Archive for the ‘Crispr’ Category

The research report of CRISPR Genome Editing Market study report covers all main geographical regions and sub-regions in the world and focuses on product sales, cost, and CRISPR Genome Editing market size and growth opportunities in these regions. The CRISPR Genome Editing market industry provides market research data status categorizes the CRISPR Genome Editing market into key dynamics, region, type and application.

The analysis of CRISPR Genome Editing market offers a competitive head-start to businesses operating in this vertical through a holistic assessment of the growth matrix and global developments. The report throws light on the opportunities, limitations, and crucial growth drivers that determine the profitability of the overall market along with solutions to overcome potential challenges.

Furthermore, the document derives the projected growth rate of the industry from a comparative study over the analysis period. It also provides a comprehensive assessment of the footprint of the COVID-19 pandemic on the market and sub-markets and assists the industry partakers in dealing with the challenges.

Request Sample Copy of this Report @ https://www.aeresearch.net/request-sample/369423

Key Highlights of the Table of Contents:

Product spectrum

Application arena

Regional analysis

Competitive landscape

To conclude, the report has meticulously assessed the CRISPR Genome Editing market through multiple segments, with a deep-dive investigation of facets including the sales channel & supply chain along with specifications pertaining to upstream suppliers, downstream buyers, raw materials, and distributors.

The report can answer the following questions:

Request Customization on This Report @ https://www.aeresearch.net/request-for-customization/369423

Read this article:
CRISPR Genome Editing Market to Exhibit Impressive Growth of CAGR during the pe - News by aeresearch

Single-cell search: Researchers mutated autism-linked genes in developing mouse embryos using a viral technique. They analyzed the cells carrying mutations (pink) when the mice were 7 days old.

Courtesy of Xin Jin / Harvard

Mutations in a set of 35 genes linked to autism affect both neurons and glial cells in developing mice, according to a study published today. The study is the first to screen multiple autism-gene mutations, one by one, in living mice and analyze their effects in individual brain cells.

About 100 genes have been strongly linked to autism, and sequencing efforts continue to uncover more. But how mutations in each of these genes affect brain development remains largely unknown. Although researchers have investigated the molecular effects of just a few genes, testing all of them individually is a daunting task.

In the new work, researchers built on a technique called Perturb-seq, developed in 2016. This technique mutates the genome in individual cells using CRISPR technology and then sequences the RNA in each cell to determine how the mutation changed it.

Perturb-seq has been used in cells grown in a dish, says Paola Arlotta, professor of stem cell and regenerative biology at Harvard University, who co-led the work, but this is the first time that it is applied in an intact, living and developing organism.

Arlotta and her colleagues injected viruses carrying CRISPR gene-editing machinery into 12-day-old mouse embryos. They used just enough virus to cause mutations in 1 out of every 1,000 stem cells in the embryonic brain.

When the pups were 7 days old, the researchers sequenced the RNA in five different cell types in the pups brains: three types of neurons and two types of glial cells. They then identified groups of mutations in which gene expression had changed in similar ways.

Mutations in several of the autism-linked genes affect common sets of related genes and multiple cell types, they found.

The approach allows researchers to study how different autism-linked genes might converge on similar developmental pathways, says Xin Jin, a junior fellow at Harvard who worked on the study.

The researchers plan to expand the number of genes that the technique can mutate at once, Arlotta says. They also plan to apply it to lab-grown human brain cells that form clusters called organoids, to test whether genes affect development comparably in mice and people.

See the rest here:
Autism genes affect development of neurons and glia - Spectrum

Abstract

Harnessing CRISPR-Cas9 technology for cancer therapeutics has been hampered by low editing efficiency in tumors and potential toxicity of existing delivery systems. Here, we describe a safe and efficient lipid nanoparticle (LNP) for the delivery of Cas9 mRNA and sgRNAs that use a novel amino-ionizable lipid. A single intracerebral injection of CRISPR-LNPs against PLK1 (sgPLK1-cLNPs) into aggressive orthotopic glioblastoma enabled up to ~70% gene editing in vivo, which caused tumor cell apoptosis, inhibited tumor growth by 50%, and improved survival by 30%. To reach disseminated tumors, cLNPs were also engineered for antibody-targeted delivery. Intraperitoneal injections of EGFR-targeted sgPLK1-cLNPs caused their selective uptake into disseminated ovarian tumors, enabled up to ~80% gene editing in vivo, inhibited tumor growth, and increased survival by 80%. The ability to disrupt gene expression in vivo in tumors opens new avenues for cancer treatment and research and potential applications for targeted gene editing of noncancerous tissues.

In recent years, molecularly targeted inhibitors and immunotherapy have greatly improved cancer responses with reduced toxicity and adverse reactions. However, the high recurrence rate and the development of drug resistance for most types of cancers highlight the need for new therapeutic modalities. Most cancer drugs require repeated administration, which increases treatment-related toxicity and treatment cost and severely reduces patient quality of life. CRISPR-Cas9 gene editing has the potential to permanently disrupt tumor survival genes, which could overcome the repeated dosing limitations of traditional cancer therapies, improve treatment efficacy, and require fewer treatments (1, 2). The Cas9 nuclease is directed by a single-guide RNA (sgRNA) to modify a specific chromosomal DNA sequence by inducing a sequence-specific double-strand break (DSB) (3, 4). DSBs are predominantly resolved via the error-prone nonhomologous end-joining repair mechanism, which can induce insertions or deletions that result in gene disruption. However, the large size of Cas9 (160 kDa, 4300 bases) and sgRNA (~31 kDa, 130 bases) is an obstacle for conventional viral and nonviral delivery systems. Moreover, current delivery systems for nonliver tissues and tumors only result in relatively low gene editing percentages (5, 6). For an effective cancer therapy, substantially higher editing efficiencies would be needed.

Lipid nanoparticles (LNPs) are clinically approved nonviral nucleic acid delivery systems capable of delivering potentially such large payloads. Cationic ionizable lipids are the key component of LNPs that enables efficient nucleic acid encapsulation, cellular delivery, and endosomal release. However, LNP formulations that were optimized for small interfering RNA (siRNA) delivery do not efficiently deliver large nucleic acids (e.g., mRNAs and plasmids) (7, 8). Most in vivo studies of gene editing have relied on adeno-associated virus (AAV) to deliver CRISPR components locally to the retina or skeletal muscle or to the liver. Nevertheless, AAV applications are limited by its small carrying capacity, immune responses, hepatoxicity at high doses, and the lack of cellular targeting (9, 10). Several nonviral delivery vehicles for CRISPR components have been reported in recent years (5, 11). These systems were evaluated for liver-associated genetic diseases, demonstrated gene editing of up to 60% in mice and rat livers, and almost a complete reduction of target protein in the blood. However, formulations designed for other tissues were less efficient (i.e., up to ~15% in the lung and ~3% in melanoma) (5, 6). Therefore, the development of efficient and safe delivery systems for nonliver tissues remains an important missing link for therapeutic translation of CRISPR editing.

Here, we report the development of a targeted nonviral LNP delivery system for therapeutic genome editing and evaluate it in two aggressive and incurable cancer models.

To overcome the cargo limitation of currently available LNP formulations, LNPs were designed to coencapsulate Cas9 mRNA and sgRNA, using ionizable cationic lipids from a novel ionizable amino lipid library (Fig. 1A) (12). This library was constructed using a novel class of ionizable amino lipids based on hydrazine, hydroxylamine, and ethanolamine linkers with a linoleic fatty acid chain and amine head groups (12). Lipids 1, 6, 8, and 10 were the top hits of the screen and were chosen for further evaluation for CRISPR-Cas9 gene editing (Fig. 1B). Cas9 mRNA was chosen, instead of plasmid DNA, to reduce long-term exposure to the nuclease to minimize off-target gene modifications (13, 14). To enhance RNA stability and minimize immunogenicity, Cas9 mRNA was chemically modified with 5-methoxyuridine, and highly modified sgRNAs were used (IDT sgRNA XT) (15, 16). CRISPR-LNP (cLNP) formulations containing Cas9 mRNA and an sgRNA were compared to Cas9 mRNA and sgRNAs encapsulated with the clinically approved LNP formulation, used for siRNA therapeutics, based on DLin-MC3-DMA as the ionizable cationic lipid (MC3-cLNPs). cLNPs were uniform in size with a diameter of 71 to 80 nm, polydispersity index of 0.024 to 0.103, and potential of 3 to 18.6 mV as measured by dynamic light scattering (Fig. 1C). The biophysical properties and transmission electron microscopy micrographs of L8-cLNPs were similar to those of MC3-cLNPs (Fig. 1C and fig. S1A). The encapsulation efficiency of Cas9 mRNA and sgRNA in L6, L8, L10, and MC3-LNPs was similarly high (>90%) but lower in L1-cLNPs (~65%) (Fig. 1D). Next, we evaluated the in vitro gene disruption efficiency of the cLNP formulations encapsulating a GFP sgRNA by measuring the loss of green fluorescent protein (GFP) fluorescence in human embryonic kidney (HEK) 293 cells stably expressing GFP (HEK293/GFP) (Fig. 1E) (17). L1-, L8-, and L10-cLNPs all disrupted GFP in a concentration-dependent manner, and L8 was the most efficient. GFP fluorescence was detected in only 4% of L8-cLNPtreated cells after incubation with cLNPs containing total RNA (1.0 g/ml). Although Cy5.5-labeled MC3-cLNPs were taken up more efficiently than L8-cLNPs into HEK293/GFP cells as measured by flow cytometry (fig. S1B), MC3-cLNPs did not reduce GFP expression at any concentration (0.1 to 1.0 g/ml total RNA, 0.7 to 7 nM total RNA). On the basis of these data, L8-cLNPs were chosen for further study.

(A) Schematic illustration of cLNP preparation. A microfluidic-based mixing of lipids to construct cLNPs encapsulating Cas9 mRNA and sgRNA. (B) Chemical structures of the selected ionizable amino lipids from the library screen. (C) Physicochemical characterization of cLNP by dynamic light scattering and sizer. Data are means SD of five independent preparations. (D) Encapsulation efficiency as measured using a RiboGreen assay. (E) GFP disruption assay: HEK293 cells were transfected with cLNPs at different concentrations (0.1 to 1 g/ml, 0.7 to 7 nM total RNA), and 72 hours after transfection, the percentage of GFP+ cells were analyzed by flow cytometry. Data are means SD of three independent experiments. (F and G) Percentage of gene editing events upon either GFP or PLK1-cLNP transfection (F) and allelic frequencies (G) in the GFP loci as determined by NGS analysis (allelic frequencies of >2% are presented). (H) GFP disruption assay in multiple cancer cell lines compared to mock-treated cells. Cells were transfected with L8-cLNPs, and 72 hours after transfection, the percentage of GFP+ cells were analyzed by flow cytometry. Data are means SD of three independent experiments.

The efficiency and specificity of gene disruption by L8-cLNPs encapsulating GFP sgRNAs (sgGFP-cLNPs) in HEK293/GFP were assessed by quantifying the percent of gene-edited GFP genomic sequences by next-generation sequencing (NGS). Ninety-four percent of GFP genomic DNA was modified, but <0.1% was edited at a nontargeted locus (PLK1) (Fig. 1, F and G). sgGFP-cLNPs did not significantly affect cell viability at all tested concentrations (up to 1 g/ml; fig. S2). Next, we evaluated gene disruption using L8-cLNPs in multiple GFP-expressing, aggressive cancer cell lines [005 murine glioblastoma multiforme (GBM), human serous ovarian adenocarcinomas Ovcar8 (OV8) and NCI-ADR (NAR), human colon carcinoma HCT116, and human lung adenocarcinoma A549]. After incubation with sgGFP-cLNPs (1 g/ml; 7 nM of total RNA), GFP fluorescence was only detected in 3 to 18% of these cancer cells (Fig. 1H). Thus, L8-cLNPs cause efficient and specific gene editing in vitro with low toxicity in multiple cancer cell lines.

To explore the potential of therapeutic genome editing, as proof of concept, we evaluated L8-cLNPs containing PLK1 sgRNA (sgPLK1-cLNPs) or sgGFP-cLNPs as control. PLK1 is a kinase required for mitosis; lack of it leads to G2-M phase cell cycle arrest and cell death in dividing cells. Treating HEK293/GFP with sgPLK1-cLNPs (0.5 g/ml) caused 98% PLK1 gene editing, while <0.1% was edited at the nontargeted GFP locus by NGS (Fig. 2, A and B). PLK1 gene editing caused potent G2-M arrest 48 hours later, while control sgGFP-cLNPs had no effect on cell cycle profile (Fig. 2, C and D). Treatment with sgPLK1-cLNP resulted in a fivefold decrease in cell viability compared to untreated or sgGFP-cLNPtreated cultures, as analyzed by 4,6-diamidino-2-phenylindole (DAPI)/annexin V staining and by XTT assay, 96 hours after treatment (Fig. 2, E to G). Preserved cell viability after treatment with sgGFP-cLNPs suggests that cLNPs may have low toxicity at therapeutically relevant doses.

(A and B) Percentage of gene editing events (A) and allelic frequencies (B) in the PLK1 loci as determined by NGS analysis (allelic frequencies of >2% are presented). (C and D) Cell cycle analysis of HEK293 cells treated with mock, sgGFP, or sgPLK1-cLNPs (0.5 g/ml, 3.5 nM of total RNA) for 48 hours and analyzed by flow cytometry. (C) Bar charts representing the percentage of G1-S and G2-M cell cycle phases. Data are means SD of three independent experiments. (D) Representative cell cycle analysis diagram. (E and F) DAPI/annexin V assay of HEK293 cells treated with mock, sgGFP, or sgPLK1-cLNPs (0.5 g/ml, 3.5 nM total RNA) for 96 hours and analyzed by flow cytometry. (E) Bar charts representing the percentage of live cells normalized to mock-treated cells. Data are means SD of three independent experiments. (F) Representative DAPI/annexin assay diagram. (G) XTT cell viability assay of HEK293 cells treated with mock, sgGFP, or sgPLK1-cLNPs (0.5 g/ml, 3.5 nM total RNA) 96 hours after treatment. Bar charts representing the % of cell viability normalized to mock-treated cells. Data are means SD of three independent experiments. (E and G) One-way analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****P < 0.0001.

To explore the potential of cLNPs for therapeutic genome editing in cancer, we evaluated cancer cell lines of two aggressive and difficult to treat cancersthe murine GBM stem celllike 005 cell line isolated from gliomas that formed in Tp53+/ mice after intracerebral lentiviral transduction of activated H-Ras and Akt (18, 19) and human OV8, a high-grade serous ovarian adenocarcinoma cell line that is highly drug resistant and metastasizes to form ascites (20, 21). GBM 005 cells resemble almost uniformly fatal human GBM, in that they are highly invasive, neovascularized, pleomorphic, and infiltrated by immune cells (18, 19). Intraperitoneally injected OV8 form chemoresistant, metastatic, high-grade ovarian cancer xenografts, like most human ovarian cancers. In vitro incubation of GBM 005 or OV8 with sgPLK1, but not sgGFP, cLNPs efficiently disrupted the PLK1 gene, causing 84 and 91% genomic editing, respectively (Fig. 3, A and F, and fig. S3). Disruption of PLK1 also strongly caused G2-M cell cycle arrest 48 hours after treatment (Fig. 3, B, C, G, and H, and fig. S4, A and C) and reduced cell viability 96 hours after treatment by 5-fold in GBM 005 and 10-fold in OV8, respectively (Fig. 3, D and I). Similarly, DAPI and/or annexin V staining increased after incubation with sgPLK1, but not sgGFP-cLNPs (Fig. 3, E and J, and fig. S4, B and D). Thus, sgPLK1-cLNPs efficiently disrupted the targeted gene and caused cell cycle arrest and death of GBM 005 and OV8 in vitro.

