Archive for the ‘Genetic Testing’ Category

Non-profit organisation The Kennel Club and supplier Weatherbys has launched its CombiBreed health tests packages for eight new breeds.

The tests have been created to provide a simplified process for canine genetic health testing for the benefit of both dog breeders and owners, and help to eradicate some of the most concerning genetic disorders facing certain breeds.

The tests are now available for breeds such as Giant Schnauzer, Irish Setter, Jack Russell Terrier, Parson Russell Terrier, Shetland Sheepdog, Spanish Water Dog, Standard Poodle and the Tibetan Terrier.

CombiBreed health tests packages simplify the process of genetic testing by using a single cheek swab to check a dogs DNA for markers associated with a number of different inherited disorders.

The company says by making genetic testing more accessible it will help responsible breeders work towards eradicating these conditions and will encourage first time breeders to make the health of the puppies they breed a priority.

Results from these tests will automatically be registered on the dogs record, and will be freely available on the Kennel Club website, allowing puppy buyers to check if the dog they are thinking of buying has come from health-tested parents

The packages are already available for breeds including: Labrador Retriever, French Bulldog, Cocker Spaniel, English Springer Spaniel, Golden Retriever, German Shepherd, Staffordshire Bull Terrier, Cavalier King Charles Spaniel, Beagle, Border Collie, Chinese Crested and the Australian Shepherd.

Read more:
The Kennel Club and Weatherbys launch CombiBreed all-in-one tests - Pet Gazette

Survey finds 23andMe Health + Ancestry results motivate customers to make positive lifestyle changes.

NEW YORK, Jan. 30, 2020 /PRNewswire-PRWeb/ -- At-home DNA testing service 23andMe is more than just a tool to discover ancestry - it also offers insight into how genes can impact overall health and wellness. 23andMe offers a wealth of reports that provide genetic health information that can help customers be more proactive about their health. Recently, 23andMe Genetics Trends Expert, Madeline Lynch, and customer Michelle Martinez, teamed with YourUpdateTV to discuss.

A video accompanying this announcement is available at: https://youtu.be/VAKAywAd4VY

A recent survey of 23andMe's Health + Ancestry Service customers found that more than three-quarters reported that after receiving their personalized genetic reports they made at least one positive change in their health behavior. Designed by 23andMe and M/A/R/C Research, researchers asked 23andMe Health + Ancestry customers about the overall impact of their 23andMe experience, regardless of their results.

51 percent of respondents reporting they've set future goals to be healthier. Changes included eating healthier, getting more sleep, and exercising more, among others. Of those who responded to the survey:

For more information and to get started, visit 23andMe.com

Madeline Lynch: Madeline Lynch is the Genetics Trends Expert at 23andMe. She serves as a subject matter expert and company spokesperson for media engagements, the analyst community, online communities, and the general public at large. Her responsibilities on the customer care team include providing input on prioritization and resolution of customer-facing issues and working directly with cross-functional teams to influence and support development of new and existing communications materials and messaging from the perspective of the customer. She holds a BA from University of California, Davis.

About Michelle Martinez: Michelle Martinez is a 51-year-old lab assistant from Arlington, Texas. Michelle was inspired to order a 23andMe Health + Ancestry kit to help prepare for any potential genetic health risks, due to several serious health risks running in her family. When she opened her Genetic Weight wellness report, she saw that she is genetically predisposed to weigh less than average. She thought, "I've been denying my genetics and just falling into bad habits. I'm not being my best self." That report, along with the knowledge of lifestyle and environmental factors that affect one's health, inspired Michelle to make better lifestyle decisions like eating healthier. She has since lost more than 50 pounds and gained confidence in being in her own skin. She believes that her weight loss journey is one of patience and acceptance with and of herself -- no matter her size.

