Archive for the ‘Crispr’ Category

BALTIMORE An ambitious effort to cure HIV with CRISPR genome editing fell short in an early clinical trial, investigators announced Friday morning.

In the study, run by Excision BioTherapeutics, researchers tried to use the gene editing tool to address a chief reason HIV has been so hard to cure. While antiviral drugs can clear patients of replicating virus, HIV is able to worm its way into a patients own DNA in certain cells. If the patient ever stops taking medicines, those cells start pumping out HIV particles and the infection roars back.

Researchers hoped they could send CRISPR to those cells and, by cutting the HIV DNA lurking there at two spots, slice out the virus. In the Phase 1 trial, investigators administered the treatment to five patients. They then took three of them off conventional antiviral treatment.

STAT+ Exclusive Story

Already have an account? Log in

Already have an account? Log in

Already have an account? Log in

Get unlimited access to award-winning journalism and exclusive events.

Go here to see the original:
Trial using CRISPR to edit HIV out of cells disappoints - STAT - STAT

Cell culture

MT4CCR5 cells are a human CD4+ T cell-line modified to stably express CCR5 co-receptor after being transduced with a lentiviral vector expressing human CCR5 under the control of SFFV promoter. These cells are susceptible to both R5-and X4-tropic HIV-1. The MT4CCR5 cells were kindly provided by Dr. Koki Morizono (UCLA, Los Angeles). These cells were cultured in RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, 100 units penicillin, and 100g/ml streptomycin (Gibco). The cell cultures were maintained in a humidified incubator at 37C and 5% CO2. HEK293T cell line (Clontech) was used for viral production and lentiviral titer. The cells were cultured in Dulbeccos Modification of Eagles Medium (Hyclone) with the same supplements as MT4CCR5 cells.

The third-generation lentiviral vector, pLVX-AcGFP1-N1 (Clontech, Cat# 632154), was used as the backbone vector to transfer the C46 HIV-1 fusion inhibitor gene into the target cells. The C46 C-peptide fusion inhibitor sequence obtained from the publication of Felix G. Hermann et al., 200950 were gene synthesized and cloned into pUC57 plasmid (Integrated DNA Technologies, Inc). The C46 HIV-1 fusion inhibitor sequence was designed to flank XhoI and EcoRI restriction sites to clone in the lentiviral vector, resulting pLVX-C46-AcGFP1. The pLVX-C46 plasmid was cloned by amplifying C46 HIV-1 fusion inhibitor gene without the expression of AcGFP1 from the synthesized pUC57 plasmid with the forward primer having the XhoI restriction site and the reverse primer adding a stop codon before the EcoRI restriction site. All construct lentiviral plasmids were confirmed to contain the C46 HIV-1 fusion inhibitor by restriction enzyme digestion and DNA sequencing.

VSVG-pseudotyped lentiviral vector particles were produced in HEK293T cells, using four separate plasmids and the calcium phosphate transfection method, as previously described51,52,53. HEK293T cells were seeded on 10-cm cell culture dishes, and co-transfected with the construct lentiviral vector with the third-generation packaging plasmid system (Addgene plasmid #12251 (pMDLg/pRRE), #12253 (pRSVREV), #12259 (pMD2.G). Vector particles were harvested from the culture supernatant collected at 24 and 48h. The viral vector titers, determined by infection of HEK293T cells with serial dilution of the samples, were expressed as the percentage of AcGFP1+positive cells evaluated by flow cytometry.

MT4CCR5 cells and MT4CCR5 CRISPR/Cas9 knockout CCR5 cells (1106) were transduced with lentiviral vectors at a multiplicity of infection (MOI) of 0.1 with 8g/ml polybrene for 24h. The transduced cells were seeded in a 6-well plate and incubated at 37C for 3days before determining the percentage of transduced cells by flow cytometry. The transduced cells were enriched for those containing the lentiviral vectors by treating them with 1g/ml puromycin (SigmaAldrich) in culture medium and refreshing the medium every 34days.

3xNLS-SpCas9 plasmid (Addgene plasmid#114365), was transformed into ClearColi BL21(DE3) E.coli cells for protein expression. The recombinant protein was expressed and purified as previously published54. In detail, the cells were cultured in LuriaBertani medium supplemented with 100g/ml of ampicillin at 37C until the cell density reached 0.6 at OD600 nm. Subsequently, protein expression was induced by adding 0.4mM isopropyl--D-thiogalactopyranoside (IPTG), and the culture was maintained at 18C in a shaking incubator for 24h. After induction, cells were centrifuged, and the cell pellets were stored at20C. To purify the Cas9 protein, the cell pellets were lysed in a buffer containing 20mM TrisHCl pH 7.5, 200mM NaCl, 0.5mg/ml lysozyme, and 1mM DTT by incubating on ice for 10min. The cells were then physically lysed by sonication and centrifuged at 15,000rpm for 1h at 4C. The supernatant was applied onto the first 1ml of HisTrap FF prepacked column (Cytiva). After extensive washing with binding buffer (20mM TrisHCl pH 7.5, 200mM NaCl) and binding buffer containing 20mM Imidazole for 5ml, the partially purified Cas9 protein was eluted with a buffer containing 200mM imidazole. For the second purification step, hydrophobic interaction chromatography (HIC) column (phenyl sepharose HP) was utilized. The HIC column was pre-equilibrated with 20mM TrisHCl pH 7.5, 200mM NaCl, and 2M NaCl buffer. The elution sample from the first column was also supplemented with salt up to 2M to promote protein binding. After applying the sample onto the column, Cas9 protein was eluted with a buffer containing 20mM TrisHCl pH 7.5, 200mM NaCl, and 1M NaCl. Finally, the Cas9 protein was further purified using gel filtration chromatography (superdex 200 increase 10/300 GL) as a third purification step. The purity of the final protein sample was evaluated by SDS-PAGE. The protein concentration was determined by the Bradford method using BSA as protein standard.

The sgRNA1# sequences, 5-ACTATGCTGCCGCCCAGT-3; the sgRNA2# sequence 5-CAGAAGGGGACAGTAAG-314. The sgRNAs targeting to CCR5 gene were synthesized with chemically modified nucleotides at the terminal positions at both the 5 and 3 ends were purchased from Integrated DNA Technologies, Inc. Ribonucleoprotein (RNP) complex was made by incubating 6g (36.81pmol) or 10g (61.35pmol) of the in-house purified Cas9 protein, 2g (61.86pmol) or 4g (123.72pmol) of sgRNA#1 or sgRNA#2 at room temperature for 20min. Resuspended 1106 cells in 20l of SF cell line nucleofector solution, mixed with the RNP complex, and transferred into the Nucleocuvette (Lonza), program DC100. The nucleotransfection protocol was followed according to the manufacturers recommendations (Amaxa 4D-Nucleofector, Lonza).

Cells were stained with monoclonal antibodies against human CCR5 (2D7: PECy7 labeled, eBioscience, Cat#557752), human CXCR4 (12G5: APC labeled, Biolegend, Cat#306510), human CD4 (OKT4: PE labeled, Biolegend, Cat#317410), according to the manufacturers instructions. C46 HIV-1 fusion inhibitor expression was measured by staining with 0.2g of anti-HIV-1 gp41 Monoclonal (2F5) (NIH AIDS Reagent Program, Cat#1475) followed by 50l of 1:500 of the secondary antibody (PE-anti-human Fc, Jackson Immunoresearch, cat#109-115-098). Isotype control antibodies were included with mouse IgG2b control-PE (ImmunoTools, Cat#21275534), mouse IgG1 control-APC (ImmunoTool, Cat#2185016), and mouse IgG1 control-PECy7 (Biolegand, Cat#400126). CCR5, CXCR4, CD4, C46 HIV-1 fusion inhibitor, and AcGFP1 expression were measured by flow cytometry using the CytoFLEX Flow Cytometer (Beckman Coulter). A live cell population defined by 7AAD- staining (Biolegend, cat#420404) was subjected to single-cell population analysis for each antibody staining. Additionally, a positive control for dead cells was established by exposing MT4CCR5 cells to heat at 56C for 30min before staining and determined by the 7AAD+ population. Data analysis for gene expression was performed with FlowJo version 10 software (BD Biosciences).

The genomic DNA was isolated from cells using Invitrogen Purelink Genomic DNA Mini Kit (Invitrogen, cat#K182001) according to the manufacturers instructions. 25ng of genomic DNA per reaction was validated with real-time PCR reactions set up in duplicate in 25l reaction volumes using Agilent Brilliant II master mix (Invitrogen) in a 96-well plate on CFX Connect Thermal Cycler platform (Bio-Rad). Taqman primer and probe sequences for this assay were as follows: C46 probe: 5 6-FAM/CA CTC CAC G/ZEN/C AGC ACT TCC GCT CG/IABkFQ 3, C46 forward primer: 5 CAC AGC CTG ATC GAG GAG AG 3, C46 reverse primer: 5 GTC CTG CCA CTG GTG GTG 3, -globin probe: 5 HEX/CT CCT GAG GAG AAG TCT GCC GTT ACT GCC /BHQ-2 3, -Globin forward primer: 5 CAA CCT CAA ACA GAC ACC ATG G 3, -Globin reverse primer: 5 TCC ACG TTC ACC TTG CCC 3. Thermocycling conditions were 50C 2min, 95C 10min, 40(95C 15s; 60C 1min)18.

Cells were washed with ice-cold PBS and lysed in radioimmunoprecipitation assay (RIPA) lysis buffer (Thermo-Fisher Scientific). The total protein concentration in the cell lysates was measured using the bicinchoninic acid assay (Thermo-Fisher Scientific). Subsequently, 30g of total protein was separated by SDS-PAGE and transferred onto a PVDF membrane (Thermo-Fisher Scientific). Blocking was carried out using 5% skim milk (Sigma) in 0.05% PBST for 24h, followed by overnight incubation with the primary antibody (anti-CCR5 antibody; CUSABIO TECHNOLOGY, cat#CSB-PA006994). After washing the blots five times with 0.05% PBST, they were probed with the secondary antibody (Goat pAb to Rb IgG (HRP); AbCam, cat#ab205718) for 1h and subsequently detected using ECL Western Blotting Substrate (Bio-Rad, cat#1705060) and scanned using the Odyssey InfraRed Imaging System (LI-COR BioSciences, Lincoln, NE). The blots were then stripped with mild stripping buffer (Thermo-Fisher Scientific), re-blocked, and re-probed with anti--Actin antibody (Abcam, cat#ab8227).

Genomic DNA was extracted from cells using Invitrogen Purelink Genomic DNA Mini Kit (Invitrogen, cat#K182001) according to the manufacturers instructions. The target sequence was amplified using the Phusion high-fidelity DNA polymerase (Thermo Scientific, cat#F-530XL) and XhoI-CCR5 forward primers 5-TGGACAGGGAAGCTAGCAGCAAA-3 and EcoRI-CCR5 reverse primer 5-TCACCACCCCAAAGG TGACCG-3. The PCR products were annealed after purification. Next, 2l of hybridized DNA were subjected to digestion with 0.5L T7EI (New England Biolabs) in NE Buffer 2 for 30min at 37C. Subsequently, the samples were loaded onto a 2% agarose gel electrophoresis with an equal amount of PCR product controls from non-edited samples.

R5-tropic HIV-1BaL virus and X4-tropic HIV-1NL4-3 virus were produced by transient transfection of pWT/BaL plasmid (NIH AIDS Reagent Program, cat#11414) or pNL4-3 plasmid (NIH AIDS Reagent Program, cat#114) into HEK293T cells. Monolayers of HEK293T cells (5106 cells per 10-cm dishes) were transfected with 10g of each plasmid using a calcium phosphate transfection method51,52,53. After 8h, the transfection mixture was withdrawn, replaced by 10ml of 10% FBS in DMEM medium. The transfected cells were incubated for 24h. HIV-1 viruses were harvested from the culture supernatants and filtered through sterile syringe filters with a 0.45-m pore size (Merck Millipore). HIV-1 samples were aliquoted and kept at80C. The virus titer was determined for the HIV viral load using the COBAS AMPLICOR HIV-1 Monitortest (version 1.5; Roche Molecular Systems, Branchburg, NJ).

The 1106 cells were incubated with HIV-1 at MOI of 1 and 10 for 16h. The cells were then washed three times with serum-free medium and resuspended in fresh growth medium. The infected cells were split into half at 3-day intervals, to maintain a cell density of approximately 106cells/ml. HIV-1 replication was monitored in culture supernatants, using HIV-1 p24 Simple Step ELISA kit (Abcam, cat#ab218268) and viral load assay, as described above. The cell pellets were kept determining cell viability by 7AAD staining (Biolegend, cat#420404) and flow cytometry.

Data was obtained from triplicate experiments (n=3). The data were analyzed, and standard deviations (SD) were calculated using the Prism 7 (GraphPad) statistical software program. Unpaired t-tests with Welchs correction were used to calculate p values, and p<0.05 was considered statistically significant.

Read this article:
CRISPR/Cas9 genome editing of CCR5 combined with C46 HIV-1 fusion inhibitor for cellular resistant to R5 and X4 ... - Nature.com

Genome editing has been successfully used to treat liver disease in fetal monkeys while still in the womb.

A collaborative team led by Dr William Peranteau from the Children's Hospital of Philadelphia and Professor Kiran Musunuru from the University of Pennsylvania, Philadelphia, has successfully used base editing, a form of CRISPR/Cas9 genome editing whereby only a single DNA base is changed, to treat hereditary liver disease in fetal monkeys.

'Genetic diseases affecting the liver, including metabolic liver diseases, are some diseases that may benefit from in utero editing,' the researchers explained while presenting their work at the 27th Annual Meeting of the American Society of Gene and Cell Therapy in Baltimore, Maryland. 'This body of work presents evidence that a one-time injection is enough to fix a broken gene by editing it to correct a disease-causing mutation.'

In this study, the researchers used base editing to treat hereditary tyrosinemia type one (HT1), a condition that also affects humans. This liver disease is caused by a mutation in the Fah gene, leading to a buildup of toxic byproducts that cause severe damage to the liver.

Base editing avoids the risks associated with the double-strand breaks created in traditional CRISPR techniques, which can lead to unpredictable edits and higher levels of cellular toxicity (see BioNews 1217 and 1091). Currently, this disease is managed with nitisinone, a medication that blocks the HPD enzyme. This enzyme acts upstream of Fah and blocks the pathway that leads to the production of toxic byproducts, thereby preventing damage to the liver.

The researchers also targeted the HPD enzyme, by disabling the HPD enzyme-coding gene. Previously, the they had success using this approach in fetal mice while still in the womb (see BioNews 971). In the current study, the researchers have tested the feasibility of in utero base editing in crab-eating macaques, which provide a much closer genetic model to humans, allowing researchers to refine the approach for potential future therapies.

To test the efficacy of the approach in utero, the researchers also delivered the base-editing injection to three-year-old crab-eating macaques. They noted that the editing levels were approximately 2- to 4.5-fold lower compared to fetal monkeys, which highlights the potential advantages to editing during fetal development.

'We also find that delivering our injection earlier in life matters, and improves how well we can edit the disease gene. With this work, we hope to pave the way to one-day offering patients these types of one-time injections to [treat] diseases caused by genetic mutations,' the researchers said at the Meeting.

Although HT1 is a rare disease affecting roughly one in 100,000 individuals and treatable with nitisinone for most patients, this research acts as a proof-of-concept to treat a wide range of congenital diseases before birth using CRISPR base editing.

However, despite the promising results, significant hurdles remain before this technique can be applied safely and effectively in humans.

See the original post:
CRISPR base editing treats liver disease in fetal monkeys | PET - BioNews

Paralog meta-analysis

To reanalyze the data from the 5 paralog screens, raw read counts were downloaded, and the same pipeline was applied to all of them. A pseudocount of 5 reads was added to each construct in each replicate, and total read counts were normalized to 500 reads per construct. Log2 fold change (LFC) for each guide at late time point was calculated relative to the plasmid sequence counts.