(A and F) Percentage of gene editing events in the PLK1 loci in 005 and OV8 as determined by NGS analysis. (B and G) Bright-field microscopy representative images of 005 and OV8 cells treated with mock, sgGFP, or sgPLK1-cLNPs [005: 0.5 g/ml (3.5 nM total RNA); OV8: 1 g/ml (7 nM total RNA)], 72 hours after treatment. (C and H) Cell cycle analysis of 005 and OV8 cells, treated with mock, sgGFP, or sgPLK1-cLNPs [005: 0.5 g/ml (3.5 nM total RNA); OV8: 1 g/ml (7 nM total RNA)] for 48 hours and analyzed by flow cytometry. Bar charts representing the % of G1, S, and G2-M cell cycle phases. Data are means SD of three independent experiments. (D and I) XTT cell viability assay of 005 and OV8 cells treated with mock, sgGFP, or sgPLK1-cLNPs [005: 0.5 g/ml (3.5 nM total RNA), OV8: 1 g/ml (7 nM total RNA)] for 96 hours. Bar charts representing the % of cell viability normalized to mock-treated cells. Data are means SD of three independent experiments. (E and J) DAPI/annexin V apoptosis analysis of 005 or OV8 cells treated with mock, sgGFP, or sgPLK1-cLNPs [005: 0.5 g/ml (3.5 nM total RNA); OV8: 1 g/ml (7 nM total RNA)] for 96 hours and analyzed by flow cytometry. Bar charts representing the percentage of live cells normalized to mock-treated cells. Data are means SD of three independent experiments. (C, E, and H to J) One-way ANOVA with Tukey multiple comparison test was used to assess the significance. ***P < 0.001 and ****P < 0.0001.

To evaluate the therapeutic potential of cLNPs for cancer, we needed to address two major concerns about CRISPR-Cas9 therapeutics: potential toxicity and immunogenicity. An initial study evaluated liver toxicity, blood counts, and serum inflammatory cytokines 24 hours after intravenous injection of sgGFP-cLNPs (1 mg/kg) into C57BL/6 mice. There were no apparent clinical signs of toxicity and no significant difference in liver enzyme (alanine transaminase, aspartate aminotransferase, and alkaline phosphatase) levels (fig. S5A) or blood counts (fig. S5B). A plasma cytokine panel [interleukin-1 (IL-1), IL-2, tumor necrosis factor (TNF-), interferon- (IFN-), and IL-10] also showed no significant differences (fig. S5C). Although more extensive evaluation of potential toxicity is needed for preclinical development, these results suggest that L8-cLNPs are not toxic or immunogenic when administered systemically at therapeutically relevant doses (see below).

Next, we evaluated whether the high genome editing efficacy observed in vitro could be translated to therapeutic efficacy in vivo. GBM 005 cells expressing GFP, mCherry, and luciferase were injected stereotactically into the mouse hippocampus. (Fig. 4A). Ten days later, Cy5.5-labeled sgGFP-cLNPs or phosphate-buffered saline (PBS) was injected intratumorally, and mice were euthanized 6 hours later to evaluate the tumor distribution by fluorescence microscopy. The Cy5.5-labeled cLNPs distributed throughout the tumor (Fig. 4B). To evaluate in vivo gene editing, sgGFP-cLNPs (0.05 mg/kg) were injected stereotactically into established tumors, mice were euthanized 2 days later, and single-cell tumor suspensions were analyzed by NGS for GFP gene editing. A single intracerebral injection facilitated ~72% of editing in the GFP locus in tumor cells (fig. S6A). To validate whether gene editing will translate to a loss of GFP fluorescence, sgGFP-cLNPs (0.05 mg/kg) were injected stereotactically into established tumors, mice were euthanized 7 days later, and single-cell tumor suspensions were analyzed by flow cytometry for GFP expression. GFP fluorescence in tumor cells was reduced by about twofold, demonstrating in vivo gene disruption (fig. S6, B and C). Next, to evaluate PLK1 gene disruption in vivo, either sgPLK1 or sgGFP-cLNPs (0.05 mg/kg) were injected stereotactically into established tumors, mice were euthanized 2 days later, and single-cell tumor suspensions were analyzed by NGS for PLK1 gene editing. sgPLK1-cLNPs facilitated ~68% editing in the PLK1 locus in tumor cells (Fig. 4C). To evaluate in vivo apoptosis caused by PLK1 gene disruption, either sgPLK1 or sgGFP-cLNPs (0.05 mg/kg) were injected stereotactically into established tumors. Mice were euthanized 3 days later, and tumor sections were analyzed by fluorescence microscopy for caspase-3 activation. Activated caspase-3 was only present in sgPLK1-cLNPtreated tumors, while no apparent staining was visualized in tumors treated with sgGFP-cLNPs, demonstrating PLK1-dependent apoptosis (Fig. 4D). Adjacent normal GFP tissue also did not show any evidence of caspase-3 activation. Because neurons are terminally differentiated nondividing cells, normal brain tissue has minimal expression of PLK1; therefore, it is not expected to undergo apoptosis. Next, we evaluated whether sgPLK1-cLNPs can inhibit tumor growth. GBM 005bearing mice were injected stereotactically once with sgPLK1 or sgGFP-cLNPs (0.05 mg/kg) (Fig. 4E). A single intratumoral injection of sgPLK1-cLNPs significantly reduced tumor growth compared to control groups as quantified by live animal luciferase activity (Fig. 4, F and G) and increased median survival from 32.5 to >48 days (Fig. 4H). Thirty percent of sgPLK1-cLNPtreated mice survived for 60 days when the experiment was terminated, while all the control mice died by 40 days. sgGFP-cLNPs had no significant effect on tumor growth or survival. As far as we are aware, these findings represent the highest survival improvement in this aggressive tumor after a single treatment.

(A) Schematic illustration of intracerebral injection to mouse brain. (B) cLNP dispersion through the tumor lesion upon intracerebral injection of Cy5.5-cLNPs to the tumor bed of 005 GBMbearing mice. Brain sections were analyzed by confocal microscopy, 6 hours after injection. Blue, DAPI; green, 005 GFP cells; yellow, Cy5.5 cLNPs. Scale bars, 50 m. (C) Percentage of gene editing events in the PLK1 locus as determined by NGS analysis, 48 hours after injection of PBS or 0.05 mg/kg of sgGFP-cLNPs or sgPLK1-cLNPs. (D) In vivo apoptosis induction using activated caspase 3 staining upon injection of either PBS or 0.05 mg/kg of sgGFP-cLNPs or sgPLK1-cLNPs. Brain sections were analyzed by confocal microscopy 3 days after injection. Blue, DAPI; green, 005 GFP cells; red, cleaved caspase 3. Scale bars, 50 m. (E) Experimental design. Ten days after tumor inoculation, sgGFP-cLNPs, sgPLK1-cLNPs, or PBS (0.05 mg/kg) was injected into the tumor bed. Tumor growth was monitored using bioluminescence of 005-GFP-Luc cells by the IVIS in vivo imaging system. (F and G) Tumor growth inhibition by single-dose treatment with cLNPs. (F) Representative bioluminescence imaging of 005 GBMbearing mice. (G) 005 tumor growth curve quantification. Data are presented in total flux (p/s) SEM; n = 15 animals per treatment group and n = 8 animals in the PBS group; ****P < 0.0001. One-way ANOVA was used to assess the significance at day 41. (H) Survival curves of 005 GBMbearing mice. n = 30 animals per treatment group and n = 8 animals in the PBS group. ****P < 0.0001. Log-rank (Mantel-Cox) test was used for curve comparison.

Therapeutic strategies for most tumors, especially metastatic or hematological tumors, require systemic rather than local administration. However, most LNPs get trapped in the liver and other central organs and are not efficiently taken up by tumor cells after systemic injection. A strategy for cell-targeted gene editing could enhance gene editing of tumor cells and reduce toxicity and editing of nontransformed cells. We recently reported a flexible method for antibody-targeted cell-specific delivery of siRNAs and mRNAs using systemically injected LNPs (22, 23). These targeted LNPs are coated with cell-targeting antibodies by binding to a lipid-anchored single-chain antibody linker that recognizes the Fc region of rat immunoglobulin G2a [IgG2A; Anchored Secondary scFv Enabling Targeting (ASSET)] (Fig. 5A) and reduce the recognition of the targeting antibody by Fc receptors (23). To evaluate the in vivo therapeutic potential of targeted L8-cLNPs (T-cLNP) against human OV8 peritoneal xenografts, we used the fact that these tumors highly express the epidermal growth factor receptor (EGFR) (24) to target cLNPs to OV8 by coating them with anti-EGFR. Mice bearing disseminated peritoneal OV8-mCherry tumors were injected intraperitoneally 10 days after tumor inoculation with Cy5.5-labeled sgGFP-cLNPs (0.75 mg/kg) conjugated to anti-hEGFR (T) or IgG isotype control (I) antibody (T or ICy5.5-cLNPs, respectively) to explore tumor targeting and accumulation. Four hours later, tumors were collected, and the Cy5.5 signal in the tumors was measured by live animal fluorescent imaging. Cy5.5 signal in the tumor was three times higher in T-Cy5.5-cLNPtreated mice rather than in I-Cy5.5-cLNPtreated mice, demonstrating specific targeting and accumulation in the tumor of T-cLNPs (Fig. 5, B and C). Next, to evaluate in vivo PLK1 gene disruption, mice bearing metastatic OV8-mCherry tumors were injected intraperitoneally 10 days after tumor inoculation with sgPLK1 or sgGFP-cLNPs (0.75 mg/kg) conjugated to anti-hEGFR (T) or IgG isotype control (I) antibody (T- or I-cLNPs). Mice were euthanized 2 days later, tumors were collected, and single-cell tumor suspensions were analyzed by NGS for PLK1 gene editing. T-sgPLK1-cLNPs facilitated ~82% of editing in the PLK1 locus in tumor cells, but <1% was detected in control groups (Fig. 5D). To evaluate antitumor effectiveness, mice bearing metastatic OV8-mCherry tumors were injected intraperitoneally on days 10 and 17 after tumor inoculation with either T-sgPLK1-cLNPs, I-sgPLK1-cLNPs, T- sgGFP-cLNPs, or I-sgGFP-cLNPs (0.75 mg/kg) (Fig. 5E). Tumor growth, monitored using mCherry live animal fluorescent imaging, was strongly inhibited only by T-sgPLK1-cLNPs (Fig. 5, F and G) and increased overall survival by ~80% (Fig. 5H). No significant difference in tumor growth or survival was observed in control mice treated with either T-sgGFP-cLNPs, I-sgGFP-cLNPs, or I-sgPLK1-cLNPs (Fig. 5G). These findings suggest that targeted cLNPs may be useful for targeted treatment of disseminated tumors.

(A) Schematic illustration of targeted cLNP production using ASSET (23). (B and C) Tumor targeting and accumulation of Cy5.5-cLNPs in OV8 tumorbearing mice as analyzed by the IVIS in vivo imaging system, 4 hours after injection. (B) Representative fluorescence imaging of tumors extracted from mCherry-OV8bearing mice. Top, mCherry OV8 tumors; bottom, Cy5.5-cLNP signal accumulation. (C) Quantification of mean fluorescence intensity of Cy5.5-cLNP accumulation in mCherry-OV8 tumors. Data are means SD of three independent experiments. One-way ANOVA was used to assess the significance, *P < 0.05. (D) Percentage of gene editing events in the PLK1 locus as determined by NGS analysis, 48 hours after injection of I-sgGFP, T-sgGFP, I-sgPLK1, or T-sgPLK1 cLNPs (0.75 mg/kg). (E) Experimental design. Ten and 17 days after tumor inoculation, I-sgGFP, T-sgGFP, I-sgPLK1, or T-sgPLK1 cLNPs (0.75 mg/kg) were injected intraperitoneally. Tumor growth was monitored using mCherry fluorescence of OV8-mCherry cells by the IVIS in vivo imaging system. (F and G) Tumor growth inhibition by dual-dose treatment with cLNPs. (F) Representative fluorescence imaging of OV8-bearing mice. (G) OV8 tumor growth curve quantification. Data are presented in total flux (p/s) SEM; n = 10 per group. One-way ANOVA was used to assess the significance at day 49; ****P < 0.0001. (H) Survival curves of OV8-bearing mice. n = 10 animals per treatment group. ***P < 0.0001. Log-rank (Mantel-Cox) test was used for curve comparison.

Remarkable progress has been made to improve the efficacy and safety of CRISPR-Cas9 gene editing (4, 2528). However, broad clinical translation will be enhanced by safe delivery systems able to edit efficiently specific diseased tissues in vivo (3, 2931). Because of the large size of the Cas9 nuclease, its encapsulation in both viral and nonviral delivery systems remains a challenge. Several approaches have been used to overcome the obstacle of delivering the large Cas9 nuclease as nucleic acid or protein for gene editing in the liver or locally for treating genetic disorders (5, 3235). These approaches achieved about 60% gene editing in the liver, resulting in reduced protein or cholesterol levels in the serum and alleviating disease symptoms in models of hemophilia, hypercholesterolemia, or TTR (transthyretin) amyloidosis (5, 11, 36). To date, systemic administration results in low editing efficiencies in extrahepatic tissues, partly due to the lack of specific targeting of current delivery vehicles. To achieve therapeutic effects for nonliver diseases or disseminated diseases, such as cancer, higher tissue-specific targeting with sufficient editing efficiencies is needed. Other genetic therapies, such as those based on RNA interference (RNAi), are transient and, therefore, would require repeated dosing, especially for rapidly dividing cancer cells. The permanent nature of genome editing should have a therapeutic impact even after one or a few doses, which could strongly affect toxicity, development of adverse reactions, compliance, and cost. Furthermore, the bacterial origin of the Cas9 nuclease renders it to be recognized by the host immune system and elicits an immune response (37, 38). Long exposure time to the Cas9 nuclease, as well as repeating dosing, might increase the risk for Cas9-related immune responses following by immune-related adverse reactions and treatment failure. Therefore, to minimize this risk, delivery systems that could achieve therapeutic relevant genome editing with a limited number of administrations and short Cas9 exposure time must be developed.

In this study, we developed and tested an efficient nonviral LNP system for CRISPR-Cas9 gene editing, which showed gene editing of up to 98% in vitro in multiple cancer cell types and up to ~80% gene editing in vivo. cLNPs targeting PLK1 were able to inhibit tumor growth and improve survival in two aggressive cancer models in mice following single or double cLNP administrations. A single dose of sgPLK1-cLNPs to the tumor bed of a murine GBM model resulted in ~70% gene editing of the PLK1 gene, induced in vivo apoptosis as assessed by activated caspase 3 staining, prolonged median survival by ~50%, and improved overall survival of 005 GBMbearing mice by 30%. The blood-brain barrier (BBB) is a highly restrictive barrier for most therapeutic modalities. The clinical course of this devastating disease has not changed for over a decade, partly due to the limitation presented by the low BBB permeability to standard chemo- and immunotherapies. In recent years, multiple clinical trials have been conducted using local intracerebral administration with or without tumor resection to bypass the BBB; however, the success of these clinical trials was hampered by the low diffusion of the tested drugs and severe damages to the healthy brain parenchyma (3941). Our results highlight the potential of cLNPs to overcome the limitations of current therapies in a clinically relevant tumor model.

To reach disseminated tumors, we also constructed cell-targeted cLNPs, decorated with an antibody to an overexpressed receptor on ovarian cancer cells. EGFR-targeted cLNPs accumulated in disseminated tumors significantly more than IgG control cLNPs, demonstrating the advantage of a cell-targeted approach for disseminated tumors. Furthermore, a single administration of EGFR-targeted cLNPs facilitated up to ~80% PLK1 gene editing in vivo. Two intraperitoneal injections of EGFR-targeted sgPLK1-cLNPs greatly reduce tumor growth and increased overall survival by ~80% of mice with high-grade ovarian cancer malignant ascites. The majority of ovarian cancers are diagnosed at late stages when tumor metastasizes throughout the peritoneal cavity (42, 43). Recent clinical studies have demonstrated an improved pharmacokinetic profile of intraperitoneally injected chemotherapy resulting in higher drug concentration in the abdominal cavity and improved progression-free survival and overall survival. Furthermore, the partial systemic restriction of intraperitoneal administration resulted in reduced toxicity and treatment-related complications (4446). The targeting strategy we designed, using the ASSET linker system (22, 23), is, to our knowledge, the first example of targeted CRISPR-Cas9 therapeutic gene editing for treating metastatic tumors. It provides a highly flexible and efficient strategy for targeted gene editing that could be used by changing the antibody, for targeting either tumor cells via tumor-specific cell surface receptors (such as EpCAM or PSMA) or shared tumor and normal cell receptors (such as CD19 on B cell lymphomas), or for targeting nontransformed cells in diseased tissues. Targeting provides a way of overcoming the limitations of most LNP and nanoparticle delivery systems, whose therapeutic effect is largely limited to the liver and other central organs, where particles get trapped. Moreover, targeted LNPs can be administered systemically to target both localized and disseminated (such as metastatic and/or hematopoietic) cells (22, 23).