About 23andMe: 23andMe, Inc. is the leading consumer genetics and research company. Founded in 2006, the mission of the company is to help people access, understand and benefit from the human genome. The company was named by TIME as a "Genius Company" in 2018 and featured as Fast Company's #2 Most Innovative Health Company in 2018. 23andMe has millions of customers worldwide, with more than 80 percent of customers consented to participate in research. 23andMe, Inc. is located in Sunnyvale, CA. More information is available at http://www.23andMe.com.

About YourUpdateTV: YourUpdateTV is a social media video portal for organizations to share their content, produced by award-winning video communications firm, D S Simon Media (http://www.dssimon.com). It includes separate channels for Health and Wellness, Lifestyle, Media and Entertainment, Money and Finance, Social Responsibility, Sports and Technology.

SOURCE 23andMe

Here is the original post:
How Genetic Testing with 23andMe Can Improve Your Health - Yahoo Finance

DNA sequencing can unlock a whole new understanding but also holds some risks and ethical questions.

Genomics has been the most transformative biotechnology of the 21st century to date. It is one that has caused significant debate amongst medical professionals and regulators since direct-to-consumer (DTC) genetic testing entered the market in the early 2000s, allowing consumers to access limited genetic information without the involvement of a physician.

As DNA sequencing costs have plummeted, the number of DTC genetic tests available through companies like 23andMe and Ancestry.com have risen rapidly. At present roughly 30 million customers have embraced DTC. It has been predicted that by 2021, over 100 million people will have utilized such analyses. In 2018, it was estimated that there were 75,000 genetic tests on the market with ten being added each day.

Affluent families are active planners and assessors of risk. With direct-to-consumer DNA testing becoming so prolific, it seems logical to examine whether these families can use genomics to their advantage when it comes to embracing human capital issues and enhancing the health and well-being of various family members.

Can these at-home DNA tests assist in determining the possibility of illness and taking steps to mitigate this risk? Should the information they provide be factored into succession decisions? Are they the missing piece of the puzzle when it comes to achieving longevity?

To answer these questions first requires a basic understanding of the current state of direct-to-consumer genetic testing in comparison to medical versions, the information these provide and what inferences can be drawn from these types of tests.

Understanding genetic testing

The human genome is made up of over 6 billion elements grouped into thousands of genes that carry hereditary information about a persons traits, including things like hair and eye color. This information is based on the way specific molecules that make up genes are arranged.

Genetic testing examines these arrangements or variations. The results are used to determine the risk of disease development, screen for and diagnose rare diseases and, in some cases, may be used to determine medical treatment when predicting things like drug responses. In a clinical setting, the results of these tests are used to inform medical treatment decisions.

Ronnie S. Stangler, M.D., physician, psychiatrist and founder of Genome Advisory, helps families of wealth navigate the field of genomics from practical functional applications, its risks and ethics, to the dreamspace of aging-reversal.

Dr. Stangler comments, I often share with my clients that DTC genetic testing products typically capture less than 0.01% of their DNA. For example, 23andMe only tests for three of over 1,000 BRCA mutations, known to contribute to the development of breast and ovarian cancer. Thus, 90% of participants who carry a BRCA mutation would be grossly mislead by todays 23andMe test.

Direct-to-consumer genetic tests offer a variety of limited health information. This includes their calculations of risk of developing certain diseases, carrier status for certain conditions (these indicate whether a person carries a gene for a recessive disease that may be passed on to their offspring), and predictions on how a person will respond to certain drugs. Some recreational tests offer non-disease related information such as ancestry, eye-color, propensity to blush based on earlobe size and a host of other infotainment data.

Unlike clinical genetic tests, DTC tests, even those manufactured by 23andMe, which have FDA approval to market, are not intended for diagnostic purposes as they provide risk information based on a limited set of conditions. These tests not only have varying levels of evidence to support their claims, but different companies also test different variants. This can lead to contradictory results for the same condition.

Clinical studies have shown that 40% of the raw data direct-to-consumer tests use can yield false positives, which may cause unnecessary stress and anxiety in users. These tests can also produce false negatives, as Dr. Stangler noted earlier, which may put users minds at ease even though they are unknowingly still at risk.