The data from each study (except Thompson) were divided into three groups; the constructs that target single genes paired with non-essential/non-targeting gRNAs (N) in the first position (gene_N), in the second position (N_gene) and constructs that target gene pairs (A_B). LFC values of each group were scaled individually so that the mode of each group was set to zero. Next, all three groups were merged in one table. Before dividing Itos dataset into three groups, LFC values were scaled such that the mode of negative controls (non-essential_AAVS1) would be zero and also TRIM family was removed from this dataset to avoid false paralog pair discovery13. Since in Thompsons study there was just one position for singleton constructs, LFC values were scaled so that the mode of negative controls (non-essential_Fluc) was set to zero. In the next step, LFC of each construct was calculated by the mean of LFC across different replicates.

To calculate genetic interaction, single gene mutant fitness (SMF) was calculated as the mean construct log fold change of gene-control constructs for each gene. The control was either non-essential genes or non-targeting gRNAs. For each gene pair, the expected double mutant fitness (DMF) of genes 1 and 2 was calculated as the sum of SMF of gene 1 and SMF of gene 2. The difference between expected and observed DMF, the mean LFC of all constructs targeting genes 1 and 2, was called dLFC.

Next step was calculating a modified Cohens D between observed and expected distribution of LFC of gRNAs targeting genes. Expected distribution of gRNAs targeting a gene pair, was calculated using expected mean and expected standard deviation (std).

$${expected},{mean}=mu 1+mu 2$$

(1)

$${expected},{stand},{deviat}=sqrt{{({std}1)}^{2}+{({std}2)}^{2}}$$

(2)

$${S}_{{pooled}}=frac{sqrt{{({expected} , {std})}^{2}+{({observed} , {std})}^{2}}}{2}$$

(3)

$${Cohe}{n}^{{prime} }{sD}=frac{{expected},{mean}-{observed},{mean}}{{S}_{{pooled}}}$$

(4)

Where 1 = mean LFC of gene1 constructs, 2 = mean LFC of gene2 constructs, std1 = standard deviation of LFC of gene1 constructs, and std2 = standard deviation of LFC of gene2 constructs.

In each cell line, the paralog pairs with dLFC<1 and Cohens D>0.8 were selected as hits. Cohens D>0.8 indicates large effect size between two groups, meaning that our expected and observed distribution of gRNAs are meaningfully separated. In total 388 paralog pairs were identified as hits across all the studies.

To identify the most consistent method in terms of hit identification, the Jaccard similarity coefficient of every pair of cell lines in each study was calculated by taking the ratio of intersection of hits over union of hits. For the studies that screened more than two cell lines, the final platform weight was the median of the calculated Jaccard coefficients of all pairs of cell lines.

$$Jleft(A,, Bright)=frac{left|Acap Bright|}{left|Acup Bright|}=frac{left|Acap Bright|}{left|A{{{{{rm{|}}}}}}+left|Bright|-{{{{{rm{|}}}}}}Acap Bright|}$$

(5)

To score paralog pairs, each hit was scored based on the cell lines in which it was identified as a hit; cell lines were weighted based on the platform weight described above. We defined the paralog score as the sum of platform weights of cell lines in which the paralog pair was identified as a hit minus the sum of platform weights of cell lines in which the paralog pair was assayed but not identified as a hit (a miss). The distribution of scores is shown in Fig.1. Gene pairs with paralog score > 0.25 and were identified as a hit in two or more studies were listed as candidate gold standard paralog synthetic lethals.

To construct an all-in-one vector for expression of both Cas12a and a guide array, we first swapped in puromycin resistance in place of blasticidin resistance from pRDA_174 (Addgene #136476). We then tested four locations for the insertion of a U6-guide expression cassette; notably this cassette needs to be oriented in the opposite direction of the primary lentiviral transcript to prevent Cas12a-mediated processing during viral packaging in 293T cells. The construct with the best-performing location, between the cPPT and the EF-1 promoter, was designed pRDA_550 (Addgene #203398). Synthesis of DNA and custom cloning was performed by Genscript.

An oligonucleotide pool consisting of 7 Essential and 7 Non-Essential gene crRNAs with their nearby DR, BsmBI recognition as well as overhang sequence was synthesized by Integrated DNA Technologies. The pool was amplified by asymmetric PCR followed by being assembled into PRDA_550 vector to acquire the designed library through NEBridge Golden Gate Assembly Kit (BsmBI-v2) (New England Biolabs). The assembled product was transformed into NEB Stable Competent E. coli (High Efficiency) cells and the plasmid DNA was purified using the PureLink Plasmid Purification Kit (Invitrogen). Three oligonucleotide pools were cloned separately and pooled together to acquire the final 7mer library. The library was sequenced to confirm uniform and complete library representation.

Human paralogs and percent identity data were imported from BioMart, which reports both AB and BA percent identity (these can differ if the two genes encode proteins of different lengths) Mean percent identity ((AB+BA)/2)and delta percent identity (|ABBA|) between paralogs were then calculated, and for the prototype library, paralogs with mean percent identity between 30% and 99% and delta percent identity <10% were selected (Supplementary Fig.5). Next, CCLE expression data was downloaded, and the mean and standard deviation of expression across all CCLE samples was calculated for each gene. Paralogs where both genes had mean expression>2 and stdev<1.5 were selected (i.e. constitutively expressed genes).

Finally, to identify and include paralog families of size > 2, we applied a difference from top paralog filter. For each gene A in the pool, we identified its top paralog B by max sequence identity. Then for each other candidate paralog C, we calculated the drop in sequence identity, ABAC (see distribution of drop % in Supplementary Fig.5). For the prototype library, we defined A,B,C as being in the same family if ABAC<10%.

For the final Inzolia library, we relaxed several of these filters. The delta percent identity filter and the expression variance filter were removed entirely, and the difference from top paralog filter was expanded to 20%. The mean expression filter was retained. These three filtering steps resulted in a total of 4435 paralog pairs included in the Inzolia pool library.

Oligonucleotide pools consisting of designed four-plex guide arrays were synthesized by Twist Bioscience. The prototype pool consists of 43,972 arrays targeting 19,687 single genes, 2082 paralog pairs, 167 paralog triples, and 48 paralog quads.

5-AATGATACGGCGACCACCGAcgtctcgAGATnnnnnnnnnnnnnnnnnnnnTAATTTCTACTATTGTAGATnnnnnnnnnnnnnnnnnnnnAAATTTCTACTCTAGTAGATnnnnnnnnnnnnnnnnnnnnTAATTTCTACTGTCGTAGATnnnnnnnnnnnnnnnnnnnnTTTTTTGAATggagacgATCTCGTATGCCGTCTTCTGCTTG-3.

Italic: primer sequence Bold: BsmBI restriction sequence. Overhang in CAPS. nnnnn: guide sequence Underlined: DR sequence.

The pool of guide arrays was PCR amplified using KAPA HiFi 2X HotStart ReadyMix (Roche) using 20ng of starting template per 25L reaction (primers are listed in Supplementary Data10) and the following conditions: denaturation at 95C for 3min, followed by 12 cycles of 20s at 98C, 30s at 60C, and 30s at 72C, followed by a final extension of 1min at 72C. The resulting amplicon was purified by the Monarch PCR & DNA Cleanup Kit (New England Biolabs) and cloned into the pRDA-550 vector by NEBridge Golden Gate Assembly Kit (BsmBI-v2) The product from assembly reaction was purified and electroporated into Endura Electrocompetent cells (Lucigen). Transformed bacteria were diluted 1:100 in 2xYT medium containing 100g/mL carbenicillin (Sigma) and grown at 30 C for 16h. The plasmid DNA was extracted by PureLink Plasmid Purification Kit (Invitrogen). The library was sequenced to confirm uniform and complete library representation. The library was prepared in MD Anderson Cancer Center.

The final Inzolia pool consists of arrays targeting 19,687 single genes, 4435 paralog pairs, 376 paralog triples, and 100 paralog quads, plus 20 arrays targeting EGFP, 500 targeting intergenic loci, and 50 encoding non-targeting guides. Each array in the oligonucleotide pools is constructed as follows:

5-AGGCACTTGCTCGTACGACGcgtctcgAGATnnnnnnnnnnnnnnnnnnnnTAATTTCTACTATTGTAGATnnnnnnnnnnnnnnnnnnnnAAATTTCTACTCTAGTAGATnnnnnnnnnnnnnnnnnnnnTAATTTCTACTGTCGTAGATnnnnnnnnnnnnnnnnnnnnTTTTTTGAATggagacgTTAAGGTGCCGGGCCCACAT-3.

Italic: primer sequence Bold: BsmBI restriction sequence. Overhang in CAPS. nnnnn: guide sequence Underlined: DR sequence.

The pool of guide arrays was PCR amplified using NEBNext High-Fidelity 2X PCR Master Mix (NEB) using 196ng of starting template per 50L reaction (primers are listed in Supplementary Data10) and the following conditions: denaturation at 98C for 1min, followed by 7 cycles of 30s at 98C, 30s at 53C, and 30s at 72C, followed by a final extension of 5min at 72C. The resulting amplicon was purified by the Qiaquick PCR Purification Kit (Qiagen) and cloned into the pRDA-550 and pRDA-052 via Golden Gate cloning with Esp3I (Fisher Scientific) and T7 ligase (Epizyme). The assembly product was purified by isopropanol precipitation, electroporated into Stbl4 electrocompetent cells (Life Technologies) and grown at 37 C for 16h on agar with 100 ug/mL carbenicillin. Colonies were scraped and plasmid DNA (pDNA) was extracted via HiSpeed Plasmid Maxi (Qiagen). The library was sequenced to confirm uniform and complete library representation. The library was prepared in Broad institute.

K-562 and A549 cells were a gift from Tim Heffernan. A375 and MELJUSO were obtained from the Cancer Cell Line Encyclopedia. Cell line identities were confirmed by STR fingerprinting by M.D. Anderson Cancer Centers Cytogenetic and Cell Authentication Core. All cell lines were routinely tested for mycoplasma contamination using cells cultured in non-antibiotic medium (PlasmoTest Mycoplasma Detection Assay, InvivoGen).

All cell lines were grown at 37C in humidified incubators at 5.0% CO2 and passaged to maintain exponential growth. For each cell line, the following medium and concentration of polybrene (EMD Millipore) and puromycin (Gibco) were used:

K-562: RPMI+10% FBS, 8g/mL, 2g/mL

A549: DMEM+10%FBS, 8g/mL, 2g/mL

A375: RPMI+10% FBS, 1g/mL, 1g/mL

MELJUSO: RPMI+10% FBS, 4g/mL, 1g/mL.

Lentivirus was produced by the University of Michigan Vector Core (prototype) or the Broad GPP (Inzolia). Virus stocks were not titered in advance. Transduction of the cells was performed at 1X concentration of virus with corresponding polybrene. Non-transduced cells were eliminated via selection puromycin dihydrochloride. The selection was maintained until all non-transduced control cells reached 0% viability. Once selection with puromycin was complete, surviving cells were pooled and 500x coverage cells were harvested for a T0 sample. After T0, cells were harvested at 500X coverage on corresponding days. The prototype In4mer screens were performed in MD Anderson Cancer Center. The Inzolia screens were performed in Broad Institute.

Genomic DNA (gDNA) was extracted using the Mag-Bind Blood & Tissue DNA HDQ 96 Kit (Omega Bio-tek) and quantified by the Qubit dsDNA Quantification Assay Kits (ThermoFisher). Illumina-compatible guide array amplicons were generated by amplification of the gDNA in a one-step PCR. Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712) (Supplementary Data10).

At least ~200X coverage gDNA per replicate across multiple reactions were amplified. Each gDNA sample was first divided into multiple 50L reactions with most 2.5ug gDNA per reaction. Each reaction contained 1ul each primer (10M), 1L 50X dNTPs, 5% DMSO, 5L 10X Titanium Taq Buffer, and 1L 10X Titanium Taq DNA Polymerase (Takara). The PCR conditions were: denaturation at 95C for 60s, followed by 25 cycles of 30s at 95C and 1min at 68C, followed by a final extension at 68C for 3min. After the PCR, all reactions from the same sample were pooled and then purified by E-Gel SizeSelect II Agarose Gels, 2% (ThermoFisher). Purified amplicons were quantified by Qubit dsDNA Quantification Assay Kits (ThermoFisher) and validated by D1000 ScreenTape Assay for TapeStation Systems (Agilent) (360bp for in4mer, 501bp for 7Mer). Purified amplicons were then pooled (with 30% customized random library to increase the diversity) and sequencing was performed by NextSeq 500 sequencing platform (Illumina) with custom primers (Integrated DNA Technologies) (Supplementary Data10). The In4mer library was sequenced by read format of 151-8-8, single-end and the 7Mer library was sequenced by read format of 151-8-8-151, paired-end.

Genomic DNA (gDNA) was extracted using the Mag-Bind Blood & Tissue DNA HDQ 96 Kit (Omega Bio-tek) and quantified by the Qubit dsDNA Quantification Assay Kits (ThermoFisher). Illumina-compatible guide array amplicons were generated by amplification of the gDNA in a one-step PCR. Indexed PCR primers were synthesized by Integrated DNA Technologies using the standard 8nt indexes from Illumina (D501-D508 and D701-D712). The sequences for the primer sets were listed in Supplementary Data10.

At least ~200X coverage gDNA per replicate across multiple reactions were amplified. Each gDNA sample was first divided into multiple 100L reactions with most 10g gDNA per reaction. Each reaction contained 0.5L forward primer (100M), 10uL reverse primer (5 uM) 8L dNTPs, 5L DMSO, 10L 10X Titanium Taq Buffer, and 1.5L Titanium Taq DNA Polymerase (Takara). The PCR conditions were: An initial denaturation at 95C for 60s, followed by 28 cycles of 30s at 94C, 30s at 52C, and 30s at 72 C followed by a final extension at 72C for 10min. After the PCR, all reactions from the same sample were pooled and purified with Agencourt AMPure XP SPRI beads according to the manufacturer protocol (Beckman Coulter). Purified amplicons were quantified by Qubit dsDNA Quantification Assay Kits (ThermoFisher) and sequenced on a HiSeq2500 with a Rapid Run (200 cycle) kit (Illumina).

Reads for each reagent were counted using only exact matches to the entire 281 nucleotide 7mer sequence, excluding the leading DR (7 23mer spacer sequences + 6 20mer DR sequences). Fold changes were calculated relative to the mean of the T0 samples, and averaged across replicates. For each sample (T7/14/21), fold changes were normalized by subtracting the mean fold change of arrays with 7 nonessentials; i.e. setting no-essentials guides to zero.

We expected that the selected essential genes would not show any pairwise or higher order interactions, and thus should be governed by the multiplicative model of genetic interaction. To evaluate this model, we fit a regression model:

where A is a binary matrix of 7mer guide arrays (rows, k=384) by positions (columns, n=7), with Ai,j=1 if guide array i targets an essential gene at position j and 0 if not. (y) is the vector of normalized observed fold changes, and the n-length vector (beta) coefficients represent the single gene knockout phenotype learned from the model. We filtered this construct for reagents that encoded two or fewer essential genes (k=87 rows). After linear fit, we compared the predicted zero, one, and two gene knockout fitness profiles (by summing the (beta) coefficients for each gene) to the mean observed knockout fitness. R2 values for each pool ranged from 0.78 to 0.91, and the overall quality of the linear fit supports the multiplicative model for non-interacting genes as assayed by combinatorial CRISPR knockouts of up to two genes. An accurate null model for noninteraction is critical for detecting and classifying deviations from this model that reflect positive or negative genetic interactions.

In4mer library sequencing reads were mapped to the library using only perfect matches. BAGEL2 was used to normalize sample level read counts and to calculate fold changes relative to the T0 reference using the BAGEL2.py fc option with default parameters44. Essential and non-essential genes were defined using the Hart reference sets from refs. 39,41. Since the library targets both individual genes and specific gene sets (paralogs), we calculated the average gene/gene set (hereafter gene) log fold change as the mean of the clone-level fold changes across two replicates. All fold changes are calculated in log2 space. Cohens D statistics were calculated in Python as described in Paralog meta-analysis above. Data for recall-precision curves were calculated using BAGEL2. We set an arbitrary threshold of fc<1 for essential genes.

For genetic interaction analysis, the expected fold change was calculated as the sum of the gene-level fold changes for each individual gene in the gene set. Expected fc was subtracted from observed fc to calculate delta log fold change, dLFC, where negative dLFC indicates synthetic/synergistic interactions with more severe negative phenotype, and positive dLFC indicates positive/suppressor/masking interactions with less severe negative or more positive phenotype than expected. We set an arbitrary threshold of dLFC<1 for synthetic lethality, and>+1 for masking/suppressor interactions.