In this study, we edited PLK1 as proof of concept, but this cancer therapeutic strategy could be extended to edit tumor dependency genes that are not vital for normal tissues and to edit specific tumor dependency genes (such as BCR-ABL) or patient- and tumor-specific oncogene mutations (such as RAS). The Cas9 isolated from Streptococcus pyogenes was used for this proof-of-concept study but could be substituted with other CRISPR-associated nucleases to favor homologous recombination (HR) events or reduce off-target gene editing. Additional safety concern of translating CRISPR technologies to the clinic resides in off-target gene editing of bystander cells. This risk can be mitigated by the addition of tissue- or cell-specific miR binding sites to the mRNA sequence, which results in tissue-specific suppression of mRNA translation (47, 48). The main off-target site of LNP-based platforms is the liver, more specifically hepatocytes and Kupffer cells (49, 50), and suppression of mRNAs in these cell types can be achieved by inserting miR122 and miR142 binding sites, respectively. Using these tissue-specific mRNA suppression approaches is crucial for further clinical development of gene editing technologies. For noncancer applications, we could envision using targeted cLNPs for patient-tailored applications to correct genes associated with genetic deficiencies. Another application would be to disrupt a nonessential gene, whose knockout has no deleterious consequences but whose expression contributes to disease pathogenesis. One example is CCR5, whose knockout could potentially be used to prevent HIV transmission and cure HIV. Thus, this therapeutic strategy opens new avenues for using genome editing as a novel modality for treating various diseases and bringing CRISPR-Cas9 editing technology to the clinic.

HEK293 [American Type Culture Collection (ATCC) CRL-1573], HCT116 (ATCC CCL-247), and A549 (ATCC CCL-185) cells were purchased from ATCC, and OV8 and NCI/ADR-RES (NAR) were supplied by R. Margalit and maintained in Dulbeccos modified Eagles medium (DMEM) or RPMI 1640 (Gibco, Thermo Fisher Scientific Inc.) supplemented with 10% fetal bovine serum (Biological Industries, Israel), 1% l-glutamine (Gibco, Thermo Fisher Scientific Inc.), and 1% penicillin-streptomycin-nystatin (Biological Industries, Israel). The 005 cells (supplied by D. Friedman-Morvinski) were maintained in stem cell medium, as previously described (15). GFP-expressing cells (HEK293 and NAR) were stably transfected with pQCXIP-GFP/d2. All cells were routinely checked every 2 months for mycoplasma contamination using the EZ-PCR Mycoplasma Test Kit (Biological Industries, Israel).

DLin-MC3-DMA (MC3) and Lipid 8 were synthesized according to a previously described method (12, 23). Cholesterol, DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), polyethylene glycol (PEG)DMG (1,2-dimyristoyl-rac-glycerol), and DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanolamine)PEG were purchased from Avanti Polar Lipids Inc. Briefly, one volume of lipid mixture (ionizable lipid, DSPC, cholesterol, DMG-PEG, and DSPE-PEG at 50:10.5:38:1.4:0.1 molar ratio) in ethanol and three volumes of mCas9/sgRNA (mCas9:sgRNA 3:1 weight ratio, 1:10 molar ratio RNA to ionizable lipid) in a citrate buffer were injected into a NanoAssemblr microfluidic mixing device (Precision Nanosystems Inc.) at a combined flow rate of 12 ml min1. The formed LNPs were dialyzed twice against PBS (pH 7.4) for 16 hours to remove ethanol.

cLNP size distribution and potential were determined by dynamic light scattering using a Malvern Nano ZS sizer (Malvern Instruments). For size measurements, cLNPs were diluted 1:20 in PBS. All used samples showed a PDI (polydispersity index) lower than 0.2. For potential measurements, cLNPs were diluted 1:200 in double-distilled water.

A drop of an aqueous solution containing LNPs was placed on a carbon-coated copper grid and dried and analyzed using a JEOL 1200 EX transmission electron microscope.

To incorporate ASSET into LNPs, ASSET was incubated with LNPs for 48 hours at 4C (1:36, ASSET:RNA weight ratio), as previously described (21). Anti-human EGFR antibody (Bio-Rad Laboratories Inc., clone ICR10) or rat IgG2a isotype control (Bio X Cell, NH, USA, clone 2A3) were used.

To quantify the RNA in LNPs and to determine the RNA encapsulation efficiency, the Quant-iT RiboGreen RNA assay (Life Technologies) was used as previously described (21, 22). Briefly, 2 l of LNPs or dilutions of ribosomal RNA at known concentrations were diluted in a final volume of 100 l of TE buffer (10 mM tris-HCl and 20 mM EDTA) in the presence or absence of 0.5% Triton X-100 (Sigma-Aldrich) in a 96-well fluorescent plate (Costar, Corning). The plate was incubated for 10 min at 40C to allow particles to become permeabilized before adding 99 l of TE buffer and 1 l of RiboGreen reagent to each well. Plates were shaken at room temperature for 5 min, and fluorescence (excitation wavelength of 485 nm and emission wavelength of 528 nm) was measured using a plate reader (BioTek Industries) according to the manufacturers protocol.

Cells were counted using trypan blue (Biological Industries), and 0.1 106 cells were placed in tissue culture 12-well plates (Greiner Bio-One, Germany) with 1 ml of growing medium. MC3 or c-LNPs were added to the wells at RNA amounts of 0.1 to 2 g. Cells were incubated with the treatments in standard culture conditions for 24 to 120 hours. Then, cells were washed three times, incubated in a fresh culture medium, and collected for flow cytometry (72 to 96 hours) or cell cycle assays (24 to 48 hours), as described below. For 005 cells, cLNPs were preincubated with ApoE3 (0.001 mg/ml; PeproTech, USA) before the addition to the cells.

sgRNAs were designed and synthesized by Integrated DNA Technologies: GFP, GACCAGGAUGGGCACCACCC/sgRNA core; MmPLK1, CTAGCACACCAACACGTCGT/sgRNA core; HsPLK1, AATTACATAGCTCCCGAGGT/sgRNA core. CleanCap Cas9 mRNA (modified) was purchased from TriLink BioTechnologies Inc.

Seventy-two hours after transfection, cells were collected and the percentage of GFP cells was evaluated using CytoFLEX and analyzed using the CytExpert software (Beckman Coulter, USA).

For in vitro uptake experiments, 20% of the total RNA content of cLNPs was replaced with an equal amount of short Cy5.5-labeled DNA oligo (Cy5.5: AGCTCTGTTTACGTCCCAGC). Binding of the labeled cLNPs was assessed by flow cytometry (CytoFLEX and the CytExpert software, Beckman Coulter, USA). Analyses were done with FlowJo software (FlowJo LLC, USA). To determine the uptake of MC3-cLNPs or L8-cLNPs, 0.5 106 cells were incubated with cLNPs (0.1 to 1 g/ml) at 37C for 2 hours. Cells were collected for flow cytometry analysis after three rounds of PBS wash.

Percentage of gene editing was evaluated in cell lines or sorted tumor cells extracted from tumors (GFP+ 005 cells or mCherry+ OV8 cells) as described below (single-cell suspension sections). Genomic DNA was extracted with QuickExtract DNA Extraction Solution (Lucigen Inc.) using the manufacturers protocol, and amplification was performed using locus-specific primers containing universal tails to add sample-unique P5 and P7 indexes for Illumina sequencing in two rounds of polymerase chain reaction (PCR). Following PCR, a 1 SPRI (Solid Phase Reversible Immobilization) bead cleanup and library quantification by quantitative PCR (IDT) were performed before sequencing. PCR amplicons were sequenced on an Illumina MiSeq instrument [v2 chemistry; 150base pair (bp) paired-end reads; Illumina, San Diego, CA, USA]. Data were analyzed using a custom-built pipeline. Data were demultiplexed (Picard tools v2.9; https://github.com/broadinstitute/picard); forward and reverse reads were merged into extended amplicons (flash v1.2.11); reads were aligned against the GRCh38 genomic reference (bwa mem v0.7.15), assigned to targets (bedtools tags v2.25). Reads, with more than 30% of bases with quality scores less than 15, were filtered out. At each target, custom python code identified INDELs based on gapped alignments between reads and targets, and editing was calculated as the percentage of total reads containing an INDEL within an 8-bp window of the cut site.

For cell cycle analysis, 5 105 cells were collected 48 hours after LNP transfection. The cells were washed with ice-cold PBS and fixed with 70% ethanol for 1 hour. Then, the cells were washed twice with cold PBS and incubated for 10 min at 37C in 300 l of PBS with 2-(4-amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI; 15 g/ml; Merck KGaA, Darmstadt, Germany). Fluorescence was measured by flow cytometry. Cell viability was evaluated by flow cytometry using APC Annexin V (BioLegend Inc., 640941) and DAPI as recommended by the manufacturer. Data from at least 2 104 cells were acquired using CytoFLEX and the CytExpert software (Beckman Coulter, USA). Analyses were done with FlowJo software. For cell cycle analysis, the Dean-Jett-Fox model was applied to at least 10,000 gated cells. Cell viability evaluation was done using the XTT Cell Proliferation Kit (Biological Industries, Israel) according to the manufacturers recommendation.

Eight-week-old female C57BL/6JOlaHsd mice (Envigo, Rehovot, Israel) were anesthetized, positioned in the Kopf Stereotaxic Alignment System, and inoculated with 3 105 005 cells in a 1.5-l volume using automatic syringe pump in a rate of 0.3 l/min. Injections were made to the right frontal lobe, ~1.5 mm lateral, 2 mm caudal from bregma, and at a depth of 2.3 mm. Bioluminescence imaging (IVIS SpectrumCT, PerkinElmer Inc.) was performed every 5 days after tumor cell implantation to monitor tumor growth. XenoLight d-luciferin (122799, PerkinElmer Inc.) was injected at 15 mg/kg subcutaneously. Bioluminescence analysis was conducted using the Living Image software (PerkinElmer Inc.).

Ten days after tumor inoculation, 005 GBMbearing mice were anesthetized, positioned in the Kopf Stereotaxic Alignment System, and injected with either sgGFP-cLNPs, sgPLK1-cLNPs, or PBS (0.05 mg/kg) in a 1.5-l volume using automatic syringe pump in a rate of 0.3 l/min. Injections were made to the right frontal lobe, ~1.5 mm lateral, 2 mm caudal from bregma, and at a depth of 2.3 mm.

Tumor-bearing brains were processed to single-cell suspensions using the Neural Tissue Dissociation Kit (P) (Miltenyi Biotec, USA) and gentleMACS Dissociator according to the manufacturers protocol. For NGS analysis, GFP+ 005 tumor cells were sorted using a BD FACSAria III sorter and further processed as described above.

Twenty percent of the total RNA content of the sgGFP-cLNPs was replaced with an equal amount of short Cy5.5-labeled DNA oligo (Cy5.5: AGCTCTGTTTACGTCCCAGC). Four hours after injection, mice were euthanized and brains were harvested. For fluorescent staining, coronal brain sections (40 m) were cut on a microtome, and images were obtained using a confocal laser-scanning microscope.

Eight-week-old female Hsd: Athymic Nude-Foxn1nu mice (Envigo, Rehovot, Israel) were injected with 3 106 OV8-mCherry cells intraperitoneally. Fluorescence imaging (IVIS SpectrumCT, PerkinElmer Inc.) was performed weekly after tumor cell implantation to monitor tumor growth. Fluorescence analysis was conducted using the Living Image software (PerkinElmer Inc.).

Tumor-bearing mice were processed to single-cell suspensions using Tumor Dissociation Kit, mouse (Miltenyi Biotec, USA) and gentleMACS Dissociator, according to the manufacturers protocol. For NGS analysis, mCherry+ tumor cells were sorted using a BD FACSAria III sorter and further processed as described above.

OV8-bearing mice were injected intraperitoneally with either anti-EGFRsgGFP-cLNPs, isotype controlsgGFP-cLNPs, anti-EGFRsgPLK1-cLNPs, or isotype controlsgPLK1-cLNPs (0.75 mg/kg). For tumor-targeting experiments, OV8-bearing mice were injected intraperitoneally with either anti-EGFR Cy5.5-sgGFP-cLNPs or isotype control Cy5.5-sgGFP-cLNPs (0.75 mg/kg). Fluorescence imaging (IVIS SpectrumCT, PerkinElmer Inc.) was performed 4 hours after LNP injection to evaluate tumor targeting and accumulation. Fluorescence analysis was conducted using the Living Image software (PerkinElmer Inc.).

Ten-week-old female C57BL/6 mice (Envigo Laboratories) were injected with sgGFP-cLNPs (1 mg/kg) intravenously. Twenty-four hours after injection, blood was collected for biochemistry using Cobas-6000 instrument and complete blood count via Sysmex and ADVIA 120 (A.M.L., Israel). The serum was separated and stored at 80C before cytokine analysis. Cytokine analysis was done by Pharmaseed Pre-clinical CRO, Israel.

All animal protocols were approved by the Tel Aviv University Institutional Animal Care and Usage Committee and in accordance with current regulations and standards of the Israel Ministry of Health. All animal experiments were conducted in a double-blinded fashion; the researchers were blinded to group allocation and administered treatments. Mice were randomly divided in a blinded fashion at the beginning of each experiment.

Statistical analysis for comparing two experimental groups was performed using two-sided Students t tests. In experiments with multiple groups, one- or two-way analysis of variance (ANOVA) with a Tukey correction was used to calculate differences among multiple populations. Kaplan-Meier curves were used to analyze survival. A value of P < 0.05 was considered statistically significant. Analyses were performed with Prism 7 (GraphPad Software). Differences are labeled n.s. for not significant, * for P 0.05, ** for P 0.01, *** for P 0.001, and **** for P 0.0001. Preestablished criteria for the removal of animals from the experiment were based on animal health, behavior, and well-being as required by ethical guidelines.

Acknowledgments: We thank N. Dammes for drawing the illustrations and V. Holdengreber for the scientific assistance with electron microscopy. Funding: A.G. thanks the Dr. Albert and Doris Fields Trust, the Marian Gertner Institute for Medical Nanosystems, and the Glaser Foundation for her fellowships. This work was supported, in part, by grants from the Israel Cancer Research Fund (grant no. 16-1285-PG). Author contributions: D.R., A.G., R.K., S.R., N.V., and D.P. conceived and designed the project. D.R., A.G., A.M.J., M.S.S., and D.F.-M. performed the experimental work. D.R., A.G., A.M.J., M.S.S., D.F.-M., Z.R.C., M.A.B., J.L., and D.P. analyzed the data. D.R., A.G., and D.P. wrote the manuscript. All authors discussed the results. Competing interests: A.M.J., M.S.S., and M.A.B. are employed by Integrated DNA Technologies Inc. (IDT), which manufactures reagents similar to some described in the manuscript. M.A.B. owns equity in DHR, the parent company of IDT. R.K. and D.P. are inventors on a patent related to this work filed by Ramot at Tel Aviv University (no. U.S. 10,543,278 B2, published on 28 January 2020). R.K., N.V., and D.P. are inventors on a pending patent related to this work filed by Ramot at Tel Aviv University (no. U.S. 2019/ 0309087 A1, filed on 10 October 2019). D.P. and S.R. are inventors on a pending patent related to this work filed by Ramot at Tel Aviv University (no. U.S. 2019/0292130 A1, filed on 26 September 2019). D.P., D.R., and A.G. are inventors on a patent application related to this work filed by Ramot at Tel Aviv University (filed on 20 May 2020). Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors. The ionizable amino lipids and the ASSET linker described in this manuscript can be provided by D.P. pending scientific review and a completed material transfer agreement. Requests for the above materials should be submitted to peer{at}tauex.tau.ac.il.