Of course, genes are not the sole determinant of a persons ultimate destiny. Lifestyle, experience and environment are powerful factors as well.

Privacy and ethical considerations

Besides the apparent shortcomings of current DTC genetic tests, another issue for wealthy families to consider is privacy.

Beyond the medical risks associated with direct-to-consumer genetic testing, I have grave concerns about privacy and security. In its current state, DTC is a privacy and security minefield.

Direct-to-consumer DNA companies not only share their data with government and law enforcement, but some may even sell it, compromising confidentiality.

Private health information splashed across the tabloids is not only a personal nightmare, but it could also have far-reaching organizational ramifications for those in family offices. Does the extended family deserve to know about the specific health risks of other family members? What if board members suddenly discover the companys founder or their future successor has a chance of developing a mental illness or debilitating disease? Will decisions be made based on this information, or will it influence decisions?

Thus, affluent families need to consider how the information made available through these tests could potentially impact other family members and influence their roles within the company as well as succession decisions.

In other instances, users may have the option to share their DNA data openly, allowing them to locate and connect with distant relatives. In ultra-wealthy families, younger members may inadvertently become targets of unscrupulous individuals and be exploited via these avenues.

Still Dr. Stangler believes there is tremendous value in understanding our genes. She explains, As a source of raw genetic information, whole genome sequencing, which analyses the entirety of our genetic makeup, has profound advantages over DTC products. It is a highly regulated medical service with legal standards that ensure accuracy, safety and far better privacy. This is critical for families of wealth.

How clinical genetic tests can be used to a familys advantage

From the above discussion, it is evident that clinical genetic testing is far superior to direct-to-consumer versions at present.

According to Dr. Stangler, Whole genome sequencing is just the beginning of the genetics journey. We use the DNA science of genomics to help individuals and global families with strategic decisions regarding health, risk and legacy. Preeminent families have already embraced planning.

With this information in mind, environmental and lifestyle factors that could contribute to the development of certain diseases can be discussed and appropriate steps, if necessary, can be taken to minimize these risks and thereby increase the odds of longevity. This can be done for each member of the family, young and old.

The relevance of this form of risk mitigation to those in family businesses and family offices goes without saying. As much as economic and financial risks can be anticipated and planned for, today the same may be said for genetic ones.

The social, behavioral, interpersonal and ethical dilemmas that arise from knowledge of ones genes are best resolved with the help of experts who are familiar not only with the complex science of genomics, but with the multitude of unique and challenging issues and non-financial risks faced by affluent families and the systems that support them. Families of wealth and their trusted advisors require a working knowledge of genomics in order to shape their most powerful legacy and future.

Read the original here:
DNA Testing And Families Of Wealth - Forbes

By Layal Liverpool

Guy Smallman/Getty

I am black and mixed-race, but it remains unclear to me whether these are social identities or biological classifications. Luckily, I can turn to Adam Rutherfords latest book, How to Argue with aRacist, to reveal the current scientific understanding of race, ancestry and genetics. It also tells us how to argue effectively against the idea that certain populations of people are biologically inferior.

From the beginning, Rutherford is clear that although he uses the term race frequently, he does so only because the word is widely used: it isnt scientifically valid, yet it exists so must be addressed. Race is a social construct. This does not mean it is invalid or unimportant, writes Rutherford.

How to Argue with a Racists strongest suit is to encourage a general conversation about race, informed by the latest science on the reality and origins of racism. Researching ethnicity has often been career death, but Rutherford says scientists shouldnt shy away from the field. Nor should writers, to judge by his mission.

For many, race is a cry for identity and belonging. In 2018, when groups of neo-Nazis in the US chugged milk to supposedly demonstrate their superior, genetically encoded ability toprocess lactose, they were trying to assert their white identity, writes Rutherford.

He rather undermines such anassertion by revealing that thegene mutations that enable lactose processing arent unique to people of European descent. They also exist today in Kazakhs, Ethiopians, Tutsi, Khoisan and in many places where dairy farming took off as part of agriculture.

