with chemotherapy.

Bone Marrow Transplant

Also known as stem cell transplant, a bone marrow transplant is done by infusing healthy bone marrow stem cells from a donor into the patients body. These bone marrow cells aid in rebuilding bone marrow and are prescribed if other treatments fail to give the desired outcome.

Immunotherapy

Immunotherapy is recommended in the specific type of NHL where proteins produced by the cancer cells hide from the immune system. Immunotherapy disrupts the job of these proteins and makes the immune system fight the malignant cells. The treatment methods in combating Non-Hodgkins Lymphoma have come a long way in the recent decade.

It is advisable to consult a healthcare expert immediately in case of any of the symptoms.

BY: Dr. Prasad Gunari, Senior Consultant Medical Oncology, HCG NMR Cancer Centre, Hubli.

Read the rest here:
What you need to know about Non-Hodgin's Lymphoma - NewsPatrolling

Express News Service

BENGALURU: Vitiligo, a skin de-pigmentation disorder which affects 0.1 to 8% of population, is a cause of worry especially for women as it mainly affects face, neck and hands. It relapses in 40% of patients, within a year after stopping treatment. But Mesenchymal stem cell-based therapy can be a hope, experts say.

On World Vitiligo Day on Saturday, dermatologist, Aster R V Hospital, Dr Sunil Prabhu said the disorder is affecting at least 2.16% of children/adolescents. Vitiligo is a long-term condition, where pale white patches develop on the skin due to lack of melanin pigment. According to Dr Praveen Bharadwaj, dermatology consultant, Manipal Hospital, Whitefield, vitiligo is a condition in which the patients immune system weakens which affects the normal functioning of melanin producing cells.

Dr Bharadwaj explained, Mesenchymal stem cells, which are multi-potent adult stem cells, are found in bone marrow, fat tissues, umbilical cord and human foreskin. They are promising agents for therapy for the re-pigmentation of skin in vitiligo. This therapy reduces the main trigger of vitiligo that is immune-mediated melanocyte degeneration (stopping the immune destruction of melanocytes which produces melanin), promotes melanocytes and prevents relapse of the condition, he said.

Link:
Experts offer hope to vitiligo patients - The New Indian Express

Expert Cancer Homoeo Clinic is delivering impactful homoeopathic treatment in the country for various diseases and disorders that include aplastic anaemia caused by a bone marrow injury.

Expert Cancer Homoeo Clinic was established in 1979 by Dr. Devendra Singh to cure chronic and dreaded diseases like neck cancer, gastrointestinal cancer, blood cancer and prostate cancer by homoeopathy. This chain of homoeopathic clinics has now expanded to possess many experienced physicians who are consistently ranked as the top cancer doctors in the world and who are trained in prestigious medical schools and research centres. Expert Cancer Homoeo Clinic offers advanced oncology care in a humane environment to its patients.

During a press interview organized recently, the spokesperson of Expert Cancer Homoeo Clinic shared, Our homoeopathic treatment is now also available for the rare disease of aplastic anaemia, in which the bone marrow and its hematopoietic stem cells get damaged. This causes a deficiency of all three blood cell types red blood cells, white blood cells, and platelets. Aplastic means the inability of stem cells to generate mature blood cells. Our homoeopathic medicines have proven to be quite effective on this type of disease.

Expert Cancer Homoeo Clinic has the top homoeopathic doctor in Indiato deliver the right treatment according to the factors that may have caused aplastic anaemia. Generally, the factors that can temporarily or permanently injure the bone marrow and affect the blood cell production include radiation and chemotherapy treatments, exposure to toxic chemicals, use of certain drugs, autoimmune disorders, a viral infection, and pregnancy with an autoimmune problem. There are also unknown factors leading to idiopathic aplastic anaemia disease.

The spokesperson additionally stated, Aplastic anaemia can progress slowly over weeks or months, or it may come on suddenly. The illness may be brief, or it may become chronic. Aplastic anaemia can be very severe and even fatal. Thus, it is always advisable to meet a doctor for timely treatment, if the patient notices the symptoms. Some of its symptoms are shortness of breath with exertion, fatigue, rapid or irregular heart rate, pale skin, unexplained or easy bruising, frequent or prolonged infections, nosebleed, dizziness, and skin rashes.

Expert Cancer Homoeo Clinic suggests the aplastic anaemia treatment in homoeopathythat can stimulate the healthy portion of bone marrow to improve cell production. This may help to reduce the number of blood transfusions. Homoeopathy medicines improve the patients general vitality and well-being and help them to fight infections. These medicines control the bleeding disorder associated with aplastic anaemia. The clinic gives the medicinal treatment that is beneficial in countering the side effects associated with conventional therapy. The chances of relapse also significantly diminish with the homoeopathic treatment of aplastic anaemia.

About Expert Cancer Homoeo Clinic:

Expert Cancer Homoeo Clinic is a chain of homoeopathy clinics in India. The clinic offers treatment for several dreaded diseases, ranging from all types of cancer to kidney diseases. Whether the patients require effective migraine treatment in Delhi or need to schedule an appointment with the best cancer doctor in Mumbai, they can do it all with the Expert Cancer Homoeo Clinic. The clinic follows a holistic treatment approach, ensuring complete healing.

Contact Information:

Expert Cancer Homoeo Clinic

Address Lucknow Centre: Opposite Picadilly Hotel, Kanpur-Lucknow Road, Bara Birwa, Jafar Khera, Alambagh, Lucknow, Uttar Pradesh, India

Phone (Mb): +91-9616385385 (Lucknow)

Address Delhi Centre: 101, Ashish Complex, Opposite Cafe Coffee Day, Near Alchon Public School, Mayur Vihar Phase 1, New Delhi, India

Phone: +91-9560062231 (Delhi)

Address Mumbai Centre: 504 Sunshine, Opp. Shastri Nagar, Lokhandwala, Andheri West, Mumbai, India

Phone: +91-8176813454 (Mumbai)

Email: [emailprotected] (Delhi) / [emailprotected] (Mumbai) / [emailprotected](Lucknow)

Website: http://cancerhomoeoclinic.co.in/

Media ContactCompany Name: Expert Cancer Homoeo ClinicContact Person: Dr. Devendra Singh Email: Send EmailPhone: +91-8176813454Address:504 Sunshine, Opp Shastri Nagar, Lokhandwala, Andheri West City: MumbaiState: MaharashtraCountry: IndiaWebsite: cancerhomoeoclinic.co.in

View original post here:
Expert Cancer Homoeo Clinic Helping Patients with Aplastic Anaemia through Homoeopathic Treatment - Digital Journal