Read more:
CRISPR-Cas9 genome editing using targeted lipid nanoparticles for cancer therapy - Science Advances

BRAZIL - 2020/10/29: In this photo illustration the CRISPR Therapeutics logo seen displayed on a ... [+] smartphone. (Photo Illustration by Rafael Henrique/SOPA Images/LightRocket via Getty Images)

Despite a large 3x rise since the March 23 lows of this year, at the current price of around $107 per share we believe CRISPR Therapeutics stock (NASDAQ: CRSP), a biotechnology gene editing company focused on developing gene-based medicines for human diseases, has more room for growth in the near term. CRSP stock has rallied from $34 to $107 off the recent bottom compared to the S&P which moved 60% over the same period, with the resumption of economic activities as lockdowns are gradually lifted. CRSP stock is also up 4.5x from levels seen in early 2018, over two years ago.

Some of the 4x rise of the last 2 years is justified by the roughly 7x growth seen in CRISPRs revenues from 2017 to 2019, while its revenue per share grew 5x to $5.32 in 2019, compared to $1.02 in 2017. This mismatch can be attributed to a 36% uptick in total shares outstanding due to share issuances. Despite the growth in RPS, the companys P/S Multiple saw a contraction. We believe the stock is likely to see upside despite the recent uptick and the potential weakness from a recession-driven by the Covid outbreak. Our dashboard, What Factors Drove 350% CRISPR Therapeutics Stock between 2017 and now?, has the underlying numbers.

CRISPRs P/S multiple changed from 23x in 2017 to 11x in 2019. While the companys P/S is 20x now (based on trailing RPS), there is a potential upside given the expected growth in RPS over the coming years, as we discuss below.

So whats the likely trigger and timing for upside?

Theres not much to look at CRISPRs Q3 sales of $0.2 million, which compares with $212 million in the prior year quarter, which included collaboration revenues from Vertex Pharmaceuticals VRTX in connection with co-development of CTX001, an experimental gene therapy for people with sickle cell disease and transfusion-dependent beta thalassemia. So with barely any revenues this year, whats the buzz around CRISPR stock, given it has rallied 3x over the recent months? It all boils down to its pipeline. The company is working to mass-produce cell therapies that will work in any person. Currently, cell therapies are manufactured from cells derived from human donors or from a patients own cells, making the process lengthy and cumbersome to develop the medication. If CRISPR is successful in its approach, it would mean off-the-shelf cell-based medicines developed using cells from diverse group of donors. The companys in-house CTX110 therapy for non-Hodgkins lymphoma has seen positive results from phase 1 trials. The CTX001, which the company is co-developing with Vertex has received Rare Pediatric Disease designation from the U.S. FDA. Overall, CRISPR stocks value is something to be looked at purely from its potential pipeline. CTX110 alone if approved could garner sales over $1.5 billion. The estimated revenues for 2020 and 2021 are $2.5 million and $12.7 million.

CRISPR is a high growth stock and it comes with a high risk as well. There could be a case where the therapies in CRISPRs pipeline arent found effective. Also, we dont know the timeline of when the products will be ready to be sold. That said, investors willing to be patient will likely be rewarded with any positive data from clinical trials for these therapies

Trefis

What if youre looking for a more balanced portfolio instead? Heres a high quality portfolio to beat the market, with over 100% return since 2016, versus 55% for the S&P 500. Comprised of companies with strong revenue growth, healthy profits, lots of cash, and low risk, it has outperformed the broader market year after year, consistently.

See allTrefis Price EstimatesandDownloadTrefis Datahere

Whats behind Trefis? See How Its Powering New Collaboration and What-Ifs ForCFOs and Finance Teams |Product, R&D, and Marketing Teams

Excerpt from:
Heres Why You Should Stay Invested In CRISPR Stock Despite The Recent 3x Rally - Forbes

Here with your Southeast Regional Ag Report, Im Tim Hammerich.

Its nearly impossible to talk about the Florida citrus industry in 2020, without at least mentioning citrus greening disease. Otherwise known as huanglongbing, citrus greening is spread by the asian citrus psyllid which serves as a vector for the disease.

Citrus greening has done enormous damage to the Florida citrus industry despite years of research to try to develop effective management tools. Scientists are now hopeful that CRISPR can help. The tool for editing genomes, allows breeders to select for very specific traits, and iterate more quickly.

And they have a roadmap to follow. CRISPR has been used to develop resistant varieties to citrus canker. A program started in 2013 was able to identify the citrus canker susceptibility gene in 2014, and through CRISPR found a way to knock out this susceptibility gene. They have now made, this year, citrus varieties that are resistant to citrus canker.

Dr. Nian Wong, professor at the Citrus Research at Education Center for the University of Florida IFAS at Lake Alfred, says they were able to make progress on citrus canker much quicker than traditional breeding, and he hopes this can also be applied to citrus greening.

While there can be no guarantees on timing, Dr. Wong hopes that progress can be made on citrus greening on a similar timeline to what theyve been able to do these past seven years with citrus canker.

Read the original:
CRISPR for Citrus Greening - AG INFORMATION NETWORK OF THE WEST - AGInfo Ag Information Network Of The West

Benzinga

Who would have thought 2020 would be the dawn of a new era in electric vehicle stocks. Though many of these companies have been on the market in one shape or form for years, most have traded as penny stocks. Tesla Inc (NASDAQ: TSLA), which was always the top dog in the industry, now finds itself with a number of major competitors.There's no denying that FOMO (fear of missing out) has driven short-term trends in these lesser-known names, and those who invested early are now reaping the benefits.Before we continue, we need to acknowledge that these stocks carry huge amounts of risk. The EV stocks detailed below are all volatile like penny stocks. So if you are looking for ways to trade these names or make money with penny stocks, it's important to control your downside.All that being said, a number of new EV stocks have also helped fuel demand. Let's say you decided that after the March sell-off this year to invest some money into electric vehicle penny stocks. What would that look like right now if you were to take $500 at that time and throw it blindly into some of these names?Kandi Technologies Group, Inc. (NASDAQ: KNDI)Kandi Technologies is one of the newer names in the space. In 2013, the company and Geely Group, a Chinese automaker, jointly invested in the establishment of Fengsheng Automotive Technology Group Co., Ltd. in order to develop, manufacture and sell pure EV products. Earlier this year, Fengsheng introduced its first pure electric SUV, the Maple 30x.Fast-forward to today and Kandi has established dealer partnerships for the retail launch of two "affordable EV models"- K23 and K27. Shares of KNDI have rallied almost 180% in the last two weeks, nearly getting back to the all-time high of $17.40 from July 30.A $500 investment in Kandi in mid-March would've gotten someone around 230 shares. At today's price, that position would be worth around $3,300. That's a 560% return.ElectraMeccanica Vehicles Corp (NASDAQ: SOLO)ElectraMeccanica's flagship is a single-passenger EV dubbed "SOLO". The company has been working toward commercialization and building its U.S. footprint, with its first round of new retail locations just announced at the end of October and the initial shipment of SOLO EV's just arriving in North America.With commercial launch imminent and momentum as a backdrop, SOLO shares have surged in recent weeks. In a July interview with Benzinga, ElectraMeccanica CEO Paul Rivera said, "We are not trying to compete with Tesla... When you're driving this car, it's just you, and you're focused on the road."With SOLO shares trading around $0.90 in mid-March, a $500 position would be somewhere in the ballpark of 555 shares. As of Thursday, the former penny stock reached a high of $9.74 making that position worth about $5,405, a 900% gain.Blink Charging Co. (NASDAQ: BLNK)Another one of the "pick and shovel" EV stocks is Blink Charging. The company continues gaining exposure as its charging stations remain a hot topic among traders and customers alike. Not only has Blink focused on expanding its charging footprint, but the company has also benefitted from other industry news. Apple Inc (NASDAQ: AAPL) for example, announced earlier this year that its Apple Maps would include EV charge routing. According to Blink, that will include its charging stations. Last week, Blink introduced a cable management solution for new and existing EV charger locations.BLNK reached a new all-time high Thursday, breaking $19 for the first time. A $500 position in BLNK around mid-March would equate to roughly 312 shares at $1.60. At today's price that position is worth over $5,720 or an over 1,000% gain.Ayro Inc. (NASDAQ: AYRO)Ayro Inc. initially focused on manufacturing short-haul electric vehicles, such as things that drive around college campuses and office complexes. But the company's recent deal with Karma Automotive forms a partnership that includes a plan to produce more than 20,000 light-duty trucks over the next three years. It's also reportedly worth as much as $300 million. While AYRO is still one of the lower-priced EV stocks, shares have been equally explosive. Prior to its merger with DropCar, shares were trading around $0.40 in mid-March. A $500 position was equal to roughly 1,250 shares of DCAR - now AYRO. At this week's current levels above $6, that position is worth right around $7,700.Green Power Motors (NASDAQ: GP)Green Power was originally listed on the TSX Venture market and traded in the U.S. on the OTCQX Market under the symbol GPVRF. After filing for a $35 million IPO on the Nasdaq, Green Power began trading under GP, the symbol it's known for today. The company manufactures electric buses, cargo delivery vehicles, shuttles, and transit vehicles. Green Power recently closed a deal for six electric school buses that were sold to Thermalito Union Elementary School District through Greenpower's national distributor, Creative Bus Sales.While GP reached of $23.45 earlier this year, the former penny stock currently trades around $19. Back in mid-March when Green Power was still on the OTCQX, the penny stock was worth around $1.05 meaning a $500 position was equal to about 476 shares. As of recent levels of $19, that position is now 1,700% higher valued at around $9,000.Workhorse Group (NASDAQ: WKHS)Who could forget Workhorse Group? It was one of the electric vehicle penny stocks originally brought to life by a Trump Tweet last summer. The company specializes in medium-duty trucks with powertrain components under the Workhorse chassis brand. Most recently, WKHS caught some momentum after receiving a purchase order for 500 all-electric C-1000 delivery vehicles from Pritchard Companies. Some of the momentum had been stifled following news that Ford Motor Company (NYSE: F) would be rolling out its own electric cargo vehicle.Needless to say, it hasn't been a bad year for the former penny stock. In mid-March, shares were trading around $1.50. At its peak, WKHS reached highs of $30.99. Currently, the EV stock sits around $22.78 a share. That means a $500 position in March (roughly 333 shares) is now worth over $7,580 or an over 1,400% gain.Nio Inc. (NYSE: NIO)Nio isn't the new kid on the block anymore. Last year NIO became a penny stock, at one point trading as low as $1.19. Though it didn't experience a massive sell-off like most of the market did in the first quarter, shares of NIO stock were hovering around $2.30 in mid-March. But in light of the company's recent earnings beat, NIO is at $48, knocking on the door of all-time highs. A $500 position in Mid-March would equate to about 217 shares of NIO. Today that would be worth $10,500, equating to a gain of over 2,000%. Neither the author of this post nor Pennystocks.com have a position or financial relationship with any of the stocks mentioned above. See more from Benzinga * Click here for options trades from Benzinga * Cannabis Stock Gainers And Losers From November 19, 2020 * Bitcoin, Ethereum & Chainlink - American Wrap: 11/19/2020(C) 2020 Benzinga.com. Benzinga does not provide investment advice. All rights reserved.

Go here to see the original:
CRISPR Therapeutics to Participate in the Jefferies Virtual London Healthcare Conference - Yahoo Finance

Agriculture is one of the most inefficient industries on the planet. Current industrial farming methods demand unsustainable amounts of water, fertilizer, and land. This demand will only intensify as our global population climbs towards 10 billion by 2050. To sustainably feed our world, we need a second agricultural revolution.

Its no surprise to find synthetic biology leading this revolution. To disrupt and transform old industries, we need to work with nature, not against it. Thats the philosophy behindInari, one of the newest companies reimagining the agricultural space. Inari is leveraging the gene-editing technology CRISPR to build the worlds first Seed Foundry. We spoke with Ponsi Trivisvavet, CEO and director of Inari, about the companys process and vision for the future of agriculture.

The genomic diversity of plants is central to Inaris mission. In order to produce crops optimized for a wide range of climates, altitudes, and soils, the company needs a catalog with as many options as possible. We use diverse tools that are true to nature in order to bring biodiversity back into crops, and this allows crops to actually have better productivity, says Trivisvavet. Certain crop phenotypes require less water or utilize fertilizer more efficiently. Reintroducing these crop varieties back into the field can reduce cost burdens on farmers and dramatically improve soil health.

Read the original post

Excerpt from:
Viewpoint: Farming one of the 'most inefficient industries.' The CRISPR revolution could change that - Genetic Literacy Project

For more than two decades, I have been working to improve several staple food crops in Africa, including bananas, plantains, cassavas and yams. As principal scientist and a plant biotechnologist at the International Institute for Tropical Agriculture in Nairobi, I aim to develop varieties that are resistant to pests and diseases such as bacterial wilt, Fusarium wilt (caused by the fungusF. oxysporum) and banana streak virus.

[Editors note: Abdullahi Tsanni is a freelance science journalist based in Abuja, Nigeria.]

In 2011, my team and I created a set of tools, the only one of its kind in Africa, for changing DNA sequences so that we could develop genetically modified and genome-edited products in sub-Saharan Africa. In 2018, we pioneered the first application of CRISPR gene-editing technology to deactivate banana streak virus in plantains. This technology overcame a major hurdle in banana breeding on the continent, and is the first reported successful use of genome editing to improve bananas.

Kenya imposed a partial lockdown on 7 April, but I was allowed to continue some crucial laboratory work, and our research is not affected. Since mid-May, my team has been working in shifts. These plants are like our babies in the lab I cant leave them.

I am excited to see the resultant performance of the bananas in our greenhouse. By next year, we should have some plants ready for trials in the field.

Read the original post

More here:
CRISPR-edited bananas immune to killer pathogens advance toward commercialization in Africa - Genetic Literacy Project

Recently published a detailed report on the CRISPR Technology Market. This market research report was prepared after considering the COVID-19 impacts and monitoring the market for a minimum of five years. The report provides you with growing market opportunities, revenue drivers, challenges, pricing trends & factors, and future market assessments. Our research team has implemented a robust research methodology that includes SWOT analysis, Porters 5 Force analysis, and real-time analysis. Furthermore, they have conducted interviews with the industry experts to offer a report that helps the clients to formulate strategies accordingly.

TheGlobal CRISPR Technology Markethas outlined the supply and demand scenario in the industry and provided a detailed analysis of the product developments, technology advancements, and competitive analysis in the market. It offers an in-depth analysis and all the information required by the new entrants and emerging players to stay ahead in the competition. This report includes information on the latest government policies, norms, and regulations that have and can affect the dynamics of the market.

The historical and forecast information provided in the report span between 2019 and 2026. The report provides detailed volume analysis and region-wise market size analysis of the market.

Get A Sample Copy Of The Report Including An Analysis Of COVID-19 Impact: https://www.researchmoz.us/enquiry.php?type=S&repid=2673637A dedicated section for the prominent companies in the market which provides information on their revenue drivers, product innovation, and challenges they are facing during in the industry. This company profiling section includes industry players mergers, acquisitions, and collaborations which have helped them to leverage or impacted their market position. Besides this, the report is fragmented on the basis of the products, applications, and region-based analysis which imparts a holistic view and scope of the market.

The market research report also offers information on potential investment opportunities, strategic growth market analysis, and probable threats that will adhere to the client to systematically and creatively plan out the business models and strategies. The critical data analysis in the CRISPR Technology market report is laid out in an upright way. This means that the information is represented in form of info graphics, statistics, and uncomplicated graphs to make it an effortless and time-saving task for the client.

Major Companies in the Market: Thermo Fisher Scientific, Merck KGaA, GenScript, Integrated DNA Technologies (IDT), Horizon Discovery Group, Agilent Technologies, Cellecta, GeneCopoeia, New England Biolabs, Origene Technologies, Synthego Corporation, Toolgen, etc.