An arrayed knockout apoptosis assay approach was adopted to validate RAS synthetic lethality in K-562. Two guides were selected for each of the three RAS genes, and two clones were designed for each target/gene combination. Guide RNAs were selected through CRISPick and gblocks (same construct as Inzolia library) were synthesized by Integrated DNA Technologies. The arrays were individually cloned into the pRDA_550 backbone and plasmids were validated by Sanger sequencing. The plasmids were then individually transfected to K-562 cells via the Neon Transfection System (Invitrogen). Each group was transfected with 2g of DNA per 2106 cells, using the recommended setting for K-562 electroporation with one pulse at 1000v, 50ms. Non-transfected cells were eliminated through puromycin selection, which was maintained until non-transfected control cells reached 0% viability. Triplicate wells were maintained after selection until the end of the experiment. Cell viability, total cell numbers, live cell size and dead cell size data were collected through reading Trypan Blue (Gibco) stained cells via Countess II FL (Thermo Fisher) at each passage until 9 days after puromycin selection, in line with Inzolia screen end point of 8 days in K-562 cells. Percent dead cells were normalized to negative control and one-way ANOVA was conducted to compare experimental groups against the negative control for statistical significance.

Further information on research design is available in theNature Portfolio Reporting Summary linked to this article.

Visit link:
Efficient gene knockout and genetic interaction screening using the in4mer CRISPR/Cas12a multiplex knockout platform - Nature.com

AI-enabled protein design company Profluent has leveraged artificial intelligence to design an open-source gene editor called OpenCRISPR-1, demonstrating the technology can be used to create molecules with the power to edit human DNA.

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology, developed more than a decade ago, allows scientists to modify DNA sequences within living organisms precisely.

Potential applications range from treatments for genetic disorders to researching disease mechanisms.

The molecules it designs are fully synthetic and do not exist in nature, in contrast to previous technologies in gene editing, such as CRISPR-Cas9.

The company is open-sourcing OpenCRISPR-1 for free ethical research and commercial use and published the science behind the protein's development in a preprint publication.

"Attempting to edit human DNA with an AI-designed biological system was a scientific moonshot, Ali Madani, Profluent cofounder and CEO, said in a statement. "Our success points to a future where AI precisely designs what is needed to create a range of bespoke cures for disease."

WHY THIS MATTERS

AI was at the heart of this achievement, with the company training large language models (LLMs) on massive scale sequence and biological context.

The Profluent team developed a database of 5.1 million Cas9-like proteins, and the AI model was trained on this database to create potential proteins for CRISPR use.

This enabled the LLM to create novel gene editors from scratch as it learned through examples found in nature.

After narrowing down the results, they identified OpenCRISPR-1, a protein performing similarly to Cas9 but with far less impact on off-target sites. This makes it more precise and causes minimal damage to DNA.

The goal of open-sourcing OpenCRISPR-1 is to encourage the use of AI for ethical research and commercial use, particularly in developing medicines leveraging CRISPR.

"We believe by doing so, we can help accelerate the pace of discovery and innovation in the field," Madani said. "Our vision is to move biology from being constrained by what can be achieved in nature to being able to use AI to design new medicines precisely according to our needs."

He added that the company intends to partner with cutting-edge research institutions and drug developers working across the drug development lifecycle to enable CRISPR medicines to become available to a greater number of patients and for a greater number of disorders.

THE LARGER TREND

Gene editing technologies, including SHERLOCK and DETECTR, are transforming digital diagnostics, enabling rapid detection of infectious diseases such as COVID-19.

Companies including Atomwise, Deep Genomics and Valo are incorporating gene editing into drug discovery processes, revolutionizing treatment development.

Beyond gene editing, AI is powering everything from bone marrow analysis software to drug discovery and platforms to help pair patients with the right cancer-treatment drugs.

Originally posted here:
Profluent releases AI-enabled OpenCRISPR-1 to edit the human genome - Mobihealth News

The ambitious idea of using CRISPR to cure genetic diseases before birth is one step closer to reality. Scientists reported on Monday that they used a form of the technology known as base editing to alter the DNA of laboratory monkeys in the womb, substantially reducing the levels of a toxic protein that causes a fatal liver disease before the animals had even been born.

The research, by a team at the University of Pennsylvania and the Childrens Hospital of Philadelphia (CHOP), will be presented next month at the annual meeting of the American Society of Gene and Cell Therapy, potentially paving the way for human trials.

But arguably the bigger deal, said study co-leader William Peranteau, is that CRISPR base-editing machinery, packaged in lipid nanoparticles, made it into a number of organs beyond the liver, including the heart, kidney, diaphragm, and skeletal muscles. We were surprised to see that we were able to achieve moderate editing in some of these organs, which traditionally have been more difficult to access.

Get unlimited access to award-winning journalism and exclusive events.

Read more from the original source:
In a scientific first, researchers use CRISPR base editing to treat liver disease in fetal monkeys - STAT

Generative A.I. technologies can write poetry and computer programs or create images of teddy bears and videos of cartoon characters that look like something from a Hollywood movie.

Now, new A.I. technology is generating blueprints for microscopic biological mechanisms that can edit your DNA, pointing to a future when scientists can battle illness and diseases with even greater precision and speed than they can today.

Described in a research paper published on Monday by a Berkeley, Calif., startup called Profluent, the technology is based on the same methods that drive ChatGPT, the online chatbot that launched the A.I. boom after its release in 2022. The company is expected to present the paper next month at the annual meeting of the American Society of Gene and Cell Therapy.

Much as ChatGPT learns to generate language by analyzing Wikipedia articles, books and chat logs, Profluents technology creates new gene editors after analyzing enormous amounts of biological data, including microscopic mechanisms that scientists already use to edit human DNA.

These gene editors are based on Nobel Prize-winning methods involving biological mechanisms called CRISPR. Technology based on CRISPR is already changing how scientists study and fight illness and disease, providing a way of altering genes that cause hereditary conditions, such as sickle cell anemia and blindness.

Originally posted here:
Generative A.I. Arrives in the Gene Editing World of CRISPR - The New York Times

CRISPR technologys initial applications were primarily focused on targeted genome editing, but its use has expanded into cell line engineering, which holds promises of groundbreaking advancements, insists Promega'sPhilip Hargreaves

CRISPR technology has come a long way since its discovery as a natural defence mechanism in bacteria. Scientists have harnessed its potential to precisely edit genes, paving the way for groundbreaking advancements in genetic engineering. Initially, CRISPR was primarily used for editing specific genes within organisms, but its scope has expanded rapidly to include the manipulation of entire cell lines. This ability to edit cell lines using CRISPR technology has unlocked a myriad of possibilities.

For many years researchers and drug developers have used immortalised cell lines (derived from humans but engineered to have stable properties over many divisions) to aid their work. These cell lines typically have the gene and/or protein target of interest expressed within them. CRISPR methodology has allowed quicker and more optimal manipulation of these cell lines.

As of now, CRISPR cell line technology is being used extensively for medical and agricultural applications. In medicine, researchers are employing CRISPR to engineer cell lines for therapeutic purposes, intending to treat diseases at the genetic level. For instance, CRISPR has been used to edit the genes of immune cells, enabling them to better target and eliminate cancer cells.

The Future Landscape

Looking ahead, the future of CRISPR cell line technology holds even more transformative possibilities. One of the key areas of exploration is regenerative medicine, where researchers aim to harness CRISPR to engineer cells for tissue repair and organ regeneration. The ability to precisely edit and manipulate cell lines could open new avenues for treating degenerative diseases and injuries, potentially revolutionising the field of transplantation.

The ability to precisely edit and manipulate cell lines could open new avenues for treating degenerative diseases and injuries, potentially revolutionising the field of transplantation

CRISPR technology is further poised to play a crucial role in the development of novel therapies for genetic disorders. The ability to edit problematic genes could pave the way for more effective treatments and even cures for conditions that were once considered incurable, such as Alzheimers.

Despite the remarkable progress in CRISPR technology, challenges and roadblocks still need to be addressed. Off-target effects, unintended mutations, and the potential for unpredictable consequences remain significant hurdles in developing and applying CRISPR-based therapies. Researchers are actively working to enhance the precision and safety of CRISPR technology to mitigate these risks.

CRISPR-engineered cell lines

One way to use CRISPR engineering to generate cell lines, which Promega is successfully offering, is to incorporate HiBiT technology. This 11 amino acid peptide can be fused to a target protein and serves as a luminescent tag. HiBiT can be integrated by knocking in the tag to the endogenous locus of the target using CRISPR gene editing, to help create a truer picture of protein behaviour and regulation in their natural cellular environment. HiBiT has a dynamic range spanning nine logs, which allows for the detection of extremely small quantities of tagged proteins.

In terms of applications, HiBiT's versatility is unmatched, as quantitative assays can be performed in both endpoint and live-cell formats, without the need for target-specific antibodies. From measuring target protein abundance to studying targeted protein degradation, protein secretion and receptor recycling, HiBiT opens up a myriad of possibilities in biomedical research. Its role in drug discovery is particularly noteworthy, enabling more precise and efficient screening of drug effects on cellular proteins.

The accessibility and affordability of CRISPR technology also need to be addressed to ensure that its benefits are not confined to a privileged few. Wide-scale adoption and integration of CRISPR cell line technology into various sectors will require collaborative efforts from researchers, policymakers, and the private sector. To aid in this endeavour, Promega now offers a comprehensive selection of pre-built CRISPR-edited cell line pools and clones, including HiBiT fusions.

Wide-scale adoption and integration of CRISPR cell line technology into various sectors will require collaborative efforts from researchers, policymakers, and the private sector

This development opens doors for researchers and developers as it reduces the costs involved in developing cell lines from scratch. Not only will this save budgets, but it also saves time. This means drug development times can be reduced by as much as 12 months, leading to vital medications being available much sooner.

The future of CRISPR cell line technology is undoubtedly exciting and promises transformative advancements in medicine, agriculture, and beyond. As scientists continue to unravel the mysteries of genetic engineering, there is a delicate balance between innovation and ethical stewardship to consider. But with efforts to maximise the technologys potential to make it more accessible and affordable, the future is bright.

Philip Hargreaves Ph.D, is director of strategic marketing & business development at Promega

Pic: Brano

More here:
The evolution of CRISPR cell line technology - Lab News

ZUG, Switzerland and BOSTON, April 22, 2024 (GLOBE NEWSWIRE) -- CRISPR Therapeutics(Nasdaq: CRSP), a biopharmaceutical company focused on creating transformative gene-based medicines for serious diseases, today announced an oral presentation highlighting the Company's lipid nanoparticle (LNP) approach for ocular editing will be presented at the American Society of Gene & Cell Therapy (ASGCT) 2024 Annual Meeting, taking place May 7 11, 2024, in Baltimore, MD and virtually.

The abstract describes our proprietary capabilities to deliver to and edit genes in the eye, opening a potential new focus area. Multiple LNPs as well as modified gRNAs and mRNAs were screened to achieve maximal editing in vivo. These optimized components have been applied to target myocilin (MYOC). Mutations of MYOC in trabecular meshwork cells have been linked to severe glaucomatous conditions. In human primary trabecular meshwork cells, up to 95% MYOC editing and 85% protein knockdown were seen. This novel approach aims to facilitate glaucoma treatment using transient expression of editing machinery targeting MYOC.

Title: Development of an In Vivo Non-Viral Ocular Editing Platform and Application to Potential Treatments for Glaucoma Session Type: In-Person Oral Presentation Session Title: Ophthalmic and Auditory: Delivery Innovations Abstract Number:87 Location: Room 318 323 Session Date and Time: Wednesday, May 8, 2024, 1:30 p.m. 3:15 p.m. ET

The accepted abstract is available online on the ASGCT website. The data are embargoed until 6:00 a.m. ET on the presentation day, Wednesday May 8, 2024. A copy of the presentation will be available at http://www.crisprtx.com once the presentation concludes.

About CRISPR Therapeutics Since its inception over a decade ago, CRISPR Therapeutics has transformed from a research-stage company advancing programs in the field of gene editing, to a company that recently celebrated the historic approval of the first-ever CRISPR-based therapy and has a diverse portfolio of product candidates across a broad range of disease areas including hemoglobinopathies, oncology, regenerative medicine, cardiovascular, autoimmune, and rare diseases. CRISPR Therapeutics advanced the first-ever CRISPR/Cas9 gene-edited therapy into the clinic in 2018 to investigate the treatment of sickle cell disease or transfusion-dependent beta thalassemia, and beginning in late 2023, CASGEVY (exagamglogene autotemcel) was approved in some countries to treat eligible patients with either of those conditions. The Nobel Prize-winning CRISPR science has revolutionized biomedical research and represents a powerful, clinically validated approach with the potential to create a new class of potentially transformative medicines. To accelerate and expand its efforts, CRISPR Therapeutics has established strategic partnerships with leading companies including Bayer and Vertex Pharmaceuticals. CRISPR Therapeutics AG is headquartered in Zug, Switzerland, with its wholly-owned U.S. subsidiary, CRISPR Therapeutics, Inc., and R&D operations based in Boston, Massachusetts and San Francisco, California, and business offices in London, United Kingdom. To learn more, visit http://www.crisprtx.com.

CRISPR Therapeutics Forward-Looking StatementThis press release may contain a number of forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995, as amended, including statements regarding CRISPR Therapeutics expectations about any or all of the following: (i) its ongoing and/or planned preclinical studies, clinical trials and pipeline products and programs, including, without limitation, the status of such studies and trials, potential expansion into new indications and expectations regarding data generally (including expected timing of data releases) as well as the data in the above-described abstract and any associated poster and the data that is being presented as described above; (ii) the safety, efficacy and clinical progress of its various clinical and preclinical programs including the program described in the oral presentation and poster; (iii) the data that will be generated by ongoing and planned preclinical studies and/or clinical trials, and the ability to use that data for the design and initiation of further preclinical studies and/or clinical trials; and (iv) the therapeutic value, development, and commercial potential of CRISPR/Cas9 gene editing technologies and therapies. Without limiting the foregoing, the words believes, anticipates, plans, expects and similar expressions are intended to identify forward-looking statements. You are cautioned that forward-looking statements are inherently uncertain. AlthoughCRISPR Therapeuticsbelieves that such statements are based on reasonable assumptions within the bounds of its knowledge of its business and operations, forward-looking statements are neither promises nor guarantees and they are necessarily subject to a high degree of uncertainty and risk. Actual performance and results may differ materially from those projected or suggested in the forward-looking statements due to various risks and uncertainties. These risks and uncertainties include, among others: the efficacy and safety results from ongoing pre-clinical studies and/or clinical trials will not continue or be repeated in ongoing or planned pre-clinical studies and/or clinical trials or may not support regulatory submissions;pre-clinical study and/or clinical trial results may not be favorable or support further development; one or more of its product candidate programs will not proceed as planned for technical, scientific or commercial reasons; future competitive or other market factors may adversely affect the commercial potential for its product candidates; uncertainties inherent in the initiation and completion of preclinical studies for its product candidates and whether results from such studies will be predictive of future results of future studies or clinical trials; uncertainties about regulatory approvals to conduct trials or to market products; uncertainties regarding the intellectual property protection for its technology and intellectual property belonging to third parties, and the outcome of proceedings (such as an interference, an opposition or a similar proceeding) involving all or any portion of such intellectual property; and those risks and uncertainties described under the heading "Risk Factors" in CRISPR Therapeutics most recent annual report on Form 10-K and in any other subsequent filings made byCRISPR Therapeuticswith theU.S. Securities and Exchange Commission, which are available on theSEC'swebsite atwww.sec.gov.CRISPR Therapeuticsdisclaims any obligation or undertaking to update or revise any forward-looking statements contained in this press release, other than to the extent required by law.