Chugging milk is a theatrical gesture, but as Rutherford points out, we increasingly turn to ancestry and genetic testing toreaffirm our human tendency to seek meaning and identity.

I can relate to this. My surname, Liverpool, comes from an ancestor on my fathers side, forcibly shipped from West Africa to the Caribbean via Liverpool, UK, during the transatlantic slave trade. But as Rutherford points out, the number of children produced by sex between enslaved peoples, and between the enslaved and their owners, makes it virtually impossible for a genetic test to establish an African country of origin for the descendants of slaves.

Instead of arguing against thelogic of marrying identity toancestry, Rutherford elegantly uses a bit of mathematics to showhow our whole way of thinking about ancestry is wrong.

He assumes generational time is 25 years and that the number ofancestors for each person in every generation has doubled. Sowe each have two parents, fourgrandparents, eight great-grandparents, and so on. In 500years, or 20 generations, that is 1,048,576 ancestors. Go back 1000 years, and each of us has more than a trillion ancestors: 10 times more people than ever existed.

The notion of a family tree isnt the most scientifically accurate metaphor, he writes, because trees only ever branch, but family trees contain loops, with the same person appearing at multiple positions in the tree, for example, as a result of first cousins having children. Understanding that we are all more closely related to one another than we think is a pretty strong argument against racism.

Is any of this enough to convince hard-liners? Maybe not.As Rutherford writes: Thecommercial genetic testsremain scientifically unconvincing. Regardless, the utility of consumer genetic testing is now a major and significant part of white supremacy discourse.

But in many ways How to Argue with a Racist isnt really about arguing with hard-liners. Its target is the surprisingly prevalent set of racist beliefs, from men of certain groups having larger or smaller penises than average to people from different racial groups being more or less intelligent than average. The way we generally speak about races does not align with what we know about those innate differences between people and populations, says Rutherford.

For example, the largest study of penis size, including more than 15,000 men, found no evidence that the organs length or girth correlates with any particular population, racial category or ethnicity, while intelligence is a complex trait influenced by a score of genes and their interaction with our environment.

Rutherford hunts widely to account for the persistence of suchracist ideas. But in the end, hefaces down the biggest issue atthe core of many of these raciststereotypes: is race truly abiological classification?We are constantly told that it is asocial construct, but scientists muddy the waters by appearing tocontradict this as they perhaps carelessly mention both race and ethnicity in their research papers.

Rutherford is clear that the majority of geneticists think genetic differences between ethnic groups are meaningless interms of behaviour or innateabilities. But he also acknowledges the contradiction because scientific papers are still published in which genes for complex traits like intelligence seem stratified along racial lines.

Race science is pseudoscience, but genetics and evolutionary research are inextricably tied up with race, and are often used by racists to justify themselves. Rutherford accepts that the field ofhuman genetics has a dark history, founded by racists in a time of racism, but also argues that genetics has demonstrated the scientific falsity of race.

He writes that scientists reluctance to express views concerning the politics that mightemerge from human genetics is a position perhaps worth reconsidering. After all, he argues, those who misuse science for ideological ends show no such restraint, and embrace modern tech to spread their messages.

More on these topics:

Original post:
How to Argue with a Racist smashes race myths that plague society - New Scientist News

Amid concerns over gene mutations going undetected due to the variety of medical devices and test reagents in use, a Japanese organization has drawn up guidelines for standard procedures and frameworks to ensure that genetic tests are reliable.

The Japanese Committee for Clinical Laboratory Standards published the guidelines after studying international standards as well as guidelines and articles at home and abroad. The guidelines stipulate what staff are required, the records that need to be kept and the correct way to check instruments and reagents.

JCCLS consists of representatives from companies and academic societies with a focus on disease diagnosis and treatment.

The guidelines also call for hospitals and other medical facilities analyzing test results to compare the results with those from other institutions to ensure precision.