Global CRISPR Technology Market Segmentation

The CRISPR Technology market report is fragmented into product types, applications, and regional analysis. In this report, the product flow, distribution, and possible future innovations are bestowed in a detailed manner. It also provides accurate calculations for product sales in terms of volume and value. The applications of the products are discussed in a coherent way which includes potential future applications.

The CRISPR Technology market is classified into:

The Study is segmented by following Product Type:

Major applications/end-users industry are as follows:

Geographical Analysis:

We also offers customization of the report. This means that the report can be tailored considering a particular product, application, and region, suiting the clients needs. Moreover, additional company profiles can be added if asked.

Request A Discount On The Report: https://www.researchmoz.us/enquiry.php?type=D&repid=2673637

The Global CRISPR Technology Market report has gone through primary and secondary market research to provide a complete overview of the market. Our dedicated research analyst team has gathered information from the company and official government websites while interviewed directors and VPs of the company to prepare the market report effectively. This enables the client to get a thorough understanding of the market which is supported by the most accurate facts and figures.

The report provides entry-level and top-winning strategies which can assist the industry players to gain high ROI. Moreover, you can call our research analysts (24/7) to clear the clients doubts even after the report is bought by you. We also provides quarterly/yearly report updates to the clients inbox which helps them to stay relevant to the innovative trends in the market.

Impact of Covid-19 in CRISPR Technology Market:The utility-owned segment is mainly being driven by increasing financial incentives and regulatory supports from the governments globally. The current utility-owned CRISPR Technology Market are affected primarily by the COVID-19 pandemic. Most of the projects in China, the US, Germany, and South Korea are delayed, and the companies are facing short-term operational issues due to supply chain constraints and lack of site access due to the COVID-19 outbreak. Asia-Pacific is anticipated to get highly affected by the spread of the COVID-19 due to the effect of the pandemic in China, Japan, and India.

Key Highlights of the Table of Contents:

Get on the Call with Our Research Analyst If You Have Any Particular Doubts before Buying the Report @https://www.researchmoz.us/enquiry.php?type=E&repid=2673637

Some of the key questions answered in this report:

For More Information Kindly Contact:Contact:ResearchMozMr. Rohit Bhisey,Tel: +1-518-621-2074USA-Canada Toll Free: 866-997-4948Email: [emailprotected]Media Release:https://www.researchmoz.us/pressreleaseBrowse More Reports Visit @http://marketresearchlatestreports.blogspot.com/

Thanks for reading this article you can also get individual chapter wise section or region wise report version like North America, Europe, MEA or Asia Pacific.

Read the original here:
CRISPR Technology Market Forecast To 2026 And COVID-19 Impact Analysis - The Think Curiouser

UF engineers reach semi-finals in XPRIZE Contest for new COVID-19 test methods; their CRISPR-ENHANCE methodology published in Nature Communications journal

XPRIZE Rapid COVID Testing competition teams are located around the globe.

According to a survey conducted in July 2020 (pdf) by researchers from Northeastern, Harvard, Rutgers, and Northwestern universities, testing (and especially testing asymptomatic individuals) is a cornerstone of containing the spread of COVID-19. The speed in producing reliable results is of the essence in controlling the spread of the virus.

Piyush Jain, Ph.D., Assistant Professor in the Department of Chemical Engineering at UF Herbert Wertheim College of Engineering, has been improving existing methods for testing COVID-19 samples from nasal swabs and saliva since the deployment of the original qPCR-based test in February 2020. His research has gained recognition by XPRIZE Foundation, Inc., a non-profit corporation fostering and sponsoring competitions to create innovative breakthroughs for the benefit of humanity.

Dr. Jain and his colleagues were selected from more than 700 teams around the globe as one of the 219 semi-finalists from 35 countries in the XPRIZE Rapid COVID Testing competition. The goal of XPRIZE Rapid COVID Testing is to develop innovative, scalable COVID-19 testing solutions that will radically change the world by providing much needed insights to help society safely reopen and not in some distant future, but right now.

Jain and his doctoral student Long Nguyen have developed an enhanced CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated proteins) system that amplifies the detection of the SARS-CoV-2 virus during the test process. This unique system, CRISPR-ENHANCE, shortens the time it takes to run the test by half and provides increased sensitivity for the results.

The gold-standard CDC-recommended qPCR-based tests currently in use are a fluorescence-based assay that requires an expensive thermocycler that cycles between temperatures and measures fluorescence using a camera. In contrast, Jain and Nguyen have been working on a lab-based fluorescence assay as well as a paper strip-based assay that can potentially be used for home-based tests that can significantly reduce cost and time.

A version of our lab-based test in development uses only common lab equipment including a heater, vortex mixer, micro-centrifuge, pipettes, and a fluorescence plate reader, Jain said.

This high-throughput lab-based test using an automated liquid handler robot is designed to analyze about 190 samples at once in just over two hours. The Jain lab is automating the entire workflow to reduce time for sample processing. With automation, pooling of samples and multiple cycles of tests in parallel, a small diagnostic lab can analyze thousands of samples daily.

If used for a single sample analysis, Jains entire lab-based assay can be performed in about 45-60 minutes, with the results being read in the last 5-10 minutes. In contrast, the current CDC-recommended qPCR-based tests take a total of 110-120 minutes, with the result-reading portion requiring approximately 80 minutes on the expensive thermocycler. This occupancy time becomes crucial when it comes to testing thousands of samples.

The CRISPR-ENHANCE method is also much more rapid and sensitive than two other CRISPR methods now on the market as it uses an engineered version of CRISPR that enhances the speed of CRISPR, shortening the time to receiving results by 3.2-fold. Also, if the CRISPR-ENHANCE assay runs longer, it enhances the sensitivity by several fold. The increase in cost of reagents using CRISPR-ENHANCE vs. conventional CRISPR is within $0.01 per sample, according to Jain.

Regarding the SARS-CoV-2 RNA extraction procedure, which has to occur before the reading phase, Jain said, The CDC recommended RNA extraction/purification steps take 30-40 minutes of laborious work and use an expensive kit with supply chain issues. However, our CRISPR-ENHANCE test can potentially work with a heat-based method that employs a simple 10- to 17-minute heating step without the need for further manipulations. The cost of the extraction reagents is 80-times lower than the current CDC-approved method, with the added benefit of helping to minimize supply chain issues. We are using this approach in the XPRIZE competition.

Jains CRISPR-ENHANCE team has tested 157 blind samples supplied by the XPRIZE Foundation and has sent those results to the judges, who will score them for specificity, sensitivity and limits of detection. From these scores, the XPRIZE Foundation will announce 20 teams on December 8, 2020, as finalists who will then have the opportunity to gain clinical validation from two world-class laboratories based in the United States, helping to accelerate the FDA approval process for their tests.

XPRIZE Competition Timeline

The five top testing protocols selected by the judges will be documented in a playbook for global dissemination in order to aid testing sites around the world in a broad effort to end the pandemic.

Proposed paper-strip COVID-19 Test

Nature Communications, doi:10.1038/s41467-020-18615-1, has recently published a paper by Jain, Nguyen and recent graduate Brianna Smith (B.S., MAE 19) on the results of their research. The paper features the development of the CRISPR-ENHANCE technology and its use in COVID-19 detection, using both the lab-based fluorescence assay and the paper strip-based assay. This paper focuses on the use of synthetic genomic RNA in the testing samples.

Jain and Nguyen hope to have their validation data on human samples completed soon and are preparing a filing with the Food and Drug Administration (FDA) to have their method approved for Emergency Use Authorization (EUA).

Following FDA approval of the enhanced fluorescence-based lab assay, Jain and Nguyen hope that, by fine-tuning their paper-strip-based assay and combining it with cell phone camera, it could potentially result in a point-of-contact and home-based tests.

Read more here:
Faster, Cheaper, Easier COVID-19 Testing - Powering the New Engineer - University of Florida

Michael Heltzen, CEO and co-founder of Cardea Bio, a San Diego startup integrating tiny bits of biology into modern electronics, believes that the way researchers have been observing biological signals is about to change.

Our ability to see detail in space and time is limited by resolution. Take, for example, the noisiness of a persons image on a digital video camera. At a low signal-to-noise ratio, an image is indecipherable, but with increasing sensor quality the image becomes progressively recognizable as a face and then a specific individual. If we only have one frame to look at, the image will be static, but with consecutive images appearing on a display we can see the person blink or make a change in facial expression.

This rings as true for human sight as does for any analytical measurement, especially in the life sciences. For example, when we want to examine a 3D genome, we amplify the genome to have enough of it to get a reflection out of it by illuminating it with a laser. But this genome is not in its dynamic, natural stateit is fragmented and static. This genome has typically been run through a molecular meat grinder, ripped up into small fragments, boiled to make it fall apart, and amplified with artificial nucleotides. Its almost like using a hammer to probe a computer and smashing it up to study the pieces.

But creating these genomic snapshots does little to provide richer information of real-time biological interactions. Using optics to observe live biological signals means that we only have one narrow perspective on a whole orchestra of different biological signals, says Heltzen. We can listen into one vertical, either genomics or proteomics, and it will often limit the signals that we get instead of being able to interact with them.

A new gate to natures signals

In Roman mythology, Cardea was the goddess of door hinges and handles who prevented evil spirits from crossing thresholds. So, it is not surprising that at the core of Cardea Bios technology is their graphene-based, biology-gated transistorscalled Cardean Transistors. These transistors leverage graphene, a nanomaterial that, in contrast to the common semiconductor material silicon, is biocompatible and a near perfect conductor due to only being one atom thick. Graphenes conductive qualities can therefore provide interactive live-streams of biological signal analysis, replacing optical static observations.

Its a different way of thinking about life science research because were basically saying that all signals of biology are binding interactions, says Heltzen. Thats how information is transferred from one molecule to another. When we take transistors and make one site of that binding interaction as the gate, if the binding interaction is there, there will be a change of the gate. This basically flips life science thinking upside down because theres no optics. Theres no analyte type of conversation. Theres no laser. Theres no heat. Theres no data sets to be converted from optical signals.

Since Cardea Bios system is based on binding interactions, it can probe any combination of biologically based binding interactions.

For example, if you want to probe for a protein biomarker, you would exploit the unique capturing mechanism between an antibody to an antigen. In this scenario, the antibody would be linked to the gate in the biological transistorif the antigen and antibody bind, the gate closes, and, if not, the gate remains open. This ability yields a computer chip that, when introduced to a sample containing the biomarker, will change gate states the same way that the transistors in computers change gates for ones and zeros. On top of that, you now have a live signal for that one biomarker.

The Cardean Transistor technology opens up the potential for new insights into biomarkers and molecular signals, says Tad Weems, managing director, Early Stage Partnerships at Agilent Technologies. The technology reads dynamic molecular signals as a function of time which means researchers will be able to interact directly with biology and observe changes in the biomarker signals. Additionally, the technology has multi-omic applications in that it will allow researchers to observe DNA, RNA, and protein biomarkers simultaneously. We believe there is not only a large market potential for these multi-omic devices, but the technology also has the potential to change patient lives.

Heltzen believes this will be the start of a paradigm-shift in many areas of life science and biotech, due to the multi-omics data streaming of DNA, RNA, and protein signals from biology fed to computers in near real time. We were very adamant about the need of a multi-omics system where the analytes on their own can keep doing what they do because otherwise this integration up against computers is not going to work, says Heltzen. If weve destroyed the signal in the process of detecting it, it doesnt make sense. With this, we are getting to the next generation of systems biology.

A digital CRISPR world

Cardea launched its breakthrough chipset called CRISPR-Chip built with its proprietary transistors. The chipset uses CRISPR as the transistor gate, and thereby harvests CRISPRs powerful natural ability to search through genomes for genetic sequences of interest, enabling the user to observe the CRISPR search activity and results in real-time on a computer screen. CRISPR has this feature of being able to run through a genome in record speeds and find specific areas, says Heltzen. So, we have made CRISPR the gate, and when it finds its targetfor example, a gene with a certain mutationit changes the gate signal.

In addition, Cardea Bio is working with partners to create a new generation of applications. Recently, it announced the global launch of a CRISPR quality control toolits first proprietary Powered by Cardea product in partnership. This idea was born out of CRISPR researchers wanting to take a guide RNA and, live on the screen, measure the kinetic strength of the guide RNAs binding to the Cas protein. The result was CRISPR-BIND, the first of a series of quality control applications that will come out of a partnership with CRISPR QC. This tool is a fast and sensitive high-throughput liquid handler that performs quality control of CRISPR-Cas complexes and gRNA. It can also be used to optimize CRISPR designs and identify the most optimal conditions for each CRISPR experiment.

Transistor diagnostics for pandemics and COVID-19

With pandemics like COVID-19, the diagnostic bottlenecks are PCR and DNA amplification. The world right now is basically doing a PCR test that is a reverse-transcription of the RNA into DNA that is just a super artificial step that then goes through the whole amplification phase, Heltzen says. He believes PCR doesnt reveal anything about virus load, virus versions, or even if the virus is alive or deadthe readout is simply that those nucleotides were in the sample.

When it comes to COVID-19, Cardea Bio takes multi-omics approach. So, you have this RNA virus itself that comes and looks at an ACE2 receptor that is an entrance into a cell, says Heltzen. We can test for the virus RNA. We can test for the use of the ACE2 receptor by using it as a gate to say that the virus is basically here now. We can look at the spike proteins or even the different sub domains of the spike protein.

To leverage their unique technology, Heltzen says Cardea Bio is creating a future pandemic solution based on handheld devices that can provide deeper insight into not just whether a person has the virus, but how their immune system is reacting to it. He believes that getting these answers, in real time, at scale will save lives. We know how to use the semiconductor industry infrastructure to make tests, and theres no other industry that knows how to make billions of units at the same time, says Heltzen. That is really the numbers we needtens of millionsand over time billions.

A plug and play toolbox to query life

Although the long-term goal for Cardea Bio is medical impact, it has applied its technology first in agriculture.

Were not going to mess around with things as important as human life until we have all technical bugs out of the platform, says Heltzen.

The medical impact Heltzen sees is a future where doctors query all the biological systems of a patient during an office visit. We already have the best security systems and surveillance systemsits called the immune system, he says.

The cells are communicating to each other, systems are communicating to each other, but the doctor standing there doesnt have a way of listening to that, Heltzen continues. We need the doctors to have live streams coming from the patients, and we already have the wildest technology stack, the patient himself, sitting there, ready to give the signals.

Heltzen says that Cardea Bios long game is to build chipsets that query all the relevant biological channels, no matter what the binding interaction is. He calls them chipsets because he envisions eventually providing ready-made modules with digitized biology at its core and infrastructure built around it.

Think of it like Legos (sic), where you can get a catalog of all the different LEGO blocks and you can be the creator, says Heltzen. We want to open up a developer community of people that understand the diseases, the opportunities, the problems, much better than us because were not going to tell people what to build.

Heltzen believes that such a community will take all the components that have been developed by biology over the past few billion years and start using them as a technology to release a new generation of natural resources on this planet.

Visit link:
Seeing Real-Time Biological Interactions with Graphene Transistors - Clinical OMICs News

The research study of the global Crispr Technology market provides the market size information and market trends along with the factors and parameters impacting it in both the short and long term. The report ensures a 360-degree assessment, bringing out the complete key insights of the industry. These insights help the business decision-makers to make better business plans and informed decisions for the future business. In addition, the study helps the venture capitalist in understanding the companies better and take informed decisions.

The Crispr Technology market research report provides essential statistics on the market position of the Crispr Technology manufacturers and is a valuable source of guidance and direction for companies and individuals interested in the industry. The report provides a basic summary of theCrispr Technology industry including its definition, applications and manufacturing technology. The report presents the company profile, product specifications, capacity, production value, and market shares for key vendors.

The overall market is split by the company, by country, and by application/type for the competitive landscape analysis. The report estimates market development trends of Crispr Technology industry. Analysis of upstream raw materials, downstream demand and current market dynamics is also carried out. The Crispr Technology market report makes some important proposals for a new project of Crispr Technology Industry before evaluating its feasibility.

Request for a sample copy of the report to get extensive insights into Crispr Technology market @https://www.in4research.com/sample-request/2000

Key segments covered in Crispr Technology market report: Major key companies, product type segment, end use/application segment and geography segment.