Investor Contact: Susan Kim +1-617-307-7503 susan.kim@crisprtx.com

Media Contact: Rachel Eides +1-617-315-4493 rachel.eides@crisprtx.com

Read the original:
CRISPR Therapeutics to Present Oral Presentation at the American Society of Gene & Cell Therapy (ASGCT) 2024 ... - GlobeNewswire

SNIPR Biome

SNIPR Biome receives funding from CARB-X to support advancement of CRISPR-medicine SNIPR001 into clinical trials in haematological cancer patients

Phase 1b/2a trial will evaluate SNIPR001 for the prevention of E.coli infections in patients undergoing hematopoietic stem cell transplantation

Copenhagen, April 22 2024: SNIPR Biome ApS (SNIPR), the company pioneering the development of precision medicines using CRISPR technology for microbial gene therapy, announces today that it has received $5.48 million from Combating Antibiotic-Resistant Bacteria Biopharmaceutical Accelerator (CARB-X) to co-fund a Phase 1b/2a clinical trial in hematological cancer patients.

The trial will evaluate SNIPR001, the first CRISPR-armed phage therapeutic that specifically targets E. coli in the gut, for the prevention of E. coli bloodstream infections in hematological cancer patients who are undergoing hematopoietic stem-cell transplantation (HSCT) and are colonized with Fluoroquinolone Resistant (FQR) E. coli. Fluoroquinolone is recommended in the US for prophylaxis of bacterial infections and febrile neutropenia in hematological cancer patients at high risk of neutropenia.

Despite the significant advances in hematologic cancer therapy over the past decade, infectious complications, and antimicrobial resistance (AMR) continue to pose significant threats to patients and clinical outcomes1. Currently, there are no approved therapies for the prevention of bloodstream infections (BSIs) in hematological cancer patients. SNIPR Biome is developing SNIPR001 to address this urgent unmet need to combat infections in hematological cancer patients.

Preclinical data published in Nature Biotechnology described SNIPR001s ability to selectively target and remove antibiotic-resistant E. coli strains in the gut, potentially offering a safe treatment which preserves the rest of the gut microbiome. This was supported by interim Phase 1 data published in 2023, which showed that oral dosing of SNIPR001 over seven days across three dosing levels in 24 healthy individuals was well tolerated. Furthermore, SNIPR001 could be recovered in faeces from treated individuals in a dose-dependent manner, and treatment with SNIPR001 numerically lowered gut E. coli levels.

Anticipated to begin later this year, the randomized, double-blinded Phase 1b/2a trial will investigate the safety, tolerability, pharmacokinetics, and pharmacodynamics of orally administrated SNIPR001 in 24 patients. It will be conducted at up to 10 sites across Europe and the United States.

CARB-X, a global non-profit partnership dedicated to supporting early-stage antibacterial research and development to address the rising threat of drug-resistant bacteria, has been a long-term collaborator with SNIPR in this field. The funding announced today enables SNIPR to move SNIPR001 into Phase 1b/2a clinical trials and will serve as a cornerstone for a further significant fundraise to enable the Company to continue development of its pipeline of CRISPR-based AMR and gut-directed gene therapies.

Story continues

Dr Christian Grndahl, Co-founder and CEO of SNIPR Biome, commented: Antibiotic resistance is one of healthcares biggest problems today, affecting treatment efficacy and survival among patients who are often already very sick. We are using our knowledge of gene editing and synthetic biology to create highly specific, designer bacteria and phage to disrupt, edit or add genes, and deliver these precision medicines in a carefully targeted way. We are pleased to be continuing our partnership with CARB-X who share our commitment to developing therapies for vulnerable patients.

Erin Duffy PhD, Chief of Research & Development, CARB-X, said: Having underscored safety for SNIPR001 in healthy subjects, SNIPR Biome is now focusing on demonstrating proof-of-mechanism for this novel product, with our support.We are keen to establish a link between gut decolonization and prevention of infection as a novel approach to antimicrobial resistance, and SNIPR001 offers the possibility of doing so.

CARB-X funding for this research is supported by the Biomedical Advanced Research and Development Authority under agreement number: 75A50122C00028, and by awards from Wellcome (WT224842), and Germanys Federal Ministry of Education and Research (BMBF). The content of this press release is solely the responsibility of the authors and does not necessarily represent the official views of CARB-X or any of its funders.

Ends

About SNIPR001 SNIPR001, a CRISPR-armed phage therapeutic that specifically targets E. coli in the gut, is designed to prevent infections from spreading into the bloodstream and represents a promising advancement against antibiotic-resistant pathogens. The pre-clinical studies of SNIPR001 published in Nature Biotechnology2 demonstrated the products activity against multi-drug resistant strains of E. coli and its specificity towards E. coli with no off-target effects toward any of the tested non-E. coli strains. SNIPR successfully completed a Phase 1 trial in the US, also funded by CARB-X, demonstrating safety of SNIPR001 and target engagement with E. coli in the gut of healthy subjects without disturbing the overall gut microbiome (NCT05277350), supporting its potential as a safe and effective preventative therapy for bloodstream infections in hematological cancer patients. SNIPR001 has been granted a Fast-Track designation for the indication Prophylaxis of bloodstream E. coli infections in patients with hematological malignancy at risk of neutropenia from the US Food and Drug Administration (FDA). SNIPR001 is also being developed to directly treat active E. coli infections.

About SNIPR BIOME SNIPR Biome is a Danish clinical-stage biotech company pioneering the development of precision medicines using CRISPR technology for microbial gene therapy. We are pioneering a novel use of CRISPR/Cas technology to better treat and prevent human diseases through precision killing of bacteria or gene modification. SNIPR Biome was the first company to orally dose humans with a CRISPR therapeutic and the first company to have been granted US and European patents for the use of CRISPR for targeting microbiomes. SNIPR technology is used in collaborations with Novo Nordisk A/S, CARB-X, SPRIN-D, and MD Anderson Cancer Center. For more information, visit http://www.sniprbiome.com and follow us on LinkedIn and X.

About CARB-X

CARB-X (Combating Antibiotic-Resistant Bacteria Biopharmaceutical Accelerator) is a global non-profit partnership dedicated to supporting early-stage antibacterial research and development to address the rising threat of drug-resistant bacteria. CARB-X supports innovative therapeutics, preventatives and rapid diagnostics. CARB-X is led by Boston University and funded by a consortium of governments and foundations. CARB-X funds only projects that target drug-resistant bacteria highlighted on the CDCs Antibiotic Resistant Threats list, or the Priority Bacterial Pathogens list published by the WHO, with a priority on those pathogens deemed Serious or Urgent on the CDC list or Critical or High on the WHO list. https://carb-x.org/ | X (formerly Twitter) @CARB_X

Contact ICR Consilium Tracy Cheung, Chris Welsh, Davide Salvi SNIPR@consilium-comms.com

SNIPR Biome Dr Christian Grndahl, Co-founder and CEO contact@sniprbiome.com http://www.sniprbiome.com

1 So M. Determining the Optimal Use of Antibiotics in Hematopoietic Stem Cell Transplant Recipients. JAMA Netw Open. 2023 Jun 1;6(6):e2317101 2 Gencay, Y.E., Jasinskyt, D., Robert, C. et al. Engineered phage with antibacterial CRISPRCas selectively reduce E. coli burden in mice. Nat Biotechnol (2023). https://doi.org/10.1038/s41587-023-01759-y

Read more here:
SNIPR Biome receives funding from CARB-X to support advancement of CRISPR-medicine SNIPR001 into clinical ... - Yahoo Finance

Crispr Therapeutics AG (NASDAQ:CRSP)is 2.8% lower at $56.35 this afternoon, continuing a pullback from a Feb. 22, more than two-year high of $91.10. Over the last month, CRSP has erased 20.8% and now sports a 9.6% year-to-date deficit.

For those looking to buy in on the dip, however, the recent pullback puts Crispr Therapeutics stock within one standard deviation of its 320-day moving average, a trendline with historically bullish implications. According to Schaeffer's Senior Quantitative Analyst Rocky White, the equity saw two similar signals in the past three years, after which it was higher one month later each time, averaging an impressive 13.3% gain. A move of similar magnitude would put the shares at roughly $63.85.

Crispr Therapeutics stock's 14-day relative strength index (RSI) of 18.2 is deep in "oversold" territory, which is typically indicative of a short-term bounce. Plus, short interest represents 17.6% of the stock's available float, and would take eight days to cover at CRSP's average pace of trading.

Plus, itsSchaeffer's Volatility Scorecard(SVS) stands at a high 86 out of 100, indicating the stock exceededoptiontraders' volatility expectations in the past 12 month -- a boon for premium buyers.

Read more from the original source:
Bullish Trendline Has Never Failed Crispr Therapeutics Stock - Yahoo Finance

A formidable collaboration between three University of California (UC) schools and leading global life sciences and diagnostics innovator the Danaher Corporation heralds a new era in the fight against rare and deadly genetic diseases, such as sickle cell disease which predominantly impacts Black and Hispanic populations in the U.S. through the innovative use of CRISPR technology.

Spearheaded by the Innovative Genomics Institute (IGI), this joint effort brings together genetics researchers and clinician experts from UC San Francisco, UC Los Angeles, UC Berkeley, and other research institutions, to expedite the development of curative therapies for diseases that have previously lacked effective treatments.

The Danaher-IGI Beacon for CRISPR Cures center will leverage genome editing technology to research a wide range of genetic disorders. The center, which will be led out of the IGI headquarters at UC Berkeley, combines expertise in genetics research, clinical practice, and industry resources to accelerate the development and deployment of CRISPR-based treatments. The goal is to establish new standards for safety and efficacy while streamlining the path from preclinical research to clinical trials.

The unique nature of CRISPR makes it ideal for developing and deploying a platform capability for CRISPR cures on demand, said Fyodor Urnov, PhD, IGIs Director of Technology and Translation, in a press release. Danaher and the IGI are in a unique position to potentially create a first-of-its-kind CRISPR cures cookbook that could be used by any team wishing to take on other diseases.

The centers initial focus will be on hemophagocytic lymphohistiocytosis (HLH) and Artemis-deficient severe combined immunodeficiency (ART-SCID), two conditions characterized by defects in a patients immune system. Traditional treatments for these disorders, such as bone marrow transplants, often fall short due to complications.

By targeting specific gene mutations associated with these diseases, researchers hope to develop therapies that address their underlying causes, improve outcomes, and enhance quality of life for those affected.

Using CRISPR, the IGI has already made incredible advancements in treating sickle cell disease through clinical trials at the Comprehensive Sickle Cell Center at UC San Francisco Benioff Childrens Hospital in Oakland which was established to address racial biases in health care. In 2021, the center received $17 million in funding to advance the use of CRISPR in sickle cell research.

This therapy has the potential to transform sickle cell disease care, said Mark Walters, MD, a pediatric professor at UC San Francisco and principal investigator of the clinical trials. If this is successfully applied in young patients, it has the potential to prevent irreversible complications of the disease.

Since then, researchers have been testing the possibility of replacing the gene that causes sickle cell with a healthy one manufactured using a patients own stem cells. Early tests have been positive, indicating a potential cure for the disease.

With CRISPR, we can speed up the development of improved therapies that can reach all the patients who need them, said Jennifer Puck, MD, a faculty member at the Jeffrey Modell Diagnostic Center for Primary Immunodeficiencies and Institute for Human Genetics, both at UC San Francisco. All patients deserve a sense of urgency. including those with rare diseases, many of whom are children.

Read the original here:
CRISPR Center Advances Genetic Disease Research - INSIGHT Into Diversity

Researchers have engineered a Cas enzyme to enhance activity against RNA viruses, resulting in a system that completely blocked the replication of various SARS-CoV-2 strains.

The research, details of which were published in Cell Discovery, was prompted by the need to overcome a barrier to the use of the Cas13d enzyme as an antiviral against human RNA viruses. Studies have shown that CRISPR/Cas13 systems are programmable tools for manipulating RNAs and Cas13d is the most active subtype of the enzyme in mammalian cells, making it the most promising antiviral candidate.

However, the activity of Cas13d is largely restricted to the nucleus. Most RNA viruses only replicate in the cytosol, where Cas13d is barely active in mammalian cells and as such are protected from the antiviral effects enabled by the enzyme, wrote the study's authors, led by Christoph Gruber of the Technical University of Munich (Cell Discov, April 12, 2024, Vol. 10 [1], pp. 1-4).

The problem led Gruber and other scientists from Helmholtz Munich and the Technical University of Munich to investigate why Cas13d is largely restricted to the nucleus and explore ways to bring the enzyme into contact with replicating RNA viruses in mammalian cells.

The research revealed that the enzyme has little activity in the cytosol because the RNA that guides the CRISPR-Cas complex to specific target sequences is found in the nucleus. That finding led the scientists to explore ways to move CRISPR RNAs (crRNAs) from the nucleus to the cytosol.

Through screening and optimization of various designs of shuttling proteins, the researchers developed a system that transfers nuclear crRNAs into the cytosol. The enzyme -- nucleocytoplasmic shuttling Cas13d or Cas13d-NCS for short -- moves nuclear crRNAs to the cytosol, where the protein/crRNA complex binds and degrades complementary target RNAs.

The researchers hypothesized that Cas13d-NCS more adeptly degrades viral cytosolic RNAs than standard Cas13d and tested that idea using a self-replicating RNA from the Venezuelan equine encephalitis RNA virus. The tests showed the engineered approach "targets solely cytosolic RNA with greater efficiency compared to the current Cas13d system," the authors wrote.

To assess antiviral efficacy, the scientists targeted SARS-CoV-2, the RNA virus that causes COVID-19. The assessment showed Cas13d-NCS can completely block the replication of various SARS-CoV-2 strains, they wrote.

"Targeting conserved but weakly expressed viral-coding sequences resulted in relatively weak inhibition, whereas targeting the ubiquitous 3'UTR with a single crRNA resulted in complete inhibition of viral replication," Gruber et al concluded.

View post:
Engineered Cas clears barrier to antiviral CRISPR therapies - LabPulse

Dunn GP, Old LJ, Schreiber RD. The immunobiology of cancer immunosurveillance and immunoediting. Immunity. 2004;21:13748.

Article CAS PubMed Google Scholar

Waldman AD, Fritz JM, Lenardo MJ. A guide to cancer immunotherapy: from T cell basic science to clinical practice. Nat Rev Immunol. 2020;20:118.

Article Google Scholar

Baulu E, Gardet C, Chuvin N, Depil S. TCR-engineered T cell therapy in solid tumors: state of the art and perspectives. Sci Adv. 2023;9:eadf3700.

Article CAS PubMed PubMed Central Google Scholar

Lemoine J, Ruella M, Houot R. Born to survive: how cancer cells resist CAR T cell therapy. J Hematol Oncol. 2021;14:199.

Article PubMed PubMed Central Google Scholar

Rodrigo S, Senasinghe K, Quazi S. Molecular and therapeutic effect of CRISPR in treating cancer. Med Oncol. 2023;40:81.

Article CAS PubMed PubMed Central Google Scholar

Tomasik J, Jasiski M, Basak GW. Next generations of CAR-T cells - new therapeutic opportunities in hematology? Front Immunol. 2022;13:1034707.

Article CAS PubMed PubMed Central Google Scholar

Zhu X, Li Q, Zhu X. Mechanisms of CAR T cell exhaustion and current counteraction strategies. Front Cell Dev Biol. 2022;10:1034257.

Article PubMed PubMed Central Google Scholar

Ren P, Zhang C, Li W, Wang X, Liang A, Yang G, et al. CAR-T therapy in clinical practice: technical advances and current challenges. Adv Biol (Weinh). 2022;6:e2101262.

Article PubMed Google Scholar

Verma NK, Wong BHS, Poh ZS, Udayakumar A, Verma R, Goh RKJ, et al. Obstacles for T-lymphocytes in the tumour microenvironment: therapeutic challenges, advances and opportunities beyond immune checkpoint. EBioMedicine. 2022;83:104216.

Article CAS PubMed PubMed Central Google Scholar

Young RM, Engel NW, Uslu U, Wellhausen N, June CH. Next-Generation CAR T-cell therapies. Cancer Discov. 2022;12:162533.

Article CAS PubMed PubMed Central Google Scholar

Shen C, Zhang Z, Zhang Y. Chimeric antigen receptor T cell exhaustion during treatment for hematological malignancies. Biomed Res Int. 2020;2020:8765028.

Article PubMed PubMed Central Google Scholar

McLane LM, Abdel-Hakeem MS, Wherry EJ. CD8 T cell exhaustion during chronic viral infection and cancer. Annu Rev Immunol. 2019;37:45795.