The move comes as an increasing number of people are opting to have their genes checked on being diagnosed with an intractable disease or in order to select an appropriate cancer treatment.

In collaboration with the committee, the Japan Accreditation Board, which evaluates abidance to international standards across various fields, has launched work to recognize institutions that carry out genetic testing in line with the new guidelines.

Accreditation is subject to passing on-site investigations and practical exams.

"Producing a correct result is key to safe, secure medicine," said Hayato Miyachi, a Tokai University professor who is involved in crafting the guidelines. "I believe the guideline will play a major role."

Read the original:
Organization crafts genetic testing guidelines to ensure reliability - Japan Today

By Tom Anderson

As the elections kick into high gear, the Florida statehouse in Tallahassee finds itself awash in millions of dollars in campaign money channeled through a network of shadowy political action committees whose backers and agenda are too often are too often concealed from the public.

The number of these types of groups in Florida has been on a steady rise since 2013, when then-Governor Rick Scott and the state legislature legalized these groups, despite warnings from public-integrity experts that they would corrupt elections and policy debates.

The groups, often bearing benign names like Floridians for Economic Freedom, operate with minimal oversight as they raise and spend unlimited amounts of money that are difficult to trace back to their original sources.

To be sure, these committees, or PACs, are required to disclose basic facts, including their mission and the candidates and issues that the groups support financially. But government watchdog groups point out that the information disclosed is so basic that it is often impossible to determine who actually benefits from the creation of the groups, who exactly is driving the agenda of the groups, and the precise reasons for the expenditures of the groups.

Consider a current case involving what, on the surface, appears to be a grassroots effort to alert Floridians about the apparent risks of genetic information in the hands of life insurers and long-term care insurers.

The effort has many trappings of a full-blown campaign, including a Facebook page, digital advertisements and a website, Protecting Our DNA, that offers the latest news on genetic privacy, discusses laws and legislative proposals to regulate the use of genetic testing by insurers, and urges voters to sign a petition.

But many important questions remain unanswered about this campaign, particularly since it turns out that it is backed by the powerful incoming House speaker, Chris Sprowls, as well as a largely opaque PAC he runs that has raised more than $4.2 million since 2015 and that currently has $1.8 million in its coffers.

The group, Floridians for Economic Freedom, is an unlikely player in the debate over the ethical, commercial and legal implications of genetic testing, in large part because its stated mission is to support or oppose candidates for statewide, multi-county, legislative, county and municipal office and other activities not prohibited by Chapter 106 F.S.

And so, exactly why it involved itself in this effort is unclear. It is also unclear whether any of the groups big-money donors pushed it to launch the genetic campaign, how much money the group is spending on the campaign and who comprises the movement the campaign suggests it represents.

This kind of information is indispensable to the public given the political and policy stakes involved. Its one thing, for example, if the grassroots campaign is a mere vanity project of the incoming speaker, who has used the issue of genetic testing to garner media coverage. Its quite another thing if there are special interests behind the campaign, including business rivals of the insurance industry.

The impact of these groups has become so pervasive that Joe Gruters, the state GOP chairman, recently raised sharp concerns that the states campaign finance system has contributed to the proliferation of so-called dark money by allowing donations to flow from one opaque committee to another in manner that often masks the identity of the original donor.

It is the political equivalent of money laundering, albeit a legal one. Imagine, for example, that a real estate development company decides it wants to unseat a local lawmaker opposing one of the developers major projects. In this case, the development company does not want its role in trying to unseat the lawmaker from being discovered.

So how does the development company go about putting its secret plan into action? Thanks to the states murky network of PACs, there are more than a few ways, especially since several committees can be run by the same person.

The company could, for instance, donate $30,000 to a hypothetical committee called Floridians For Prosperity. The donation then could be transferred to another committee called Citizens for Economic Growth, which can in turn transfer the money to Save Floridas Future. In the end, the last committee to receive the money is free to invest it in, say, advertising attacking the targeted lawmaker with little risk of exposing the development companys role.