The information for each competitor includes:

Company segment, the report includes global key players of Crispr Technology as well as some small players:

For product type segment, this report listed the main product type of Crispr Technology market

For end use/application segment, this report focuses on the status and outlook for key applications. End users are also listed.

Any Questions/Queries or need help? Speak with our analyst:https://www.in4research.com/speak-to-analyst/2000

This report covers the following regions:

Key Questions Answered in the Report:

We also can offer a customized report to fulfill the special requirements of our clients. Regional and Countries report can be provided as well.

Ask for more details or request custom reports from our industry experts @https://www.in4research.com/customization/2000

Read the original here:
Crispr Technology Market to 2026: Report on Top Company Players, Industry Insights and Overview - PRnews Leader

The Clinical Grade Viral Vector & Plasmid DNA Manufacturing Market research report recently presentedby Prophecy Market Insights which provides reliable and sincere insights related to the various segments and sub-segments of the market. The market study throws light on the various factors that are projected to impact the overall dynamics of the Clinical Grade Viral Vector & Plasmid DNA Manufacturing market over the forecast period (2019-2029).

Influences of the market report:

An executive summary provides the markets definition, application, overview, classifications, product specifications, manufacturing processes; raw materials, and cost structures.

Market Dynamics offers drivers, restraints, challenges, trends, and opportunities of the Clinical Grade Viral Vector & Plasmid DNA Manufacturing market

Segment Level Analysis in terms of types, product, geography, demography, etc. along with market size forecast

Get Free Sample Copy of This Report @ https://www.prophecymarketinsights.com/market_insight/Insight/request-sample/2821

Regional and Country- level Analysis different geographical areas are studied deeply and an economical scenario has been offered to support new entrants, leading market players, and investors to regulate emerging economies. The top producers and consumers focus on production, product capacity, value, consumption, growth opportunity, and market share in these key regions, covering

Australia, New Zealand, Rest of Asia-Pacific

Stakeholders Benefit:

Segmentation Overview:

The Clinical Grade Viral Vector & Plasmid DNA Manufacturing research study comprises 100+ market data Tables, Graphs & Figures, Pie Chat to understand detailed analysis of the market. The predictions estimated in the market report have been resulted in using proven research techniques, methodologies, and assumptions. This Clinical Grade Viral Vector & Plasmid DNA Manufacturing market report states the market overview, historical data along with size, growth, share, demand, and revenue of the global industry.

Download PDF Brochure for report overview @ https://www.prophecymarketinsights.com/market_insight/Insight/request-pdf/2821

Competitive landscape Analysis provides mergers and acquisitions, collaborations along with new product launches, heat map analysis, and market presence and specificity analysis.

Highlights of the Report

Complete access to COVID-19 Impact on the Clinical Grade Viral Vector & Plasmid DNA Manufacturing market dynamics, key regions, market size, growth rate and forecast to 2029

The report on the Clinical Grade Viral Vector & Plasmid DNA Manufacturing market includes an assessment of the market, trends, segments, and regional markets. Overview and dynamics have been included in the report.

Some important Questions Answered in Clinical Grade Viral Vector & Plasmid DNA Manufacturing Market Report are:

Clinical Grade Viral Vector & Plasmid DNA ManufacturingMarket by Top Manufacturers:

Get Sample Copy of This Report @ https://www.prophecymarketinsights.com/market_insight/Insight/request-sample/2821

About us:

Prophecy Market Insights is specialized market research, analytics, marketing/business strategy, and solutions that offers strategic and tactical support to clients for making well-informed business decisions and to identify and achieve high-value opportunities in the target business area. We also help our clients to address business challenges and provide the best possible solutions to overcome them and transform their business.

Contact Us:

Mr. Alex (Sales Manager)

Prophecy Market Insights

Phone: +1 860 531 2701

Email: [emailprotected]

Read the original:
Application and Product Portfolio Analysis During the forecasted period of CRISPR Technology Market - PRnews Leader

CRISPR Genome Editing Market report examines Product Specification, Major Segments in Focus, Geographic Focus, Production Capacity, Production, Sales Performance of key players in market which gives you deep understanding of competitive scenario of CRISPR Genome Editing market. CRISPR Genome Editing industry research report enables reader to dive into consumers mind.

Download Free Sample PDF of CRISPR Genome Editing [emailprotected] https://www.researchmoz.us/enquiry.php?type=S&repid=2602918

CRISPR Genome Editing market competition by top manufacturers, with production, price, and revenue (value) and market share for each manufacturer; the top players including:

Editas MedicineCRISPR TherapeuticsHorizon DiscoverySigma-AldrichGenscriptSangamo BiosciencesLonza GroupIntegrated DNA TechnologiesNew England BiolabsOrigene TechnologiesTransposagen BiopharmaceuticalsThermo Fisher ScientificCaribou Biosciences

Goal Audience of CRISPR Genome Editing Market 2019 Forecast to 2026 Market:

Raw material suppliers->>Distributors/traders/wholesalers/suppliers->>Regulatory bodies, including government agencies and NGO->>Commercial research & development (R&D) institutions->>Importers and exporters->>Government organizations, research organizations, and consulting firms->>Trade associations and CRISPR Genome Editing industry bodies->>End-use industries

Place an Enquiry to Our Industry Expert at @https://www.researchmoz.us/enquiry.php?type=E&repid=2602918

(*Fill the form and our sales representative will get back to you for assistance)

Based onProduct Type, CRISPR Genome Editing market report displays the manufacture, profits, value, and market segment and growth rate of each type, covers:

Genetic EngineeringGene LibraryHuman Stem Cells

Based onend users/applications, CRISPR Genome Editing market report focuses on the status and outlook for major applications/end users, sales volume, market share and growth rate for each application, this can be divided into:

Biotechnology CompaniesPharmaceutical Companies

CRISPR Genome Editing Market 2019 forecast to 2026 Market Segment by Regions, regional analysis covers

Enquiry for Discount Visit @https://www.researchmoz.us/enquiry.php?type=D&repid=2602918

Some of the important topics in CRISPR Genome Editing Market Research Report:

For More Information Kindly Contact:ResearchMozMr. Rohit Bhisey,90 State Street,Albany NY,United States 12207Tel: +1-518-621-2074USA-Canada Toll Free: 866-997-4948Email:[emailprotected]Follow us on LinkedIn @http://bit.ly/1TBmnVGMedia Release:https://www.researchmoz.us/pressreleaseFollow me on :https://nextgenmarketresearch.blogspot.com/

Read more from the original source:
CRISPR Genome Editing Market Research Report- Opportunities & Challenges With Totally Different Segments, Forecast- 2026 - The Think Curiouser

The latest CRISPR Technologymarket report estimates the opportunities and current market scenario, providing insights and updates about the corresponding segments involved in the global CRISPR Technologymarket for the forecast period of 2020-2026. The report provides detailed assessment of key market dynamics and comprehensive information about the structure of the CRISPR Technologyindustry. This market study contains exclusive insights into how the global CRISPR Technologymarket is predicted to grow during the forecast period.

The primary objective of the CRISPR Technology market report is to provide insights regarding opportunities in the market that are supporting the transformation of global businesses associated with CRISPR Technology. This report also provides an estimation of the CRISPR Technologymarket size and corresponding revenue forecasts carried out in terms of US$. It also offers actionable insights based on the future trends in the CRISPR Technologymarket. Furthermore, new and emerging players in the global CRISPR Technologymarket can make use of the information presented in the study for effective business decisions, which will provide momentum to their businesses as well as the global CRISPR Technologymarket.

Get Exclusive Sample copy on CRISPR Technology Market is available at https://inforgrowth.com/sample-request/4361707/crispr-technology-market

The study is relevant for manufacturers, suppliers, distributors, and investors in the CRISPR Technologymarket. All stakeholders in the CRISPR Technologymarket, as well as industry experts, researchers, journalists, and business researchers can influence the information and data represented in the report.

CRISPR Technology Market 2020-2026: Segmentation

The CRISPR Technology market report covers major market players like 1. Thermo Fisher Scientific 2. Merck KGaA 3. GenScript 4. Integrated DNA Technologies (IDT) 5. Horizon Discovery Group 6. Agilent Technologies 7. CellectaInc. 8. GeneCopoeiaInc. 9. New England Biolabs 10. Origene TechnologiesInc. 11. Synthego Corporation 12. ToolgenInc.

CRISPR Technology Market is segmented as below:

By Product Type: By Product & Service: 1. CRISPR Products 1.1. CRISPR Enzymes1.2. CRISPR Libraries 1.3. CRISPR Kits 1.4. Other CRISPR Products 2. CRISPR Services 2.1. gRNA Design & Vector Construction2.2. Cell Line Engineering 2.3. Screening Services 2.4. Other CRISPR Services

Breakup by Application:Application: 1. Biomedical 2. Agricultural 3. Industrial 4. Biological Research End-use: 1. Pharmaceutical and Biopharmaceutical Companies 2. Biotechnology Companies 3. Academic & Research Institutes 4. Contract Research Organizations

Get up to 30% instant discount Under Our HALLOWEEN Discount OFFER;https://inforgrowth.com/discount/4361707/crispr-technology-market

Impact of COVID-19:CRISPR TechnologyMarket report analyses the impact of Coronavirus (COVID-19) on the CRISPR Technologyindustry.Since the COVID-19 virus outbreak in December 2019, the disease has spread to almost 180+ countries around the globe with the World Health Organization declaring it a public health emergency. The global impacts of the coronavirus disease 2019 (COVID-19) are already starting to be felt, and will significantly affect the CRISPR Technologymarket in 2020.

The outbreak of COVID-19 has brought effects on many aspects, like flight cancellations; travel bans and quarantines; restaurants closed; all indoor events restricted; emergency declared in many countries; massive slowing of the supply chain; stock market unpredictability; falling business assurance, growing panic among the population, and uncertainty about future.

COVID-19 can affect the global economy in 3 main ways: by directly affecting production and demand, by creating supply chain and market disturbance, and by its financial impact on firms and financial markets.

Get the Sample ToC and understand the COVID19 impact and be smart in redefining business strategies. https://inforgrowth.com/CovidImpact-Request/4361707/crispr-technology-market

Global CRISPR Technology Market Report Answers Below Queries:

To know about the global trends impacting the future of market research, contact at: https://inforgrowth.com/enquiry/4361707/crispr-technology-market

Key Questions Answered in this Report:

What is the market size of the CRISPR Technology industry?This report covers the historical market size of the industry (2013-2019), and forecasts for 2020 and the next 5 years. Market size includes the total revenues of companies.

What is the outlook for the CRISPR Technology industry?This report has over a dozen market forecasts (2020 and the next 5 years) on the industry, including total sales, a number of companies, attractive investment opportunities, operating expenses, and others.

What industry analysis/data exists for the CRISPR Technology industry?This report covers key segments and sub-segments, key drivers, restraints, opportunities and challenges in the market and how they are expected to impact the CRISPR Technology industry. Take a look at the table of contents below to see the scope of analysis and data on the industry.

How many companies are in the CRISPR Technology industry?This report analyzes the historical and forecasted number of companies, locations in the industry, and breaks them down by company size over time. The report also provides company rank against its competitors with respect to revenue, profit comparison, operational efficiency, cost competitiveness, and market capitalization.

What are the financial metrics for the industry?This report covers many financial metrics for the industry including profitability, Market value- chain and key trends impacting every node with reference to companys growth, revenue, return on sales, etc.

What are the most important benchmarks for the CRISPR Technology industry?Some of the most important benchmarks for the industry include sales growth, productivity (revenue), operating expense breakdown, the span of control, organizational make-up. All of which youll find in this market report.

FOR ALL YOUR RESEARCH NEEDS, REACH OUT TO US AT:Address: 6400 Village Pkwy suite # 104, Dublin, CA 94568, USAContact Name: Rohan S.Email:[emailprotected]Phone: US: +1-909-329-2808UK: +44 (203) 743 1898

Read the original here:
Latest News 2020: CRISPR Technology Market by Coronavirus-COVID19 Impact Analysis With Top Manufacturers Analysis | Top Players: Thermo Fisher...

Scope of the Report:

CRISPR And CRISPR-Associated (Cas) Genes industry is relatively concentrated, manufacturers are mostly in the Europe and North America. Among them, North America region accounted for more than 45.70% of the total market of global CRISPR And CRISPR-Associated (Cas) Genes.Although this market has great potential for future development, we do not recommend entering the market for investors who do not have strong capital or do not have key technology.

The worldwide market for CRISPR And CRISPR-Associated (Cas) Genes is expected to grow at a CAGR of roughly 39.8% over the next five years, will reach 2640 million US$ in 2024, from 350 million US$ in 2019, according to a new Globalmarketers.biz Research study.

This report focuses on the CRISPR And CRISPR-Associated (Cas) Genes in global market, especially in North America, Europe and Asia-Pacific, South America, Middle East and Africa. This report categorizes the market based on manufacturers, regions, type and application.

To Understand How Covid-19 Impact on this industry. Get Free Sample Report:

https://www.globalmarketers.biz/report/life-sciences/global-crispr-and-crispr-associated-(cas)-genes-market-2019-by-manufacturers,-regions,-type-and-application,-forecast-to-2024/131472#request_sample

Global CRISPR And CRISPR-Associated (Cas) Genes report portrays the fundamental details of the dominant market players elaborating their business profiles, CRISPR And CRISPR-Associated (Cas) Genes market revenue, sales volume, press releases, technical developments taking place in this industry.

Report is segmented into different parts as below:

Global CRISPR And CRISPR-Associated (Cas) Genes Market Details Based On Key Players:

Caribou BiosciencesAddgeneCRISPR THERAPEUTICSMerck KGaAMirus Bio LLCEditas MedicineTakara Bio USAThermo Fisher ScientificHorizon Discovery GroupIntellia TherapeuticsGE Healthcare Dharmacon

Global CRISPR And CRISPR-Associated (Cas) Genes Market Details Based on Product Category:

Genome EditingGenetic engineeringgRNA Database/Gene LibrarCRISPR PlasmidHuman Stem CellsGenetically Modified Organisms/CropsCell Line Engineering

Global CRISPR And CRISPR-Associated (Cas) Genes Market Details Based On Key Product Applications:

Biotechnology CompaniesPharmaceutical CompaniesAcademic InstitutesResearch and Development Institutes

Global CRISPR And CRISPR-Associated (Cas) Genes Market Details Based On Regions

Inquire Before Buying Or Ask For Custom Requirement:

https://www.globalmarketers.biz/report/life-sciences/global-crispr-and-crispr-associated-(cas)-genes-market-2019-by-manufacturers,-regions,-type-and-application,-forecast-to-2024/131472#inquiry_before_buying

The first part of the report portrays the information related to the basic CRISPR And CRISPR-Associated (Cas) Genes introduction, key market players, their company profiles, sales ratio, demand and supply volume, CRISPR And CRISPR-Associated (Cas) Genes market gains during 2018 and 2019. The second part of the CRISPR And CRISPR-Associated (Cas) Genes report extracts more details stating the sales revenue of each CRISPR And CRISPR-Associated (Cas) Genes industry player, the business strategies followed by them. The third part of the report displays the competitive scenario of all the CRISPR And CRISPR-Associated (Cas) Genes market players on basis of the revenue gains.

The fourth part of the report enlists the CRISPR And CRISPR-Associated (Cas) Genes details based on key producing regions and CRISPR And CRISPR-Associated (Cas) Genes market gains during the period from 2015 to 2019. Fifth, sixth, seventh, eighth and ninth part of the CRISPR And CRISPR-Associated (Cas) Genes report enlists the major countries within the regions and the CRISPR And CRISPR-Associated (Cas) Genes revenue generated during the period from 2012 to 2017. Tenth and eleventh part of the CRISPR And CRISPR-Associated (Cas) Genes report mentions the variety of CRISPR And CRISPR-Associated (Cas) Genes product applications, CRISPR And CRISPR-Associated (Cas) Genes statistics during 2015 to 2019.