Article CAS PubMed Google Scholar

Anderson KG, Stromnes IM, Greenberg PD. Obstacles posed by the tumor microenvironment to T cell activity: a case for synergistic therapies. Cancer Cell. 2017;31:31125.

Article CAS PubMed PubMed Central Google Scholar

Cheng H, Ma K, Zhang L, Li G. The tumor microenvironment shapes the molecular characteristics of exhausted CD8+ T cells. Cancer Lett. 2021;506:5566.

Article CAS PubMed Google Scholar

Gumber D, Wang LD. Improving CAR-T immunotherapy: overcoming the challenges of T cell exhaustion. EBioMedicine. 2022;77:103941.

Article CAS PubMed PubMed Central Google Scholar

Bucks CM, Norton JA, Boesteanu AC, Mueller YM, Katsikis PD. Chronic antigen stimulation alone Is sufficient to drive CD8+ T cell exhaustion. J Immunol. 2009;182:6697708.

Article CAS PubMed Google Scholar

Yin Z, Bai L, Li W, Zeng T, Tian H, Cui J. Targeting T cell metabolism in the tumor microenvironment: an anti-cancer therapeutic strategy. J Exp Clin Cancer Res. 2019;38:403.

Article PubMed PubMed Central Google Scholar

Bader JE, Voss K, Rathmell JC. Targeting metabolism to improve the tumor microenvironment for cancer immunotherapy. Mol Cell. 2020;78:101933.

Article CAS PubMed PubMed Central Google Scholar

Peng HY, Lucavs J, Ballard D, Das JK, Kumar A, Wang L, et al. Metabolic reprogramming and reactive oxygen species in T cell immunity. Front Immunol. 2021;12:652687.

Article CAS PubMed PubMed Central Google Scholar

Watson MJ, Delgoffe GM. Fighting in a wasteland: deleterious metabolites and antitumor immunity. J Clin Invest. 2022;132:e148549.

Article CAS PubMed PubMed Central Google Scholar

Zhang Z, Liu S, Zhang B, Qiao L, Zhang Y, Zhang Y. T Cell dysfunction and exhaustion in cancer. Front Cell Dev Biol. 2020. https://doi.org/10.3389/fcell.2020.00017.

Wang S, Wu J, Shen H, Wang J. The prognostic value of IDO expression in solid tumors: a systematic review and meta-analysis. BMC Cancer. 2020;20:471.

Article CAS PubMed PubMed Central Google Scholar

Allard B, Longhi MS, Robson SC, Stagg J. The ectonucleotidases CD39 and CD73: novel checkpoint inhibitor targets. Immunol Rev. 2017;276:12144.

Article CAS PubMed PubMed Central Google Scholar

Fang L, Liu K, Liu C, Wang X, Ma W, Xu W, et al. Tumor accomplice: T cell exhaustion induced by chronic inflammation. Front Immunol. 2022;13:979116.

Article CAS PubMed PubMed Central Google Scholar

Soriano-Baguet L, Brenner D. Metabolism and epigenetics at the heart of T cell function. Trends Immunol. 2023;44:23144.

Article CAS PubMed Google Scholar

Wherry EJ. T cell exhaustion. Nat Immunol. 2011;12:4929.

Article CAS PubMed Google Scholar

Blank CU, Haining WN, Held W, Hogan PG, Kallies A, Lugli E, et al. Defining T cell exhaustion . Nat Rev Immunol. 2019;19:66574.

Article CAS PubMed PubMed Central Google Scholar

Catakovic K, Klieser E, Neureiter D, Geisberger R. T cell exhaustion: from pathophysiological basics to tumor immunotherapy. Cell Commun Signal. 2017;15:1.

Article PubMed PubMed Central Google Scholar

Fuertes Marraco SA, Neubert NJ, Verdeil G, Speiser DE. Inhibitory receptors beyond T Cell Exhaustion. Front Immunol. 2015;6:310.

Article PubMed PubMed Central Google Scholar

Huang Y, Si X, Shao M, Teng X, Xiao G, Huang H. Rewiring mitochondrial metabolism to counteract exhaustion of CAR-T cells. J Hematol Oncol. 2022;15:38.

Article CAS PubMed PubMed Central Google Scholar

Pereira RM, Hogan PG, Rao A, Martinez GJ. Transcriptional and epigenetic regulation of T cell hyporesponsiveness. J Leukoc Biol. 2017;102:60115.

Article CAS PubMed PubMed Central Google Scholar

Seo H, Chen J, Gonzlez-Avalos E, Samaniego-Castruita D, Das A, Wang YH, et al. TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8+ T cell exhaustion. Proc Natl Acad Sci USA. 2019;116:124105.

Article CAS PubMed PubMed Central Google Scholar

Chi X, Luo S, Ye P, Hwang WL, Cha JH, Yan X, et al. T-cell exhaustion and stemness in antitumor immunity: characteristics, mechanisms, and implications. Front Immunol. 2023;14:1104771.

Article CAS PubMed PubMed Central Google Scholar

Fujiwara Y, Kato T, Hasegawa F, Sunahara M, Tsurumaki Y. The past, present, and future of clinically applied chimeric antigen receptor-T-cell therapy. Pharm (Basel). 2022;15:207.

CAS Google Scholar

Watanabe N, Mo F, McKenna MK. Impact of manufacturing procedures on CAR T cell functionality. Front Immunol. 2022;13:876339.

Article CAS PubMed PubMed Central Google Scholar

Zhang Y, Xu Y, Dang X, Zhu Z, Qian W, Liang A, et al. Challenges and optimal strategies of CAR T therapy for hematological malignancies. Chin Med J (Engl). 2023;136:26979.

Article CAS PubMed Google Scholar

Zhou Z, Tao C, Li J, Tang JCO, Chan ASC, Zhou Y. Chimeric antigen receptor T cells applied to solid tumors. Front Immunol. 2022;13:984864.

Article CAS PubMed PubMed Central Google Scholar

Chow A, Perica K, Klebanoff CA, Wolchok JD. Clinical implications of T cell exhaustion for cancer immunotherapy. Nat Rev Clin Oncol. 2022;19:77590.

Article PubMed PubMed Central Google Scholar

Hosseinkhani N, Derakhshani A, Kooshkaki O, Abdoli Shadbad M, Hajiasgharzadeh K, Baghbanzadeh A, et al. Immune checkpoints and CAR-T cells: the pioneers in future cancer therapies? Int J Mol Sci. 2020;21:8305.

Article CAS PubMed PubMed Central Google Scholar

Mirzaei HR, Pourghadamyari H, Rahmati M, Mohammadi A, Nahand JS, Rezaei A, et al. Gene-knocked out chimeric antigen receptor (CAR) T cells: Tuning up for the next generation cancer immunotherapy. Cancer Lett. 2018;423:95104.

Article CAS PubMed Google Scholar

Gonzlez Castro N, Bjelic J, Malhotra G, Huang C, Alsaffar SH. Comparison of the feasibility, efficiency, and safety of genome editing technologies. Int J Mol Sci. 2021;22:10355.

Article PubMed PubMed Central Google Scholar

Gonzlez-Romero E, Martnez-Valiente C, Garca-Ruiz C, Vzquez-Manrique RP, Cervera J, Sanjuan-Pla A. CRISPR to fix bad blood: a new tool in basic and clinical hematology. Haematologica. 2019;104:88193.

Article PubMed PubMed Central Google Scholar

Gilles AF, Averof M. Functional genetics for all: engineered nucleases, CRISPR and the gene editing revolution. EvoDevo 2014;5:43.

Article PubMed PubMed Central Google Scholar

Hirakawa MP, Krishnakumar R, Timlin JA, Carney JP, Butler KS. Gene editing and CRISPR in the clinic: current and future perspectives. Biosci Rep. 2020;40:BSR20200127.

Article CAS PubMed PubMed Central Google Scholar

Khan A, Sarkar E. CRISPR/Cas9 encouraged CAR-T cell immunotherapy reporting efficient and safe clinical results towards cancer. Cancer Treat Res Commun. 2022;33:100641.

Article PubMed Google Scholar

Stadtmauer EA, Fraietta JA, Davis MM, Cohen AD, Weber KL, Lancaster E, et al. CRISPR-engineered T cells in patients with refractory cancer. Science. 2020;367:7365.

Article Google Scholar

Lu Y, Xue J, Deng T, Zhou X, Yu K, Deng L, et al. Safety and feasibility of CRISPR-edited T cells in patients with refractory non-small-cell lung cancer. Nat Med. 2020;26:73240.

Article CAS PubMed Google Scholar

Nidhi S, Anand U, Oleksak P, Tripathi P, Lal JA, Thomas G, et al. Novel CRISPRCas systems: an updated review of the current achievements, applications, and future research perspectives. Int J Mol Sci 24 mars. 2021;22:3327.

Article CAS Google Scholar

Asmamaw M, Zawdie B. Mechanism and applications of CRISPR/Cas-9-mediated genome editing. Biologics. 2021;15:35361.

PubMed PubMed Central Google Scholar

Peng R, Lin G, Li J. Potential pitfalls of CRISPR/Cas9-mediated genome editing. FEBS J. 2016;283:121831.

Article CAS PubMed Google Scholar

Pickar-Oliver A, Gersbach CA. The next generation of CRISPRCas technologies and applications. Nat Rev Mol Cell Biol. 2019;20:490507.

Read the original here:
CRISPR-Cas gene knockouts to optimize engineered T cells for cancer immunotherapy | Cancer Gene Therapy - Nature.com

The discovery of Clustered Regularly Interspaced Short Palindromic Repeats (widely known as just CRISPR) has been revolutionary in many ways. For one, it has transformed disease research. Just recently, scientists revealed they could cut HIV out of cells using the gene-editing technology, and it also has the potential to completely change the way cancer is treated, too. But CRISPRs abilities dont end there. It could also change the way that food tastes (making healthier foods more appealing to children, for example), and even save the food system from the brutal impact of the climate crisis.

Right now, extreme weather events, including drought, heatwaves, and floods, threaten essential crops all over the world. In fact, one 2021 study from NASA suggested that the impact of global climate change could impact crops within the decade. Maize yields are a particular concern, as the research suggested they could drop by 24 percent. A 20 percent decrease from current production levels could have severe implications worldwide, Jonas Jgermeyr, crop modeler and climate scientist, said at the time.

But, by improving their resilience, CRISPR could help to save more crops from falling foul to extreme weather events, which, as the human-driven climate crisis intensifies, are only set to become more common over the coming years.

Pexels

CRISPR is, essentially, a revolutionary gene-editing technology. Adapted from a naturally occurring defense mechanism found in bacteria, the system enables scientists to make precise changes to the DNA of organisms. In 2020, Emmanuelle Charpentier and Jennifer Douda were awarded the Nobel Prize in Chemistry for pioneering CRISPR-Cas9. The technology is also known as genetic scissors, because of the way it can help researchers cut DNA.

The statement from The Nobel Prize at the time noted that, since 2012, when Charpentier and Doudna first discovered the CRISPR-Cas9 genetic scissors, it has contributed to many important discoveries in basic research, adding that as well as leading to major breakthroughs in curing inherited diseases, plant researchers have been able to develop crops that withstand mold, pests, and drought.

In terms of crops, CRISPR can help scientists change and insert DNA into plants to make them more resistant to harsher surroundings. It could help make them less vulnerable to extreme temperatures, for example, and even help increase crop yield to produce more food for more people.

Pexels

CRISPR is already helping scientists to overcome major challenges in the food system. In January 2024, for example, a paper published in Nature revealed that researchers in Kenya are working on making sorghuma staple food across many African countriesmore resilient to a parasitic weed, called Striga, using the gene-editing technology.

In Singapore, a company called Singrow launched the worlds first climate-resilient strawberry last year, which was also created with the help of CRISPR. In North Carolina, the scientists behind the food startup Pairwise are developing more nutritious crops, produce higher yields, and require fewer resources to grow with the technology. Earlier this year, the company was even acknowledged by Time Magazine as one of Americas Top Greentech Companies.

These companies are far from alone. According to the food innovation platform Forward Fooding, more than 50 companies around the world are currently using DNA technology to improve crops. It notes that since 2013, they have raised around 2.3 billion in funding.

CRISPR is not perfect. Its important to note that this technology is still new, and more research is needed into the long-term effects of gene-editing crops. But so far, the progress is promising.

As well as a move away from animal agriculture, which is widely considered by scientists to be depleting the earth of natural resources and driving up emissions, CRISPR could be one of the key factors in building a more sustainable, resilient, nutritious food system, which may also be able to feed more people than ever.

Charlotte is a writer and editor based in sunny Southsea on England's southern coast.

Original post:
Revolutionary CRISPR Technology Is Helping Make Crops More Resilient to the Climate Crisis - VegNews

Greater use of CRISPR-based therapies in clinical trials is expected to drive further advancements in precision medicine, GlobalData states.

There has been a notable rise in licensing agreements for innovator drugs incorporating clustered regularly interspaced short palindromic repeats (CRISPR)-based technology for gene therapies over the past five years, according to data and analytics firm GlobalData.

These agreements have amassed a total deal value of $21 billion. Of note, between 2020 to 2022, there was a remarkable surge in deal worth. For agreements relating to or involving treatments for haematological disorders, the total deal value reached $1.8 billion, the research found.

For instance, the approval of Casgevy in the US in December 2023 signified a breakthrough in gene therapy. Vertex Pharmaceuticals treatment was subsequently the first CRISPR/Cas9 gene-edited therapy to be granted a marketing authorisation by the European Commission (EC) in February 2024.

Innovator drugs harnessing CRISPR technologies saw 182 percent growth in total licensing agreement deal value from $5.6 billion in 2020 to $15.8 billion in 2022. Among the top three therapy areas, oncology represented over half of the total deal value with $11.9 billion, followed by immunology with $6.7 billion, and central nervous system with $2.2 billion, Ophelia Chan, Business Fundamentals Analyst at GlobalData explained.

GlobalData highlighted that the largest CRISPR-based deal of 2023 was Eli Lilys subsidiary, Prevail Therapeutics gaining rights to Scribe Therapeuticss CRISPR X-Editing (XE) technologies. In a deal potentially worth over $1.57 billion, the agreement seeks to advance in vivotherapies for targets that cause serious neurological and neuromuscular diseases.

The increasing presence of CRISPR-based therapies in clinical trials is anticipated to fuel further advancements in precision medicine

CRISPR technology is transforming targeted gene therapies for diverse unmet diseases by precisely targeting diverse genomic sites, promising tailored treatments and improved patient outcomes. The increasing presence of CRISPR-based therapies in clinical trials is anticipated to fuel further advancements in precision medicine, Chan stated.

In other recent gene therapy news, last month the US Food and Drug Administration (FDA) authorised Lenmeldy (atidarsagene autotemcel) for children with early-onset metachromatic leukodystrophy (MLD).

Anti-Cancer Therapeutics, Big Pharma, Biopharmaceuticals, business news, Clinical Development, Clinical Trials, Data Analysis, Drug Development, Drug Markets, Drug Safety, Gene therapy, Industry Insight, Research & Development (R&D), Technology, Therapeutics

Read more from the original source:
CRISPR technologies fuelling haematological innovations - European Pharmaceutical Review

Kelly Banas, Ph.D., principal investigator at ChristianaCares Gene Editing Institute, will present her latest research discovery related to targeting the NRF2 gene in cancer cells at the first CRISPR Medicine Conference held in Copenhagen, Denmark, April 22 to 25. The Gene Editing Institutes research has focused on the NRF2 gene and the strong immune response []

The post Kelly Banas, Ph.D., To Present Her Latest Discovery at CRISPR Medicines First International Conference appeared first on ChristianaCare News.

Gold Alert Issued for Two Missing Dover Children1 day ago

I-95 Drive to Save Lives Commences During National Distracted Driving Awareness Month April 20241 day ago

State Police Asking for Witnesses Following Fatal Pedestrian Hit-and-Run Crash in Newark1 day ago

State Police Investigating a Pedestrian Killed by a Train Near Newark1 day ago

Post Views: 270

Share this Post

View original post here:
Kelly Banas, Ph.D., To Present Her Latest Discovery at CRISPR Medicine's First International Conference - Milford LIVE

CRISPR technology offers the promise to cure human genetic diseases with gene editing. This promise became a reality when the worlds first CRISPR therapy was approved by regulators to treat patients with sickle cell disease and beta-thalassemia last year.