Part number twelve, thirteen, fourteen and fifteen provides information regarding the futuristic CRISPR And CRISPR-Associated (Cas) Genes market trends expected during the forecast period from 2020 to 2024, CRISPR And CRISPR-Associated (Cas) Genes marketing strategies, CRISPR And CRISPR-Associated (Cas) Genes market vendors, facts and figures of the CRISPR And CRISPR-Associated (Cas) Genes market and vital CRISPR And CRISPR-Associated (Cas) Genes business conclusion along with data collection sources and appendix.

What CRISPR And CRISPR-Associated (Cas) Genes Market Report Contributes?

View Full Table Of Content: @

https://www.globalmarketers.biz/report/life-sciences/global-crispr-and-crispr-associated-(cas)-genes-market-2019-by-manufacturers,-regions,-type-and-application,-forecast-to-2024/131472#table_of_contents

Contact Us:

Name: Alex White

Phone: US: +1(806)4400782/ UK: +44 33 3303 4979

Email: [emailprotected]

Read the rest here:
Global CRISPR And CRISPR-Associated (Cas) Genes Market Views: Taking A Nimble Approach To Explores Huge Growth In Near Future With Eminent Players -...

This article was originally published here

Mol Cell. 2020 Oct 26:S1097-2765(20)30693-6. doi: 10.1016/j.molcel.2020.10.010. Online ahead of print.

ABSTRACT

Cancer-associated mutations that stabilize NRF2, an oxidant defense transcription factor, are predicted to promote tumor development. Here, utilizing 3D cancer spheroid models coupled with CRISPR-Cas9 screens, we investigate the molecular pathogenesis mediated by NRF2 hyperactivation. NRF2 hyperactivation was necessary for proliferation and survival in lung tumor spheroids. Antioxidant treatment rescued survival but not proliferation, suggesting the presence of distinct mechanisms. CRISPR screens revealed that spheroids are differentially dependent on the mammalian target of rapamycin (mTOR) for proliferation and the lipid peroxidase GPX4 for protection from ferroptosis of inner, matrix-deprived cells. Ferroptosis inhibitors blocked death from NRF2 downregulation, demonstrating a critical role of NRF2 in protecting matrix-deprived cells from ferroptosis. Interestingly, proteomics analyses show global enrichment of selenoproteins, including GPX4, by NRF2 downregulation, and targeting NRF2 and GPX4 killed spheroids overall. These results illustrate the value of spheroid culture in revealing environmental or spatial differential dependencies on NRF2 and reveal exploitable vulnerabilities of NRF2-hyperactivated tumors.

PMID:33128871 | DOI:10.1016/j.molcel.2020.10.010

See more here:
3D Culture Models with CRISPR Screens Reveal Hyperactive NRF2 as a Prerequisite for Spheroid Formation via Regulation of Proliferation and Ferroptosis...

The study presents an in-depth analysis of the important growth avenues and existing growth dynamics in the estimation year of 2020, and key prospects over the analysis period of 2020 2026.The study on the global CRISPR and Cas Genes Market offers insights and analysis into the potential and current opportunities amongst various end-users. It also provides a detailed picture of the trends of the changing structure in the industry and the difficulties faced by various industry participants. The report elaborates on the challenges of utmost concern so as to prepare the participants and stakeholders and place them in a better position to face the challenges.

Get Sample Copy of this Report https://www.factmr.com/connectus/sample?flag=S&rep_id=4823

Experienced analysts at Fact.MR has put together all the available strategies, methods, and resources pertaining to the CRISPR and Cas Genes market so as to come up with a crisp view. The report also makes a vivid explanation of the existing dynamics of growth in the market over the assessment period, 2020 2026. Global businesses are suffering from uncertainties and turmoil as the coronavirus Covid-19 spreads at an unprecedented rate across the world. The super spread of Covid-19, caused by the Sars-Cov-2 virus, comes with profound implications for the global CRISPR and Cas Genes market and is highly consequential. As such, business leaders, owners, and strategists across the globe are making great efforts to find out how Covid-19 will change the industrial forecasts and estimates. The study also discusses in detail the impact that it will leave on the global economy in the few months to come.

The global CRISPR and Cas Genes market report offers an analysis of the current opportunities in various regions and assesses their shares of revenue. Key regions covered in the report include the following:

With an offering of valuable insight into the profile of each of the major vendors in the market and the technological innovations in the said industry that could emerge as the cornerstone of their futuristic strategies and moves, the report seeks to facilitate better decision making by the companies. Some of the leading players comprise:

In terms of type of product, the global CRISPR and Cas Genes market can be segmented into:

In addition to understanding and discussing the demand patterns of several end users, this report by Fact.MR on the global CRISPR and Cas Genes market also sums up the trends that are expected to attract investments by other various ancillary industries.

A Customization of this Report is Available upon Request https://www.factmr.com/connectus/sample?flag=RM&rep_id=4823

The study offers a clear and accurate analysis of the consumption and demand patterns of several services and products found in the global CRISPR and Cas Genes market. In addition to that, this very assessment by the experts of Fact.MR stresses the potential opportunities, market figures, and the effect of potential opportunities on the market figure of the future.

About Fact.MR

Fact.MR is a fast-growing market research firm that offers the most comprehensive suite of syndicated and customized market research reports. We believe transformative intelligence can educate and inspire businesses to make smarter decisions. We know the limitations of the one-size-fits-all approach; thats why we publish multi-industry global, regional, and country-specific research reports.

Contact:

Unit No: AU-01-H Gold Tower (AU), Plot No: JLT-PH1-I3A,

Jumeirah Lakes Towers, Dubai, United Arab Emirates

MARKET ACCESS DMCC Initiative

Email: sales@factmr.com

Web: https://www.factmr.com/

Read this article:
The Impact of the Coronavirus on the Global CRISPR and Cas Genes Market Fact.MR Study 2020 2026 - The Cloud Tribune

CRISPR And CRISPR-Associated (Cas) Genes Market Scope of the Report:

Factors and CRISPR And CRISPR-Associated (Cas) Genes Market execution are analyzed using quantitative and qualitative approaches to give a consistent picture of current and future trends in the boom. The study also allows for a detailed market analysis focused primarily on geographic locations. The Global CRISPR And CRISPR-Associated (Cas) Genes Market Report offers statistical graphs, estimates, and collateral that explain the state of specific trade within the local and global scenarios.

The worldwide market for CRISPR And CRISPR-Associated (Cas) Genes is expected to grow at a CAGR of roughly xx% over the next five years, will reach xx million US$ in 2025, from xx million US$ in 2018, according to a new study.

This report focuses on the CRISPR And CRISPR-Associated (Cas) Genes in global market, especially in North America, Europe and Asia-Pacific, South America, Middle East and Africa. This report categorizes the market based on manufacturers, regions, type and application.

Get PDF Sample Copy of this Report to understand the structure of the complete report: (Including Full TOC, List of Tables & Figures, Chart) @ https://www.marketresearchhub.com/enquiry.php?type=S&repid=2649968&source=atm

Sales and Pricing AnalysesReaders are provided with deeper sales analysis and pricing analysis for the global CRISPR And CRISPR-Associated (Cas) Genes market. As part of sales analysis, the report offers accurate statistics and figures for sales and revenue by region, by each type segment for the period 2015-2026.In the pricing analysis section of the report, readers are provided with validated statistics and figures for the price by players and price by region for the period 2015-2020 and price by each type segment for the period 2015-2020.Regional and Country-level AnalysisThe report offers an exhaustive geographical analysis of the global CRISPR And CRISPR-Associated (Cas) Genes market, covering important regions, viz, North America, Europe, China and Japan. It also covers key countries (regions), viz, U.S., Canada, Germany, France, U.K., Italy, Russia, China, Japan, South Korea, India, Australia, Taiwan, Indonesia, Thailand, Malaysia, Philippines, Vietnam, Mexico, Brazil, Turkey, Saudi Arabia, UAE, etc.The report includes country-wise and region-wise market size for the period 2015-2026. It also includes market size and forecast by each application segment in terms of sales for the period 2015-2026.Competition AnalysisIn the competitive analysis section of the report, leading as well as prominent players of the global CRISPR And CRISPR-Associated (Cas) Genes market are broadly studied on the basis of key factors. The report offers comprehensive analysis and accurate statistics on sales by the player for the period 2015-2020. It also offers detailed analysis supported by reliable statistics on price and revenue (global level) by player for the period 2015-2020.On the whole, the report proves to be an effective tool that players can use to gain a competitive edge over their competitors and ensure lasting success in the global CRISPR And CRISPR-Associated (Cas) Genes market. All of the findings, data, and information provided in the report are validated and revalidated with the help of trustworthy sources. The analysts who have authored the report took a unique and industry-best research and analysis approach for an in-depth study of the global CRISPR And CRISPR-Associated (Cas) Genes market.The following manufacturers are covered in this report:Caribou BiosciencesAddgeneCRISPR THERAPEUTICSMerck KGaAMirus Bio LLCEditas MedicineTakara Bio USAThermo Fisher ScientificHorizon Discovery GroupIntellia TherapeuticsGE Healthcare DharmaconCRISPR And CRISPR-Associated (Cas) Genes Breakdown Data by TypeGenome EditingGenetic engineeringgRNA Database/Gene LibrarCRISPR PlasmidHuman Stem CellsGenetically Modified Organisms/CropsCell Line EngineeringCRISPR And CRISPR-Associated (Cas) Genes Breakdown Data by ApplicationBiotechnology CompaniesPharmaceutical CompaniesAcademic InstitutesResearch and Development Institutes

Do You Have Any Query Or Specific Requirement? Ask to Our Industry [emailprotected] https://www.marketresearchhub.com/enquiry.php?type=E&repid=2649968&source=atm

Reasons to Purchase this CRISPR And CRISPR-Associated (Cas) Genes Market Report:

* Analyzing the outlook of the market with the recent trends and SWOT analysis

* Market dynamics scenario, along with growth opportunities of the market in the years to come

* Market segmentation analysis including qualitative and quantitative research incorporating the impact of economic and non-economic aspects

* Regional and country level analysis integrating the demand and supply forces that are influencing the growth of the market.

* Market value (USD Million) and volume (Units Million) data for each segment and sub-segment

* Competitive landscape involving the market share of major players, along with the new projects and strategies adopted by players in the past five years

* Comprehensive company profiles covering the product offerings, key financial information, recent developments, SWOT analysis, and strategies employed by the major market players

* 1-year analyst support, along with the data support in excel format.

You can Buy This Report from Here @ https://www.marketresearchhub.com/checkout?rep_id=2649968&licType=S&source=atm

The CRISPR And CRISPR-Associated (Cas) Genes Market report has 150 tables and figures browse the report description and TOC:

Table of Contents

1 Study Coverage

1.1 CRISPR And CRISPR-Associated (Cas) Genes Product

1.2 Key Market Segments in This Study

1.3 Key Manufacturers Covered

1.4 Market by Type

1.4.1 Global CRISPR And CRISPR-Associated (Cas) Genes Market Size Growth Rate by Type

1.5 Market by Application

1.5.1 Global CRISPR And CRISPR-Associated (Cas) Genes Market Size Growth Rate by Application

2 Executive Summary

2.1 Global CRISPR And CRISPR-Associated (Cas) Genes Market Size

2.1.1 Global CRISPR And CRISPR-Associated (Cas) Genes Revenue 2014-2025

2.1.2 Global CRISPR And CRISPR-Associated (Cas) Genes Production 2014-2025

2.2 CRISPR And CRISPR-Associated (Cas) Genes Growth Rate (CAGR) 2019-2025

2.3 Analysis of Competitive Landscape

2.3.1 Manufacturers Market Concentration Ratio (CR5 and HHI)

2.3.2 Key CRISPR And CRISPR-Associated (Cas) Genes Manufacturers

2.3.2.1 CRISPR And CRISPR-Associated (Cas) Genes Manufacturing Base Distribution, Headquarters

2.3.2.2 Manufacturers CRISPR And CRISPR-Associated (Cas) Genes Product Offered

2.3.2.3 Date of Manufacturers Enter into CRISPR And CRISPR-Associated (Cas) Genes Market

2.4 Key Trends for CRISPR And CRISPR-Associated (Cas) Genes Markets & Products

3 Market Size by Manufacturers

3.1 CRISPR And CRISPR-Associated (Cas) Genes Production by Manufacturers

3.1.1 CRISPR And CRISPR-Associated (Cas) Genes Production by Manufacturers

3.1.2 CRISPR And CRISPR-Associated (Cas) Genes Production Market Share by Manufacturers

3.2 CRISPR And CRISPR-Associated (Cas) Genes Revenue by Manufacturers

3.2.1 CRISPR And CRISPR-Associated (Cas) Genes Revenue by Manufacturers (2019-2025)

3.2.2 CRISPR And CRISPR-Associated (Cas) Genes Revenue Share by Manufacturers (2019-2025)

3.3 CRISPR And CRISPR-Associated (Cas) Genes Price by Manufacturers

3.4 Mergers & Acquisitions, Expansion Plans

More Information.

For More Information Kindly Contact:

marketresearchhub

Mr. Rohit Bhisey,

90 State Street,

Albany NY,

United States 12207

Tel: +1-518-621-2074

USA-Canada Toll Free: 866-997-4948

Email: [emailprotected]

Read the original here:
CRISPR And CRISPR-Associated (Cas) Genes Market: Drivers, Restraints, Opportunities, and Threats (20192025) - Eurowire

As we know, COVID-19 is causing large scale loss of life and severe human suffering. With the pandemic spreading across the globe, researchers are racing against the clock to develop diagnostic tools, vaccines and treatments. Recently, WHO has launched a Solidarity clinical trial to assess relative effectiveness of four potential drugs against COVID-19. Further, there are close to 40 clinical trials of vaccines are ongoing, however, as per experts, it may take more than a year to develop a vaccine.

In order to enhance COVID-19 drug discovery and develop rapid testing kits, various academic institutes, non-profit institutes, scientific pioneers and biopharmaceutical companies have also been leveraging benefits of CRISPR technology.

For more Insights Click under

CRISPR Can be a Solution to Address the COVID-19 Pandemic

The CRISPR / Cas9 system has revolutionized the field of genetic engineering. It enables researchers to alter the genomes of a range of organisms with relative ease. Currently, it has emerged as a promising tool that is used extensively for editing genomes and for the development of novel treatment options. CRISPR is popularly known as search engine for biology, as it has emerged as a location finder, rather than site specific cleavage tool. The figure below highlights the key potential areas and benefits of CRISPR in order to fight against novel coronavirus.

Rapid and Economical Diagnostic Tests

Presently, COVID-19 testing capacity is limited by a number of factors, such as requirements for complex procedures, need for laboratory instrumentation, and dependence on limited supplies. Therefore, there is an urgent need for rapid detection kits. CRISPR has been explored by scientists for diagnosis of infectious diseases. The underlying mechanism involves binding of guide RNA with a protein of Cas family which cuts the target and shreds the nearby RNA or DNA. When CRISPR hits a target, the reporter molecule releases a fluorescent signal. This is further analysed by paper tests dipped into a patient sample, such as blood, urine, or saliva, which further shows up as a line on the testing strip. Researchers have been utilizing CRISPR-based tools and technologies to detect RNA of virus in patient samples. Sherlock Biosciences has already made history, as it received Emergency Use Authorization (EUA) from the US Food and Drug Administration (FDA) for its Sherlock CRISPR SARS-CoV-2 kit for the detection of the virus that causes COVID-19. The kit is designed for use in laboratories and can provide results within an hour. The company claims that more than 1 million tests can be performed within a week.

Enhancing Drug Discovery

CRISPR technology aids in the study of interaction of virus with human cells. This enables the generation of appropriate cell models for faster discovery of new potential treatment options, or identification of an existing drug combination that may provide a treatment solution. For instance, researchers are exploring molecular mechanisms of the novel virus by utilizing CRISPR technology, which can ultimately assist in identifying potential drug combinations.

CRISPR-based COVID-19 Therapy

Researchers at Stanford University have been working on the development of a gene targeting anti-viral agent against COVID-19, using PAC-MAN technology. The technology has been modified to be used against the deadly virus. It consists of a virus-killing enzyme, such as Cas13 and a guide RNA, which commands Cas13 to destroy specific nucleotide sequences in the coronaviruss genome. Based on several studies, it has been revealed that PAC-MAN has the ability to neutralize the coronavirus and stop it from replicating inside cells. Based on information available, work is currently ongoing, and researchers are finding a solution to deliver this technology to lung cells. Multiple delivery methods are currently under evaluation.

A lot of companies are currently active in providing CRISPR-based genome engineering services. To get a detailed information on the key players, recent developments, and the likely market evolution.

For more Insights Click under

CRISPR Can be a Solution to Address the COVID-19 Pandemic

You may also be interested in the following titles:

About Roots Analysis

Roots Analysis is one of the fastest growing market research companies, sharing fresh and independent perspectives in the bio-pharmaceutical industry. The in-depth research, analysis and insights are driven by an experienced leadership team which has gained many years of significant experience in this sector. If youd like help with your growing business needs, get in touch at [emailprotected]

Contact Information

Roots Analysis Private Limited

Gaurav Chaudhary

+1 (415) 800 3415

[emailprotected]

Visit link:
CRISPR Can be a Solution to Address the COVID-19 Pandemic | Roots Analysis - The Think Curiouser

Genome editing may be one of the solutions to address climate change. A September 2020 report by the Information Technology & Innovation Foundation (ITIF),Gene Editing for the Climate: Biological Solutions for Curbing Greenhouse Emissions, emphasizes that gene-editing technology could be used to develop clean energy and climate solutions that policymakers have to date under-emphasized.

CRISPR and the newer gene-editing applications are also being used to address food issues by reducing apple or potato browning and tomato softening to extend the shelf life of produce. In addition, disease-resistant fruits are under development, such as the Panama disease resistant Cavendish bananas that are being field tested by Tropic Biosciences.

Furthermore, many companies are focusing on extending the nutritional value of food by adding more protein to soy and other staple crops, and making oils, including soybean and canola, healthierAnother firm of note, Pairwise Plants, is working to develop new and delicious types of leafy greens, berries, and cherries, along with other efforts in staple crops.

The role of technology and its impact on agriculture is unprecedented. According to [Yeild10s OIiver] Peoples, it is important to start by looking at fundamentals in a scientific way and first ask whether a change makes sense; if it has a meaningful impact and is sustainable.

Read the original post

Visit link:
Picking up where GMOs left off: CRISPR leads the way to 'greener' food production in the 21st century - Genetic Literacy Project

CRISPR (pronounced crisper) is short for clustered regularly interspaced short palindromic repeats. It is a method for genome editing, and recently hit the headlines with the announcement that the 2020Nobel Prizein Chemistry will be awarded to Emmanuelle Charpentier and Jennifer Doudna for their discovery of the CRISPR/Cas9 genetic scissors.

The possibilities offered by CRISPR for probiotics and manipulation of the microbiome will be addressed at the upcoming IPA World Congress + Probiota Americas 2020 Digital Summit in a keynote presentation by Dr Rodolphe Barrangou from North Carolina State University.

Speaking with NutraIngredients-USA this week, Dr Barrangou explained: Most people dont know that CRISPR-Cas systems occur naturally in about half of the bacteria that exist in the world. So, CRISPR actually comes from bacteria. CRISPR has been used in the dairy industry already to enhance phage resistance in cheese cultures, yogurt cultures, and the like.

There are multiple papers that have come out already illustrating our ability to manipulate not just probiotic species but also specific strains. We can use endogenous CRISPRs or exogenous CRISPRs to manipulate some of the common players in the probiotics field commercially. That has been done. We can add genes. We can remove genes. We can change genes of interest, added Dr Barrangou.

What we havent seen as of yet, but were on the cusp of seeing, is enhancing several genes at the same time and then commercializing clinically-tested, proven and substantiated probiotics. Were going to see it right before our eyes.

CRISPR is very powerful. CRISPR is very timely. CRISPR is going to allow us to reshape the future of probiotic genomes more flexibly, more easily, more affordably than we had imagined until now.

Dr Barrangou will deliver his keynote on the opening day of the IPA World Congress + Probiota Americas 2020 Digital Summit on November 10.

Over the three days, sessions will run for two hours, and offer attendees keynote presentations, live panel discussions, presentations from the leading categories leading players, and live Q&A sessions.

The Digital Summit will bring together experts from Seed, UAS/ Chr. Hansen, Lonza, Embria (Cargill), North Carolina State University, University College Cork, ADM, KGK Science, Probi, the International Probiotics Association, the Lawson Health Research Institute, and many more.

The event will also feature a range of exclusive on-demand content, including our unique series of interviews with champions of prebiotics, probiotics and the microbiome.

For more information and to register for FREE, please click the image below.

NOVEMBER 10 - 12, 2020 3-DAY SUMMIT

Connecting the business and science of the microbiome

The rest is here:
CRISPR is going to reshape the future of probiotic genomes: Expert - NutraIngredients-usa.com

CRISPR Therapeutics (NASDAQ:CRSP) disappointed the market today with its third-quarter results, due in no small part to a dramatic but expected flip into the red on the bottom line.

For the quarter, the company's collaboration revenue withered to roughly $148,000, from the year-ago figure of nearly $212 million. The extreme fall was due to the fact that in the year-ago quarter, the clinical-stage company received development funds from longtime partner Vertexthat comprised the vast bulk of its revenue.

Image source: Getty Images.

For similar reasons, CRISPR posted a loss in this most recent quarter. This amounted to almost $92.6 million, or $1.32 per share, against the year-ago net profit of $138.4 million.

Neither headline figure met analyst expectations. According to data compiled by Yahoo! Finance, on average, prognosticators tracking the stock were expecting nearly $2.1 million in revenue, and a per-share net loss of only $1.18.

CRISPR's earnings release comes shortly after the company, which specializes in therapies based on gene-editing techniques, made headlines for its off-the-shelf T-cell therapy CTX110. While the company reported some quite promising results in the early-stage trial for CTX110, this was marred by the death of a participant several weeks after he received a relatively high dosage of the treatment. Clinical-stage biotech stocks like CRISPR tend to be very sensitive to negative developments such as this, and shares took a serious hit despite those positive results detailed in the research.

Regardless, investors aren't particularly bullish on the company these days. On Wednesday, they bid the company's stock down by 3.5%, a steeper fall than that of the S&P 500 index.

Continued here:
CRISPR Therapeutics Stock Falls 3.5% on Q3 Results - Motley Fool

TipRanks

America goes to the polls on Tuesday (well, actually, America has been early voting for a few weeks, now), and while Democrat Joe Biden has a solid lead in the polls, there is some of evidence that President Trump may still win a second term. Finally, with all of the early voting, mass absentee ballots, and possible extended counting deadlines, we might not know on Tuesday night who the winner is.Its a situation made of uncertainty, and financial markets dont like that. Which brings us to dividend stocks. Investors want a pad, something to protect their portfolio in case of a market drop, and dividends offer just that. These profit-sharing payments to stockholders provide a steady income stream, that typically stays reliable even in a modest downturn. Wall Streets analysts have been doing some of the footwork for us, pinpointing dividend-paying stocks that have kept up high yields, at least 8% to be exact. Opening up theTipRanks database, we examine the details behind those payments to find out what else makes these stocks compelling buys.Altria Group, Inc. (MO)Well start with Altria Group, the tobacco company best known for its iconic Marlboro cigarettes. Altria, like many of the so-called sin stocks, is one of the markets dividend champions, with a long history of reliable, high-yielding payments. The company has benefited from a psychological quirk of human nature during such a wild year as 2020: People will hunker down if necessary, but they wont give up their small pleasures.Cigarettes are exactly that, and even though overall smoking rates have been declining in recent years, Altria saw stable financial results in the last few quarters. The first and second quarters both showed $1.09 in earnings, well above the 97 cents expected in Q1 and modest beat against Q2s $1.06 forecast. Revenues hit $5.06 billion in Q2, in-line with the two previous quarters.Looking ahead, analysts expect Altria to post $1.15 per share in earnings on $5.5 billion in revenues when it reports Q3 results. That report is due out tomorrow morning. Meeting those results will help Altria maintain its dividend although the company has a long-standing, very public, commitment to do just that. Altria has kept its dividend reliable for the past 12 years, and for the last payment, made it September, the company even slightly raised the payout by 2.4%. The current dividend is 86 cents per common share, or $3.44 annualized, and yields an impressive 8.8%.Looking at Altria in the lead-up to the Q3 report, Deutsche Bank analyst Stephen Powers writes, [We] are positively biased on company fundamentals as we approach MO's results next weekreinforced by healthy scanned channel demand intraquarter across MO's core tobacco businesses, with particular strength in cigarettes driven by the Marlboro brand we believe continued operational execution in its core business will enable MO to more credibly position itself as a stable core tobacco investmentPowers rates the stock as a Buy, and his $51 price target implies a 37% upside for the coming year. (To watch Powers track record, click here)Overall, Altria has a Moderate Buy rating from the analyst consensus, based on 3 Buys and 2 Holds set in recent weeks. The stocks current share price is $37.04, and the average price target of $46 suggests a 24% one-year upside. (See MO stock analysis on TipRanks)American Finance Trust (AFIN)Next on our list is a Real Estate Investment Trust, a REIT. These companies are known for their high dividends, a fact resulting from a quirk of tax regulation. REITs are required to return a certain percentage of profits directly to shareholders, and dividends are one of the surest means of compliance. AFIN, which focuses its portfolio on single- and multi-tenant service-retail properties, is typical for its niche.And its niche has been solid. AFIN boasts major companies like Home Depot, Lowes, and Dollar General among its top ten tenants, and announced earlier this month that it has collected over 91% of its third quarter rents. Looking ahead to Q3 results next week, EPS is expected at 23 cents, a 15% increase from Q2. The company offers a monthly dividend, at a rate of 7.1 cents per common share, instead of the more common quarterly payments. The monthly format allows some flexibility in managing adjustments to the payout rate; in April, AFIN reduced the dividend from 9 cents to 7.1 as part of efforts to manage the corona crisis effects on business. The current payment annualizes to 85.2 cents per share, and yields a robust 14.7%. This is more than 7x higher than the average dividend yield found among S&P 500 companies.B. Riley analyst Bryan Maher notes the difficulties that AFIN has faced, as a property owner and manager during an economic downturn, but is confident in the companys ability to meet the challenges.Like most REIT's, AFIN has been impacted by the COVID-19 pandemic, which is not surprising given its portfolio has a large number of service retail assets. However, 71% of the portfolio is necessity-focused retail, with the balance being distribution and office properties. As such, AFIN collected 84% of cash rents due in 2Q20, including 96% of the cash rent due from its top 20 tenants. Cash rent collection for July improved to 88%. AFIN has been proactive in working with certain tenants to negotiate rent deferrals/credits Maher noted. To this end, Maher rates AFIN stock a Buy, and gives it a $10 price target. At current trading levels, this implies a strong one-year upside potential of 76%. (To watch Mahers track record, click here)AFIN is priced at $5.69, and its average target matches Mahers, at $10. The stock has a Moderate Buy from the analyst consensus, based on an even split between Buy and Hold reviews. (See AFIN stock analysis on TipRanks)Golub Capital BDC (GBDC)Last but not least is Golub Capital, a business development company and asset manager. Golub works with middle market companies, providing solutions for financing and lending. The company boasts a market cap of $2.2 billion, as well as over $30 billion in capital under management.In the months since the corona virus crisis hit the economy, Golub has seen a depressed share price and high volatility in its earnings. The stock is down 28% year-to-date. Earnings, which collapsed in 4Q19, have been bouncing in 2020. The first quarter showed 33 cent per share, while the Q2 figure came in at 28 cents. Looking ahead, the forecast expects a repeat of the second quarter EPS figure, 28 cents. Revenues have been just as volatile; the first quarter saw a deep net loss, but Q2 saw the top line bounce back to $145 million. This was the highest quarterly revenue figure in the past year.Golub believes in keeping up the dividend for investors, offering not only a reliable regular payment but also periodic special dividends. The company adjusted the payment earlier this year, both to keep it affordable during the coronavirus crisis and to keep the yield from getting too high. The result was a 12% cut, making the current payment 29 cents per common share quarterly. This still gives a high yield of 9.16%, which compares well to the 2.5% average found among finance sector peers.Finian OShea, from Well Fargo, notes that Golub has recently announced a $2 billion unsecured debt issue, a move that gives the company plenty of liquidity in a difficult time. He writes, GBDC isnt paying a hefty premium for unsecureds to begin with... We think the improved flexibility and longer tenor of unsecureds make them an attractive addition to the right side of the balance sheet, and see it as a vote of confidence in GBDCs underlying portfolio.OShea reiterates his Overweight (i.e. Buy) rating on this stock. His price target, at $13.50, indicates room for a modest 6% upside. (To watch OSheas track record, click here)Like AFIN above, Golub Capital has a Moderate Buy consensus rating, with 1 each Buy and Hold reviews. The stocks average price target matches OSheas, at $13.50. (See Golubs stock analysis at TipRanks)To find good ideas for dividend stocks trading at attractive valuations, visit TipRanks Best Stocks to Buy, a newly launched tool that unites all of TipRanks equity insights.Disclaimer: The opinions expressed in this article are solely those of the featured analysts. The content is intended to be used for informational purposes only. It is very important to do your own analysis before making any investment.

View original post here:
Did The Underlying Business Drive CRISPR Therapeutics' (NASDAQ:CRSP) Lovely 407% Share Price Gain? - Yahoo Finance

AllTheResearchs latest research report provides an overview of thePlant Breeding and CRISPR Plants market with segmentation, regional analysis and discussion of important industry trends, market share estimates and profiles of the leading key players. The identified trends that are very helpful for business decisions. The Plant Breeding and CRISPR Plants Industry report is a valuable source of guidance for the new and prominent growths of the enterprise, the competitive evaluation, and nearby assured analysis for the reviewing size.

The global Plant Breeding and CRISPR Plants market was valued at US$ 7452.1 Mn in 2018 and is expected to reach US$ 17246.7 Mn in 2026, growing at a CAGR of 16.1% during the forecast period.

Request for Sample with Complete TOC and Figures & Graphs @ https://www.alltheresearch.com/sample-request/179

Company Profiles mapped in Plant Breeding and CRISPR Plants market with Competitive Intelligence:

Market Segmentation by Type, Application and Region

Based on Product Type:

Based on Application:

The Global Plant Breeding and CRISPR Plants market analyses and researches the Plant Breeding and CRISPR Plants development status and forecast in the United States, Europe, China, Japan, Southeast Asia, India and Central and South America. The Global Plant Breeding and CRISPR Plants Market focuses on global major leading industry players providing information such as company profiles, product picture and specification, capacity, production, price, cost, revenue, and contact information. Upstream raw materials and equipment and downstream demand analysis is also carried out.

The Plant Breeding and CRISPR Plants industry development trends and marketing channels are analyzed. Finally, the feasibility of new investment projects is assessed, and overall research conclusions offered. The Plant Breeding and CRISPR Plants Market report provides key statistics on the market status of the Plant Breeding and CRISPR Plants manufacturers and is a valuable source of guidance and direction for companies and individuals interested in the industry.

Any questions, Lets discuss with the analyst @ https://www.alltheresearch.com/speak-to-analyst/179

How Report will help you to make decisions for business:

Browse report along with TOC, Table & figures, research methodology and many more @ https://www.alltheresearch.com/report/179/Plant Breeding and CRISPR Plants

About AllTheResearch:

AllTheResearch was formed with the aim of making market research a significant tool for managing breakthroughs in the industry. As a leading market research provider, the firm empowers its global clients with business-critical research solutions. The outcome of our study of numerous companies that rely on market research and consulting data for their decision-making made us realise, that its not just sheer data-points, but the right analysis that creates a difference.While some clients were unhappy with the inconsistencies and inaccuracies of data, others expressed concerns over the experience in dealing with the research-firm. Also same-data-for-all-business roles was making research redundant. We identified these gaps and built AllTheResearch to raise the standards of research support.

FOR ALL YOUR RESEARCH NEEDS, REACH OUT TO US AT:

Contact Name: Rohan S.

Email:[emailprotected]

Phone: +1 (407) 768-2028

More here:
Plant Breeding and CRISPR Plants Market Report 2026 Focuses on Top Companies, Research Methodology, Drivers and Opportunities - Eurowire