American biopharma Vertex Pharmaceuticals CASGEVY works by turning on the BCL11A gene, which codes for fetal hemoglobin. While this form of hemoglobin is produced before a baby is born, the body begins to deactivate the gene after birth. As both sickle cell disease and beta-thalassemia are blood disorders that affect hemoglobin, by switching on the gene responsible for fetal hemoglobin production, CASGEVY presents a curative, one-time treatment for patients.

As CASGEVYs clearance is a significant milestone, the technology has come a long way. CRISPR/Cas9 was first used as a gene-editing tool in 2012. Over the years, the technology exploded in popularity thanks to its potential for making gene editing faster, cheaper, and easier than ever before.

CRISPR is short for clustered regularly interspaced short palindromic repeats. The term makes reference to a series of repetitive patterns found in the DNA of bacteria that form the basis of a primitive immune system, defending them from viral invaders by cutting their DNA.

Using this natural process as a basis, scientists developed a gene-editing tool called CRISPR/Cas that can cut a specific DNA sequence by simply providing it with an RNA template of the target sequence. This allows scientists to add, delete, or replace elements within the target DNA sequence. Slicing a specific part of a genes DNA sequence with the help of the Cas9 enzyme, aids in DNA repair.

This system represented a big leap from previous gene-editing technologies, which required designing and making a custom DNA-cutting enzyme for each target sequence rather than simply providing an RNA guide, which is much simpler to synthesize.

CRISPR gene editing has already changed the way scientists do research, allowing a wide range of applications across multiple fields. Here are some of the diseases that scientists aim to tackle using CRISPR/Cas technology, testing its possibilities and limits as a medical tool.

Cancer is a complex, multifactorial disease, and a cure remains elusive. There are hundreds of different types of cancer, each with a unique mutation signature. CRISPR technology is a game-changer for cancer research and treatment as it can be used for many things, including screening for cancer drivers, identifying genes and proteins that can be targeted by cancer drugs, cancer diagnostics, and as a treatment.

China spearheaded the first in-human clinical trials using CRISPR/Cas9 as a cancer treatment. The study tested the use of CRISPR to modify immune T cells extracted from a patient with late-stage lung cancer. The gene-editing technology was used to remove the gene that encodes for a protein called PD-1 that some tumor cells can bind to to block the immune response against cancer. This protein found on the surface of immune cells is the target of some cancer drugs termed checkpoint inhibitors.

CRISPR technology has also been applied to improve the efficacy and safety profiles of cancer immunotherapy, such as CAR-T cell and natural killer cell therapies. In the U.S., CRISPR Therapeutics is one of the leading companies in this space, developing off-the-shelf, gene-edited T cell therapies using CRISPR, with two candidates targeting CD19 and CD70 proteins in clinical trials.

In 2022, the FDA granted Orphan Drug designation to Intellia Therapeutics CRISPR/Cas9-gene-edited T cell therapy for acute myeloid leukemia (AML). Currently, Vor BioPharmas VOR33 is undergoing phase 2 trials to treat AML, and the CRISPR trial is one to watch, according to a report published by Clinical Trials Arena earlier this year.

However, CRISPR technology still has limitations, including variable efficiency in the genome-editing process and off-target effects. Some experts have recommended that the long-term safety of the approach remain under review. Others have suggested using more precise gene-editing approaches such as base editing, an offshoot of CRISPR that hit the clinic in the U.S. last year.

There are several ways CRISPR could help us in the fight against AIDS. One is using CRISPR to cut the viral DNA that the HIV virus inserts within the DNA of immune cells. This approach could be used to attack the virus in its hidden, inactive form, which is what makes it impossible for most therapies to completely get rid of the virus.

The first ever patient with HIV was dosed with a CRISPR-based gene-editing therapy in a phase 1/2 trial led by Excision Biotherapeutics and researchers at the Lewis Katz School of Medicine at Temple University in Philadelphia back in 2022.

The decision to move the therapy to the clinic was bolstered by the success of an analog of the drug EBT-101 called EBT-001 in rhesus macaques infected with simian immunodeficiency virus (SIV). In a phase 1/2 study, EBT-101 was found to be safe.

Another approach could make us resistant to HIV infections. A small percentage of the worlds population is born with a natural resistance to HIV, thanks to a mutation in a gene known as CCR5, which encodes for a protein on the surface of immune cells that HIV uses as an entry point to infect the cells. The mutation changes the structure of the protein so that the virus is no longer able to bind to it.

This approach was used in a highly controversial case in China in 2018, where human embryos were genetically edited to make them resistant to HIV infections. The experiment caused outrage among the scientific community, with some studies pointing out that the CRISPR babies might be at a higher risk of dying younger.

The general consensus seems to be that more research is needed before this approach can be used in humans, especially as recent studies have pointed out this practice can have a high risk of unintended genetic edits in embryos.

Cystic fibrosis is a genetic disease that causes severe respiratory problems. Cystic fibrosis can be caused by multiple different mutations in the target gene CFTR more than 700 of which have been identified making it difficult to develop a drug for each mutation. With CRISPR technology, mutations that cause cystic fibrosis can be individually edited.

In 2020, researchers in the Netherlands used base editing to repair CFTR mutations in vitro in the cells of people with cystic fibrosis without creating damage elsewhere in their genetic code. Moreover, aiming to strike again with yet another win is the duo Vertex Pharmaceuticals and CRISPR Therapeutics, which have collaborated to develop a CRISPR-based medicine for cystic fibrosis. However, it might be a while until it enters the clinic as it is currently in the research phase.

Duchenne muscular dystrophy is caused by mutations in the DMD gene, which encodes for a protein necessary for the contraction of muscles. Children born with this disease experience progressive muscle degeneration, and existing treatments are limited to a fraction of patients with the condition.

Research in mice has shown CRISPR technology could be used to fix the multiple genetic mutations behind the disease. In 2018, a group of researchers in the U.S. used CRISPR to cut at 12 strategic mutation hotspots covering the majority of the estimated 3,000 different mutations that cause this muscular disease. Following this study, Exonics Therapeutics was spun out to further develop this approach, which was then acquired by Vertex Pharmaceuticals for approximately $1 billion to accelerate drug development for the disorder. Currently, Vertex is in the research stage, and is on a mission to restore dystrophin protein expression by targeting mutations in the dystrophin gene.

However, a CRISPR trial run by the Boston non-profit Cure Rare Disease targeting a rare DMD mutation resulted in the death of a patient owing to toxicity back in November 2022. Further research is needed to ensure the safety of the drug to treat the disease.

Huntingtons disease is a neurodegenerative condition with a strong genetic component. The disease is caused by an abnormal repetition of a certain DNA sequence within the huntingtin gene. The higher the number of copies, the earlier the disease will manifest itself.

Treating Huntingtons can be tricky, as any off-target effects of CRISPR in the brain could have very dangerous consequences. To reduce the risk, scientists are looking at ways to tweak the genome-editing tool to make it safer.

In 2018, researchers at the Childrens Hospital of Philadelphia revealed a version of CRISPR/Cas9 that includes a self-destruct button. A group of Polish researchers opted instead for pairing CRISPR/Cas9 with an enzyme called nickase to make the gene editing more precise.

More recently, researchers at the University of Illinois Urbana-Champaign used CRISPR/Cas13, instead of Cas9, to target and cut mRNA that codes for the mutant proteins responsible for Huntingtons disease. This technique silences mutant genes while avoiding changes to the cells DNA, thereby minimizing permanent off-target mutations because RNA molecules are transient and degrade after a few hours.

In addition, a 2023 study published in Nature went on to prove that treatment of Huntingtons disease in mice delayed disease progression and that it protected certain neurons from cell death in the mice.

With CASGEVYs go-ahead to treat transfusion-dependent beta-thalassemia and sickle cell disease in patients aged 12 and older, this hints that CRISPR-based medicines could even be a curative therapy to treat other blood disorders like hemophilia.

Hemophilia is caused by mutations that impair the activity of proteins that are required for blood clotting. Although Intellia severed its partnership with multinational biopharma Regeneron to advance its CRISPR candidate for hemophilia B a drug that was recently cleared by the FDA to enter the clinic the latter will take the drug ahead on its own.

As hemophilia B is caused by mutations in the F9 gene, which encodes a clotting protein called factor IX (FIX), Regenerons drug candidate uses CRISPR/Cas9 gene editing to place a copy of the F9 gene in cells in order to get the taps running for FIX production.

The two biopharmas will continue their collaboration in developing their CRISPR candidate to treat hemophilia A, which manifests as excessive bleeding because of a deficit of factor VIII. The therapy is currently in the research phase.

While healthcare companies were creating polymerase chain reaction (PCR) tests to screen for COVID-19 in the wake of the pandemic, CRISPR was also being put to use for speedy screening. A study conducted by researchers in China in 2023, found that the CRISPR-SARS-CoV-2 test had a comparable performance with RT-PCR, but it did have several advantages like short assay time, low cost, and no requirement for expensive equipment, over RT-PCRs.

To add to that, the gene editing tool could fight COVID-19 and other viral infections.

For instance, scientists at Stanford University developed a method to program a version of the gene editing technology known as CRISPR/Cas13a to cut and destroy the genetic material of the virus behind COVID-19 to stop it from infecting lung cells. This approach, termed PAC-MAN, helped reduce the amount of virus in solution by more than 90 percent.

Another research group at the Georgia Institute of Technology used a similar approach to destroy the virus before it enters the cell. The method was tested in live animals, improving the symptoms of hamsters infected with COVID-19. The treatment also worked on mice infected with influenza, and the researchers believe it could be effective against 99 percent of all existing influenza strains.

As European, U.S., and U.K. regulators have given their stamp of approval for the first-ever CRISPR-based drug to treat patients, who is to say we wont see another CRISPR-drug hitting this milestone in the near future.

And apart from the diseases mentioned, CRISPR is also being studied to treat other conditions like vision and hearing loss. In blindness caused by mutations, CRISPR gene editing could eliminate mutated genes in the DNA and replace them with normal versions of the genes. Researchers have also demonstrated how getting rid of the mutations in the Atp2b2 and Tmc1 genes helped partially restore hearing.

However, one of the biggest challenges to turn CRISPR research into real cures is the many unknowns regarding the potential risks of CRISPR therapy. Some scientists are concerned about possible off-target effects as well as immune reactions to the gene-editing tool. But as research progresses, scientists are proposing and testing a wide range of approaches to tweak and improve CRISPR in order to increase its efficacy and safety.

Hopes are high that CRISPR technology will soon provide a way to address complex diseases such as cancer and AIDS, and even target genes associated with mental health disorders.

New technologies related to CRISPR research:

This article was originally published in June 2018, and has since been updated by Roohi Mariam Peter.

Read more here:
Seven diseases that CRISPR technology could cure - Labiotech.eu

ZUG, Switzerland and BOSTON, April 01, 2024 (GLOBE NEWSWIRE) -- CRISPR Therapeutics(Nasdaq: CRSP), a biopharmaceutical company focused on creating transformative gene-based medicines for serious diseases, today announced an oral presentation at the American Society of Gene & Cell Therapy (ASGCT) 2024 Annual Meeting, taking place May 7 11, 2024, in Baltimore, MD and virtually.

Title: Development of an In Vivo Non-Viral Ocular Editing Platform and Application to Potential Treatments for Glaucoma Session Type: In-Person Oral Presentation Session Title: Ophthalmic and Auditory: Delivery Innovations Abstract Number:87 Location: Room 318 323 Session Date and Time: Wednesday, May 8, 2024, 1:30 p.m. 3:15 p.m. ET

Abstracts will be released to the public on April 22, 2024, at 4:30 p.m. ET at https://annualmeeting.asgct.org/. The data are embargoed until 6:00 a.m. ET on the presentation day, Wednesday May 8, 2024. A copy of the presentation will be available at http://www.crisprtx.com once the presentation concludes.

About CRISPR Therapeutics Since its inception over a decade ago, CRISPR Therapeutics has transformed from a research-stage company advancing programs in the field of gene editing, to a company with a diverse portfolio of product candidates across a broad range of disease areas including hemoglobinopathies, oncology, regenerative medicine, cardiovascular and rare diseases. The Nobel Prize-winning CRISPR science has revolutionized biomedical research and represents a powerful, clinically validated approach with the potential to create a new class of potentially transformative medicines. To accelerate and expand its efforts, CRISPR Therapeutics has established strategic partnerships with leading companies including Bayer and Vertex Pharmaceuticals. CRISPR Therapeutics AG is headquartered in Zug, Switzerland, with its wholly-owned U.S. subsidiary, CRISPR Therapeutics, Inc., and R&D operations based in Boston, Massachusetts and San Francisco, California, and business offices in London, United Kingdom. To learn more, visit http://www.crisprtx.com.

Investor Contact: Susan Kim +1-617-307-7503 susan.kim@crisprtx.com

Media Contact: Rachel Eides +1-617-315-4493 rachel.eides@crisprtx.com

Read more:
CRISPR Therapeutics to Present at the American Society of Gene & Cell Therapy (ASGCT) 2024 Annual Meeting - GlobeNewswire

One of the most significant challenges in treating HIV is the virus ability to integrate its genome into the hosts DNA. This means that lifelong antiretroviral therapy is essential as latent HIV can reactivate from reservoirs as soon as treatment ends.

One potential technique being developed to address this problem is the use of gene editing technology to cut out and incapacitate HIV from infected cells. Currently, there is a Phase I/II Clinical Trial underway in people with HIV-1 (the most common strain of HIV)

Now, new research from another team shows that gene editing can be used to eliminate all traces of the HIV virus from infected cells in the laboratory.

The research is being presented early ahead of the European Congress of Clinical Microbiology and Infectious Diseases, which will be held from 27-30 April in Barcelona, Spain. Its been carried out by scientists from the Amsterdam Medical University in the Netherlands, and the Paul Ehrlich Institute in Germany, and has not yet been submitted for peer review.

Our aim is to develop a robust and safe combinatorial CRISPR-Cas regimen, striving for an inclusive HIV cure for all that can inactivate diverse HIV strains across various cellular contexts, they write in a conference abstract submitted ahead of ECCMID.

CRISPR-Cas gene editing technology acts like molecular scissors to cut DNA and either delete unwanted genes or introduce new genetic material, while guidance RNA (gRNA) tells CRISPR-Cas exactly where to cut at designated spots on the genome.

In this research, the authors used 2 gRNAs that target conserved parts of the viral genome this means they remain the same or conserved across all known HIV strains. This genetic sequence does not have a match in human genes, to prevent the system going off target and causing mutations elsewhere in the human genome.

The hope is to one day provide a broad-spectrum therapy capable of combating multiple HIV variants effectively. But before this dream can become a reality, the researchers had to address a number of issues with getting the CRISPR-Cas reagents into the right cells.

To delivered CRISPR components into cells in the body a viral vector, containing genes that code for the CRISPR-Cas proteins and gRNA, is used. This is the vehicle that delivers into the host cell the instructions to make all necessary components, but these instructions need to be kept as simple and short as possible.

Another issue is making sure the viral vector enters HIV reservoir cells specifically cells that express the receptors CD4+ and CD32a+ on their surface.

They found that in one system, saCas9, the vector size was minimised, which enhanced its delivery to HIV-infected cells. They also included proteins that target the CD4+ and CD32a+ receptors specifically in the vector.

This system showed outstanding antiviral performance, managing to completely inactivate HIV with a single guide RNA (gRNA) and excise (cut out) the viral DNA with two gRNAs in cells in the lab.

We have developed an efficient combinatorial CRISPR-attack on the HIV virus in various cells and the locations where it can be hidden in reservoirs and demonstrated that therapeutics can be specifically delivered to the cells of interest, the authors write.

These findings represent a pivotal advancement towards designing a cure strategy.

But the researchers stress that, while these preliminary findings are very encouraging, it is premature to declare that there is a functional HIV cure on the horizon.

See the original post:
How CRISPR-Cas genome editing could be used to cure HIV - Cosmos

CRISPR gene editing technology is beginning to deliver on a promise to quickly create crops with traits that withstand a changing climate, resist aggressive pests and reinvigorate healthy soils, according to experts at the South by Southwest event in Austin earlier this month.

Companies exploring CRISPR to make climate-friendly foods and medicines are enjoying some tailwinds:

At the same time, startups and researchers are taking on investment partnerships with larger organizations to commercialize CRISPR innovations. Bayer has a project with Pairwise to create a corn crop that is more resilient to environmental factors. In 2011, The Gates Foundation gave a $10.3 million grant to the International Rice Research Institute (IRRI) and has re-invested more than $16 million to the organization in 2023 to create climate resistant rice varieties.

The past 200 years of industrialized agriculture have increased yields and eased shipping with large, durable produce often to the detriment of the soil, the planet and taste.

"We think with gene editing you wont have to make that choice," said Tom Adams, CEO of Pairwise. The startup is producing the first CRISPR consumer product by editing out the wasabi-like spiciness of a mustard green to make it more palatable to eaters.

Pairwise sold the green at a New York grocer earlier this year and is seeking to partner with companies to sell to consumers. The companys main focus is developing business-to-business markets by selling ingredient crops or seeds to big agricultural companies or seed banks.

Traditionally, farmers mated or cross-pollinated organisms to augment their desired characteristics. It could take decades to cultivate a plant to the desired enhancement for human consumption.

In the 1970s, scientists began genetically modifying organisms (GMOs) by cultivating foreign DNA in a bacteria or virus and then inducing those cells to add their modified DNA into a plant or animal. The modified DNA would typically offer resistance to pests or diseases.

CRISPR opens up new possibilities to modify crops by knocking out or enhancing genes that are already present. "Its more precise, and more accurate and more intuitive than breeding," said Elena Del Pup, a plant genetics researcher at Wageningen University in the Netherlands. "[It] allows us to make very specific edits."

"The hope and the promise of [CRISPR] is that by making a few simple edits, you confer a highly valuable disease resistance trait onto a crop," said Vipula Shukla, senior program officer at the Bill and Melinda Gates Foundation.

If European Union states eventually accept the recent parliamentary vote, they would exempt plants with CRISPR edits from GMO labeling requirements.

The EU has been notoriously strict on GMOs, requiring labeling under consumer "right to know" rules since 1997. Every GMO product must receive EU authorization and a risk assessment.

In the United States, the FDA began requiring clear labeling on consumer products containing GMOs in 2022. In 2018, the USDA decided that CRISPR-edited foods do not need to be regulated or labeled as genetically edited because these modifications could have been done with traditional breeding alone.

Experts think the new EU vote that exempts CRISPR from these rules indicates a willingness to embrace new tools to address the challenges of providing enough food for a growing population facing climate change.

Heres how advocates foresee CRISPR helping the food system become more resilient to climate change.

In agriculture, maximizing yield remains a top priority. Crops that produce more food and use less fertilizer, water and pesticides also decrease embedded emissions.

Pairwise, in collaboration with Bayer, is editing corn that yields more kernels per ear. Another edited corn grows to 6 feet rather than the conventional 9 feet tall.

"The advantage is that it's much sturdier," said Adams. "So if there's a big wind it doesn't get blown over." It also makes applying insecticides, fungicides and herbicides easier.

To engineer the next generation of climate-efficient plants, scientists need to find specific genes in them, such as for controlling water usage or nitrogen fixation.

"One of the biggest limitations [for CRISPR] is our relatively limited knowledge of the biology of the organisms that were trying to edit," Shukla said. "You can't apply CRISPR to a gene if you don't know what the gene does."

Farmers and researchers are field-testing a strain of CRISPR-edited rice designed to resist bacterial blights, which can kill 75 percent of a crop. Rice blight is a particular problem in India and Africa.

Since 2011, The Gates Foundation has been funding field trials of CRISPR rice in India. It has engaged in similar field tests of a virus-resistant corn in Mexico since 2015. "The Gates Foundation wants to come in at a point where there's a testable hypothesis," Shukla said. "We're focusing on developing and delivering these innovations to people."

The foundation looks for preliminary laboratory results or small scale, proven field testing. It then funds a larger scale pilot in real-world conditions in developing countries.

"I don't personally have a lot of faith that we're going to reverse climate change," Adams said. "So, I think we probably should be investing in adapting to it."

Farmers need plants that can survive temperature extremes, including higher nighttime temperatures, as well as erratic rainfall patterns. CRISPR can help native plants adapt to their changing environment by enhancing their genes.

"One of the consequences of climate change is having to move crops into places they havent been before because it's warmer or wetter or drier," Shukla said. "And crops are not adapted to those pests [in the new locations]. We have the ability with gene editing to confer traits that make those crops more tolerant to pests and diseases that they haven't experienced before."

The Gates Foundation is looking at genes for heat tolerance as its next target for research and investment, according to Shukla.

CRISPR technology may also diversify the genetic composition of current crops and domesticate new crops. That could help address the damage done by industrial, monoculture farming practices, in which a single crop species dominates a field or farm, depleting the soil of its nutrients.

"Wild relatives of plants contain traits that can be super-valuable for agriculture," Shukla said. "But we haven't had a way through crossing or other methods to bring those traits into the agricultural system."

If Pairwises mild mustard green becomes a hit, it might offer an incentive for farmers to plant a new leafy green alongside their kale, lettuce and spinach adding to biodiversity.

See the original post:
Why Bayer and the Gates Foundation are using CRISPR to reduce food's climate impact - GreenBiz

TCGA data acquisition and pre-processing

TCGA SNV data for 16 cancer types (BLCA, BRCA, COAD, GBM, HNSC, KIRC, KIRP, LIHC, LUAD, LUSC, OV, PAAD, PRAD, READ, STAD, and UCEC) were downloaded from the GDC data portal (https://portal.gdc.cancer.gov/, DR-7.0). The mutation files were initially collected as VarScan2 processed protected mutation annotation format (MAF) files. To eliminate low-quality and potential germline variants, we further processed the files according to the guidelines provided by the GDC portal (https://docs.gdc.cancer.gov/Data/File_Formats/MAF_Format/) to generate high-confidence somatic mutation files. For gene expression analysis, we obtained fragments per kilobase of exon per million mapped fragments (FPKM) data using the TCGAbiolinks19 R package (version 2.26.0). The gene expression values were then normalized to log2(FPKM+1).

The DepMap CRISPR/Cas9 screen dataset20 (https://depmap.org/portal/, DepMap Public 21Q2) was used to collect essential genes. Haploinsufficient genes were compiled from three sources: (1) Vinh T Dang et al.s study11, (2) ClinGen12 (https://clinicalgenome.org, genes with haploinsufficiency scores of 2 or 3, downloaded on January 20, 2021), and (3) DECIPHER13 (https://deciphergenomics.org, genes located in the top 5% probability of haploinsufficiency scores, version 3). Oncogenes were obtained from the COSMIC Cancer Gene Census9 (https://cancer.sanger.ac.uk/census, v94) data by applying the filter Somatic=yes and including genes with the role of oncogene in cancer. Hotspot mutations were annotated using data from the Cancer Hotspots portal3 (https://www.cancerhotspots.org, Hotspot Results V2).

To generate targetable SNVs and the corresponding sgRNA sequences from a given SNV list of a sample, we followed the following steps: First, we identified the SNVs located within essential or haploinsufficient genes. If an SNV was encoded by an essential gene, only homozygous SNVs were further analyzed. Next, we calculated the allele frequency (AF) threshold ({AF}_{cut}) using the following equation:

$${AF}_{cut}={AF}_{M}+MAD(hetAF)$$

(1)

where ({AF}_{M}) is the median of AFs of SNVs from the sample, and (MAD(hetAF)) is the median absolute deviation (MAD) of AFs of heterozygous SNVs from the patient or sample. SNVs with AF below the samples ({AF}_{cut}) were filtered out. We then considered the expression of the gene in which an SNV was located and retained SNVs where the gene expression (log2(FPKM+1)) was greater than 1.

To identify SNVs that generate a novel and specific targetable site for the CRISPR/Cas9 approach, we searched for a PAM sequence (NGG, where N represents any nucleotide) within a 12-base pair region around the SNV or checked if the SNV itself created a new PAM sequence. For the satisfying SNVs, a 20-nucleotide sgRNA sequence was obtained.

To obtain sgRNAs with precise knockout efficiency and low potential off-target effects, we calculated the on- and off-target scores and applied strict cutoffs as follows: First, on-target scores were calculated using the Azimuth 2.015 method implemented in the crisprScore21 R package (version 1.2.0). sgRNAs with on-target scores greater than 0.5 were examined for possible off-target sites using CasOFFinder16 (offline version 2.4). The UCSC human reference genome assembly (GRCh38) was used as a reference, and off-target sites with a maximum of three mismatches were searched. If an sgRNA was found to have off-target sites, the off-target score was calculated using the CFD15 method, which was also implemented in the crisprScore21 R package. If off-target sites with scores>0.175 were present, the sgRNA was filtered out to mitigate potential off-target risks. Finally, the SNVs were reported along with their corresponding sgRNAs, on-target scores, and off-target scores.

All cells were maintained at 37C in a 5% CO2 atmosphere. Human embryonic kidney 293T (HEK293T) cells were purchased from ATCC. HEK293T cells were cultured in Dulbeccos modified Eagles medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillinstreptomycin (Invitrogen, USA). Human colorectal cancer cell lines (SNUC4, SW620, and NCIH498) were also purchased from the Korean Cell Line Bank and cultured in RPMI-1640 medium (Gibco) supplemented with 10% FBS and 1% penicillinstreptomycin.

The lentiviral plasmids lentiCas9-Blast and lentiGuide-puro were purchased from Addgene USA (#52,962, #52,963). The sgRNA sequences were cloned following the lentiCRISPR v2 cloning protocol22,23. For transfection, 7.5105 HEK293T cells were seeded in 60-mm plates one day before transfection. Transfection was performed using Opti-MEM I Reduced Serum Medium (Gibco) with 1g of lentiviral plasmid, 0.25g of pMD2.G (#12,259; Addgene), 0.75g of psPAX2 (#12,260; Addgene), and 6 L of FuGENE (Promega, USA). The medium was changed after 16h of incubation at 37C under 5% CO2. Viral supernatants were collected 48 and 72h after transfection, filtered through a 0.45-m membrane (Corning, USA), and stored at -80C. Cells were transduced with lentivirus encoding lentiCas9-Blast to establish stable Cas9-expressing cells, followed by selection with blasticidin (10g/mL) (Invitrogen) for seven days.

Stable Cas9-expressing SNUC4 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRNA targeting the RRP9 SNV of SNUC4 (sgRRP9-SNV). After selection with puromycin (SNUC4: 10g/mL, SW620: 2g/mL, Invitrogen) for 72h, 1103 cells/well were seeded into six-well plates. The medium was replaced every 72h. After 14days, the medium was removed, and the cells were stained with 0.05% crystal violet solution in a 6% glutaraldehyde solution for 30min. The crystal violet solution was then removed, and the cells were washed with H2O and allowed to dry. Colonies comprising more than 50 cells were counted using the ImageJ software24.

Parental or stable Cas9-expressing SNUC4 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRRP9-SNV. After selection with puromycin (SNUC4: 10g/mL, SW620: 2g/mL) for 72h, 1105 cells/well were seeded into six-well plates. After 3days, cells were trypsinized, stained with trypan blue (Bio-Rad, USA), and counted. All harvested cells were seeded onto 60-mm plates. After 3days of incubation, cells were trypsinized and counted with trypan blue again. The subculture was repeated once more using 100-mm plates. Growth curves were generated using cell counts obtained during the subculture.

Total RNA was extracted from SW620 cell line using the RNeasy Plus Mini Kit (QIAGEN, Germany) following the manufacturers instructions. cDNA was synthesized with PrimeScript RT Master Mix (Takara Korea Biomedical Inc, Korea), and full-length RRP9 cDNA was PCR amplified with CloneAmp HiFi PCR Premix (Takara Korea Biomedical Inc). The PCR-amplified RRP9 wild-type cDNA was cloned into pcDNA3 Flag HA (#10,792, Addgene) using In-Fusion HD Cloning Kit (Takara Korea Biomedical Inc). RRP9 sequence was confirmed by Sanger-sequencing.

Stable Cas9-expressing SNUC4 cells were transduced with lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRRP9-SNV. After selection with puromycin (10g/mL) for 72h, 3103 cells/well were seeded into 96-well plates. After a 24h incubation, 2g of empty or RRP9 plasmids were transfected with FuGene HD (Promega) according to the manufacturers protocol. Cell viability was assessed after 4days using Cell Titer Glo (Promega), and relative luminescence units (RLU) were measured using an EnVision plate reader (Perkin-Elmer, USA).

Stable Cas9-expressing NCIH498 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRNA targeting the SMG6 SNV of NCIH498 (sgSMG6-SNV). After selection with puromycin (NCIH498: 10g/mL, SW620: 2g/mL) for 72h, 3103 cells/well were seeded into 96-well plates. After 6days, cell viability was determined with Cell Titer Glo according to the manufacturers protocol, and RLU were measured using an EnVision plate reader.

Cells and tissues were harvested, washed with phosphate-buffered saline (PBS), and lysed on ice for 15min in a radioimmunoprecipitation assay buffer (R0278; Sigma, USA) supplemented with a protease and phosphatase inhibitor cocktail (GenDEPOT, USA). Cell lysates were centrifuged at 4C for 10min at 15,000rpm. Protein concentrations were determined using Bradford assay (Bio-Rad). Equal amounts of total protein were separated via sodium dodecyl sulfate gel electrophoresis and transferred to polyvinylidene difluoride membranes (Bio-Rad). The membranes were blocked with 5% skim milk for 1h at 22C and then incubated overnight at 4C with a primary antibody against the target protein in a buffer containing 0.1% Tween 20. Subsequently, the membranes were washed with Tween-PBS buffer three times for 10min each and incubated with a secondary antibody (anti-rabbit IgG or anti-mouse IgG) diluted in a blocking buffer containing 0.1% Tween 20 for 1h at 22C. The membranes were then washed with Tween-PBS three times for 10min each. The immunoreactive bands were visualized using Pierce enhanced chemiluminescence western blotting substrate (32,106; Thermo Fisher Scientific, USA). Mouse monoclonal anti-Cas9 (#14,697; Cell Signaling Technology, USA), rabbit polyclonal anti-RRP9 (#ab168845, Abcam, UK), rabbit polyclonal anti-FLAG (DYKDDDDK) (#2368; Cell Signaling Technology) and rabbit monoclonal anti-heat shock protein 90 (HSP90) (#4877, Cell Signaling Technology) and were used at a 1:1000 dilution. Anti-rabbit IgG (#111-035-144; Jackson ImmunoResearch, USA) was used at a 1:5000 dilution except for anti-FLAG which was used at a 1:10,000 dilution. Anti-mouse IgG (#115-035-146, Jackson ImmunoResearch) was used at a 1:10,000 dilution.

Genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Libraries were prepared with a two-step PCR reaction, in which the first step uses target-specific primers, and the second step utilizes primers containing unique barcodes and Illumina sequencing adaptor sequences. The primers used here are listed in Supplementary Data 4. PCR reactions were performed with KAPA HiFi HotStart Ready Mix (Roche Molecular Systems, Inc. USA). For the first PCR step, 100ng of genomic DNA was denatured at 95 for 5min, followed by 30 cycles of (98C at 20s, 61C for 15s, and 72C for 15s), and a final extension at 72C for 1min. Primers with unique barcodes and Illumina sequencing adaptor sequences were added to the PCR product from step 1 for the second PCR reaction, where denaturation at 95C for 5min was followed by 12 cycles of (98C at 20s, 61C for 15s, 72C for 15s), and a final extension at 72C for 1min. PCR products were verified with 2% agarose gel electrophoresis and extracted using the Zyomoclean Gel DNA Recovery Kit (Zymo Research, USA) according to the manufacturers instructions. The barcoded PCR products were pooled and subjected to paired-end sequencing (2150bp reads) on an Illumina NovaSeq-6000 instrument (Macrogen, Korea). InDel quantification was conducted using CRISPResso225 with default parameters.

Genomic DNA was extracted from colorectal cancer cell lines using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Target regions were PCR-amplified with nTaq (Mg2+plus) (Enzynomics, Korea) with the following primers: sgRRP9-SNV region (Forward: 5-TCAAGGCCCTCGTTGATTCC-3, Reverse: 5-TTTTTGGGCTTTGTGGCTGC-3), sgSMG6-SNV region (Forward: 5-TCTGCATCGAAAGTGACACGA-3, Reverse: 5- CTATCAGCCTGGACGACGTTT-3). PCR products were purified with PureLink Quick PCR Purification Kit (Invitrogen). 200ng of purified PCR product were denatured at 95C for 10min, re-annealed at 2C per second temperature ramp to 85C, followed by a 1C per second ramp to 25C. 1l of T7E1 enzyme (Enzynomics) was added to the heterocomplexed PCR product and incubated at 37C for 15min. Products were electrophoresed on a 2% agarose gel using TAE buffer. Band intensities were measured with ImageJ, and the estimated non-homologous end joining (NHEJ) event was calculated with the following formula:

$$NHEJleft( % right) = 100 times left[ {1 - left( {1 - fraction; cleaved} right)^{{left( {frac{1}{2}} right)}} } right]$$

(2)

where the fraction cleaved is (frac{(Density; of; digested; products)}{(Density; of; digested; products,+,undigested; parental; band}).

All animal procedures were approved by the Institutional Animal Care and Use Committee of Yonsei University, Seoul, Korea (2021-0106). All methods were performed in accordance with the relevant guidelines and regulations for the care and use of laboratory animals. Six-week-old female BALB/c-nu Slc mice were purchased from Orient Bio (Korea) and SLC Inc. (Japan). The mice were housed in individual ventilation cages equipped with a computerized environmental control system (Techniplast, Italy). The animal room temperature was maintained at 222C with a relative humidity of 5010%. Before the experiments, the animals were acclimated for seven days under a 12-h lightdark cycle.

Stable Cas9-expressing SNUC4 cells were transduced with lentivirus encoding either the control sgRNA or sgRNA targeting the RRP9 SNV in SNUC4 cells. After selection with 10g/mL puromycin for 72h, 3106 cells were subcutaneously injected into the left (control sgRNA) or right (RRP9 SNV of SNUC4 sgRNA) flanks of 10 mice. Similarly, stable Cas9-expressing SW620 cells were transduced with lentivirus encoding either the control sgRNA or sgRNA targeting the RRP9 SNV in SNUC4 cells. After selection with 2g/mL puromycin for 72h, 2106 cells were subcutaneously injected into the left (control sgRNA) and right (RRP9 SNV of SNUC4 sgRNA) flanks of 10 mice. Among the mice, we excluded those with no observable tumor growth in the left flank (control sgRNA) from further analysis.

Tumor sizes were measured using a caliper, and the volume was calculated using the formula: 0.5lengthwidth2. Mice were sacrificed when the largest tumor reached a volume of 1000 mm3. Each tumor was considered an experimental unit. The sample size was determined to be sufficient to identify statistically significant differences between groups.

Genomic DNA was extracted from colorectal cancer cell lines using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Whole-exome capture was performed using the SureSelect Human All Exon V4 51Mb Kit (Agilent Technologies, USA). The captured DNA was then sequenced on the HiSeq 2500 platform (Illumina, USA), generating a minimum of 98.9 million paired-end sequencing reads of 100bp per sample.

The Burrows-Wheeler Alignment26 tool was used with the default parameters to align the paired-end reads to the UCSC human reference genome assembly (GRCh37/hg19). An average of 98.3% of the reads were successfully aligned to the human genome. Duplicate reads were removed using the Picard software package. The Genome Analysis Tool Kit (GATK) version 3.446 was used for read quality score recalibration and local realignment to identify short InDels using the HaplotypeCaller27 package. The variants were filtered using the GATK Best Practices quality control filters.

SNVs were identified using Mutect28, specifically the tumor-only option, with default parameters. Variants supported by at least five high-quality reads (Phred-scaled quality score>30) and detected with at least 20% AF were selected for further analysis. The detected SNVs and InDels were annotated using various databases, including the single nucleotide polymorphism (SNP) database (dbSNP29, build 147), 1000 Genomes Project30 (Phase 3), Korean dbSNP (build 20,140,512), and somatic mutations in TCGA colon adenocarcinoma (COAD), using the Variant Effect Predictor software31 (version 87). ANNOVAR32 was used to annotate regions of known germline chromosomal segmental duplications and tandem repeats.

Several steps were performed to filter variants. Patients with germline polymorphisms, chromosomal segmental duplications, or tandem repeats were excluded. The variants were then filtered to include known somatic mutations observed in at least one sample from TCGA COAD dataset. Additionally, nonsynonymous mutations observed in genes belonging to the Cancer Gene Census, as reported in at least ten samples in the COSMIC9 database (version 87), were included in the analysis.

Total RNA was extracted from colorectal cancer cell lines using the RNeasy Plus Mini Kit (QIAGEN) following the manufacturers instructions. The TruSeq RNA Sample Prep Kit v2 (Illumina) was used to generate mRNA-focused libraries. Libraries were sequenced on the HiSeq 2500 platform, generating at least 40 million paired-end reads of 100bp per sample.

The TopHat-Cufflinks33 pipeline was employed to align the reads to the reference genome and calculate normalized gene expression values in FPKM. TopHat was used to align and map the reads to the reference genome. The resulting alignments were then processed using Cufflinks, which estimates transcript abundance and calculates FPKM values, providing a measure of gene expression levels that takes the length of exons and the total number of mapped reads into account.

R (ver. 4.2.1) (R Foundation, Austria) and the ImageJ software were used to analyze the data.

The figures were generated using the R software, and statistical analyses were performed using RStudio software (version 2022.07.2+576). Specific statistical tests are identified in the figure legends for each experiment.

The study design, animal use and all experimental methods were conducted and reported in accordance with ARRIVE guidelines (https://arriveguidelines.org).

Go here to read the rest:
CRISPR/Cas9 targeting of passenger single nucleotide variants in haploinsufficient or essential genes expands cancer ... - Nature.com

The new Integrated Classifier Pipeline system uses genetic fingerprints to identify unintended bystander CRISPR edits. A confocal microscope image of an early blastoderm-stage nucleus in aDrosophila(fruit fly) embryo uses colorful fluorescent markers to highlight the homothorax gene undergoing transcription from two separate parental chromosomes (two distinct signal clusters). Credit: Bier Lab, UC San Diego

The ICP system can cleanly establish whether a given individual insect has inherited specific genetic components of the CRISPR machinery from either their mothers or fathers since maternal versus paternal transmission result in totally different fingerprints, said Bier, a professor in the UC San Diego School of Biological Sciences.

The ICP can help untangle complex biological issues that arise in determining the mechanisms behind CRISPR. While developed in insects, ICP carries vast potential for human applications.

There are many parallel applications of ICP for analyzing and following CRISPR editing outcomes in humans following gene therapy or during tumor progression, said study first author Li. This transformative flexible analysis platform has many possible impactful uses to ensure safe application of cutting-edge next-generation health technologies.

ICP also offers help in tracking inheritance across generations in gene drive systems, which are new technologies designed to spread CRISPR edits in applications such as stopping the transmission of malaria and protecting agricultural crops against pest destruction. For example, researchers could select a single mosquito from the field where a gene-drive test is being conducted and use ICP analysis to determine whether that individual had inherited the genetic construct from its mother or its father, and whether it had inherited a defective element lacking the defining visible markers of that genetic element.

The CRISPR editing system can be more than 90 percent accurate, said Bier, but since it edits over and over again it will eventually make a mistake. The bottom line is that the ICP system can give you a very high-resolution picture of what can go wrong.

In addition to Li and Bier, coauthors included Lang You and Anita Hermann. Prior Bier lab member Kosman also made important intellectual contributions to this project.

Funding for the study was provided primarily by an award from the Bill and Melinda Gates Foundation.

Competing interest disclosure: Bier has equity interest in two companies he co-founded: Agragene Inc. and Synbal Inc., which may potentially benefit from the research results. He also serves on Synbals board of directors and the scientific advisory boards for both companies.

Read this article:
New Genetic Analysis Tool Tracks Risks Tied to CRISPR Edits - University of California San Diego

Leadership change simultaneous to the Eclipse Cell Engineering platform spinout asEditCo Bio

REDWOOD CITY, Calif., March 27, 2024 /PRNewswire/ -- Synthego Corporation, a leading provider of genome engineering solutions, announced that Paul Dabrowski will step down as Chief Executive Officer, effective immediately. Craig Christianson has been appointed Chief Executive Officer following an extensive search process. Mr. Dabrowski, a co-founder of the company, will continue his role as a Board Director and advisor. Additionally, the company announces the divestiture of the Eclipse Cell Engineering platform as EditCo Bio, Inc., enablingSynthego's unique focus on therapeutic applications of CRISPR.

"Founding and growing Synthego the past 12 years has been the privilege of a lifetime," said Dabrowski. "Our team has transformed the CRISPR landscape by staying true to our values and providing everyone, from individual scientists to the world's leading biotechnology companies, with unprecedented access to advanced genome engineering. I'm confident Craig is an ideal fit to further our mission by building a robust commercial engine leveraging Synthego's platform - in addition to his impeccable track record, he embodies Synthego's culture of innovation and excellence. As the world enters the era of CRISPR based therapeutics, Synthego is now focused to be the premier supplier to hundreds of programs entering the clinic."

Christianson has a track record of spearheading global commercial strategies, business development and operations to build global life sciences and other businesses. He joins Synthego from Water Street Healthcare Partners, preceded by 12 years with global biotechnology company Promega Corporation where he led commercial operations, accelerating their growth to $700M+ in annual sales through profit-driven strategies and successful digital transformation.

"I am honored to join this pioneering organization which plays an important role in the impact CRISPR has on life science research and clinical development," said Christianson. "Paul is a visionary who has built a foundation upon which Synthego will become the best partner for clients in terms of co-development and regulatory compliance for the advancement of therapies and, ultimately, human health."

Christianson's appointment, along with the spinout of EditCo Bio, previously operating as Synthego's Eclipse platform, reinforces Synthego's commitment to provide CRISPR therapeutic developers with best-in-class guide RNAs. With its state-of-the-art GMP facility and extensive experience of producing leading products, Synthego is uniquely positioned to address escalating clinical requirements and changing regulatory frameworks. Bolstered by the FDA approval of the first CRISPR-based therapy, Synthego is more dedicated than ever to accelerating life-saving technologies for improved human health in its next chapter.

For more information, click here.

About Synthego:Synthego is a genome engineering company that enables the acceleration of life science research and development in the pursuit of improved human health. Based on a foundation of engineering and chemistry, Synthego leverages automation and machine learning to synthesize high-quality CRISPR reagents for science at scale. Synthego's mission is to enable agile life science research and development from discovery through clinical trials by providing scientists with comprehensive CRISPR solutions for each phase coupled with full technical and regulatory support from industry-leading experts. With its technologies cited in hundreds of peer-reviewed publications and utilized by thousands of commercial and academic researchers and therapeutic drug developers, Synthego is at the forefront of innovation, enabling the next generation of medicines by delivering genome editing at an unprecedented scale.

SOURCE Synthego

Read more:
Synthego Announces CEO Transition to Focus on Enabling CRISPR Therapeutics - PR Newswire

Figure 1: Total deal value by deal therapy area of licensing agreements for innovator drugs utilising the CRISPR system, globally, 2019-2024, year to date. Credit: GlobalData.

Licensing agreements for innovator drugs utilising clusteredregularly interspaced short palindromic repeats (CRISPR) technologies saw oncology, immunology, and central nervous system as the top three therapy areas by total deal value with a combined $21bn over the past five years.

Furthermore, haematological disorders saw almost three times more licensing agreement deal value in 2022 compared to 2020, reaching a total deal value of $1.8bn in the past five years (Figure 1), as reported by GlobalDatas Pharma Intelligence Center Deals Database.

This highlights the growing importance of advancements in CRISPR for haematological disorder therapies.

In December 2023, the US Food and Drug Administrations approval of Casgevy, the first CRISPR and CRISPR-associated protein 9 (Cas9) genome editing therapy developed by Vertex Pharmaceuticals and CRISPR Therapeutics for sickle cell disease and beta thalassemia represented a major milestone in gene therapy.

Casgevy precisely edits DNA in blood stem cells by utilising CRISPR/Cas9 technology, involving taking the patients bone marrow stem cells and enhancing their expression of fetal haemoglobin before reintroducing these edited stem cells back into the patient.

This restores healthy haemoglobin production in patients with sick cell disease and beta thalassemia, effectively alleviating the symptoms of these diseases.

Access the most comprehensive Company Profiles on the market, powered by GlobalData. Save hours of research. Gain competitive edge.

Your download email will arrive shortly

We are confident about the unique quality of our Company Profiles. However, we want you to make the most beneficial decision for your business, so we offer a free sample that you can download by submitting the below form

Country * UK USA Afghanistan land Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bonaire, Sint Eustatius and Saba Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos Islands Colombia Comoros Congo Democratic Republic of the Congo Cook Islands Costa Rica Cte d"Ivoire Croatia Cuba Curaao Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and McDonald Islands Holy See Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Isle of Man Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati North Korea South Korea Kuwait Kyrgyzstan Lao Latvia Lebanon Lesotho Liberia Libyan Arab Jamahiriya Liechtenstein Lithuania Luxembourg Macao Macedonia, The Former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Runion Romania Russian Federation Rwanda Saint Helena, Ascension and Tristan da Cunha Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and The Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and The South Sandwich Islands Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syrian Arab Republic Taiwan Tajikistan Tanzania Thailand Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates US Minor Outlying Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam British Virgin Islands US Virgin Islands Wallis and Futuna Western Sahara Yemen Zambia Zimbabwe Kosovo

Industry * Academia & Education Aerospace, Defense & Security Agriculture Asset Management Automotive Banking & Payments Chemicals Construction Consumer Foodservice Government, trade bodies and NGOs Health & Fitness Hospitals & Healthcare HR, Staffing & Recruitment Insurance Investment Banking Legal Services Management Consulting Marketing & Advertising Media & Publishing Medical Devices Mining Oil & Gas Packaging Pharmaceuticals Power & Utilities Private Equity Real Estate Retail Sport Technology Telecom Transportation & Logistics Travel, Tourism & Hospitality Venture Capital

Tick here to opt out of curated industry news, reports, and event updates from Pharmaceutical Technology.

Submit and download

Figure 1 shows innovator drugs harnessing CRISPR systems saw 182% growth in total licensing agreement deal value from $5.6bn in 2020 to $15.8bn in 2022, according to GlobalDatas Pharma Intelligence Center Deals Database.

Oncology represented more than half of the total deal value for the top three therapy areas with $11.9bn, followed by immunology with $6.7bn, and central nervous system with $2.3bn, according to GlobalDatas Pharma Intelligence Center Deals Database.

Pharma giants such as Lily and Sanofi have recently partnered with companies developing CRISPR-based technologies.

Last year, Prevail Therapeutics, a subsidiary of Lily, secured exclusive rights to Scribe Therapeutics CRISPR X-Editing (XE) technologies for $1.65bn.

This licensing agreement, aimed at developing genetic therapies for neurological and neuromuscular diseases, stands as the largest CRISPR-based deal of the year.

Concurrently, Sanofi expanded its collaboration with Scribe in July 2023, with a deal worth up to $1.24bn, focusing on leveraging Scribes XE genome editing technologies for the development of in vivo therapies, particularly sickle cell disease and other genomic disorders.

Moreover, Lilys expertise in cardiometabolic diseases prompted the company to partner with Beam Therapeutics in October last year.

This agreement, valued at up to $600m, involved acquiring rights held by Beam in Verve Therapeutics, a gene-editing company focused on single-course gene editing therapies for cardiovascular disease.

This includes Verves programmes targeting PCSK9 and ANGPTL3, both set for clinical initiation this year.

CRISPR technology is revolutionising targeted gene therapies for various unmet diseases by precisely targeting diverse genomic sites.

This advancement in precision medicine offers hope for more tailored treatments and improved patient outcomes.

Furthermore, the growing number of CRISPR-based therapies in clinical trials is expected to fuel significant interest and drive further progress in this field.

View original post here:
CRISPR drug licensing deals secure $21bn in top three therapy areas over five years - Pharmaceutical Technology