Right now, legislators cant take a cup of coffee from a lobbyist without breaking the law, Gruters, a state senator from Sarasota, recently told the Orlando Sentinel. But here, someone can run $50,000 through the process and use it against you or on your behalf and no one will know. It makes a mockery of the system.

Tom Anderson is a public-integrity expert and investigator and resident of Florida

Link:
Florida's PACs: A Murky Network of Influence - The - The Floridian

With help from Darius Tahir (@dariustahir)

Editor's Note: This edition of Morning eHealth is published Mondays, Wednesdays and Fridays at 10 a.m. POLITICO Pro eHealth subscribers hold exclusive early access to the newsletter each morning at 6 a.m. Learn more about POLITICO Pro's comprehensive policy intelligence coverage, policy tools and services at politicopro.com.

Advertisement

Jonathan Bush's take on the Epic feud: Bush chatted with POLITICO about privacy, his new board position at Innovaccer and the upcoming interoperability rules.

Apple, Microsoft support API provisions: The tech giants are among more than two dozen signatories on a letter urging HHS to allow API access to patient records in the department's upcoming interoperability rules.

FCC's $20B broadband fund advances: Commissioners on Thursday voted to set rules surrounding a planned subsidy fund supporting broadband in remote areas.

eHealth Tweet thread of the day: Stephanie Hughes @stephanie_h "Had never heard the words 'ambient biometric data' all in one place until I heard @natashanyt say them in an interview with @stewart_jack. Now I'm going to use them all the time."

Natasha Singer @natashanyt "For context: we were discussing Alexa, Ring and other technologies that can collect voice/facial data from visitors/passersby who may not know about, and did not consent to, the surveillance."

It's FRIDAY at Morning eHealth. What stories are flying under the radar as we brace for the interop rules? Keep us posted at mravindranath@politico.com. Tweet the team at @arthurallen202, @dariustahir, @ravindranize, @POLITICOPro and @Morning_eHealth.

BUSH CALLS EPIC'S HHS CAMPAIGN 'INDISPUTABLY CYNICAL' HHS' upcoming data sharing rules could loosen electronic health record companies' control over patient information, arousing fierce opposition from some health leaders. But for Jonathan Bush the firebrand founder of athenahealth the rules offer an opportunity not just to help patients, but also to dream up new businesses.

Bush says Epic's opposition to the rules is "indisputably cynical" and he said as much in an email to CEO Judy Faulkner, although the email bounced. (An Epic spokesperson says Faulkner's email is functioning, but did not confirm that she'd received the message.) "I think of you as a good person who wants good things in healthcare....I am losing my grip on that assumption. Please reconsider," Bush wrote.

Faulkner has said the rules, which would make it easier for patients to send their data to apps outside their providers' systems, don't do enough to prevent third parties from exploiting their data. Critics, like Bush, say the company is protecting its own interests.

"Consumers are NOT as dumb as you think they are," Bush told Morning eHealth in an email, noting that in this new data-sharing landscape, patients can send their records to new services that aggregate data and recognize patterns in a way that health systems can't. It could also open the door to companies like Firefly Health, a venture-backed primary care company where he's executive chairman.

"I would fight and die to protect Judys right to behave in an aggressive competitive manner to prevent other entrepreneurs to enter her space," Bush said, but "that falls short of using control of the law/regulatory system."

... Bush also chatted with us about what he's been up to since he stepped down from athenahealth in 2018. In addition to his role at Firefly Health as executive chairman, he recently joined the board at Innovaccer, which sells software to help engage patients, manage pediatric populations, and connect patients to social determinants of health services, among other products.

It's the underlying software platform at Innovaccer that interested Bush, he told us. "For every field, they go through and say, 'what is extractable out of this?' ... They map it to a common data model that anybody later on can come and write apps to [and pull that data]."

That's something he tried and failed to do at athenahealth. "[B]ut we had older architecture and, frankly, we didn't have a business model that justified all that mapping. I ended up spending so much on R&D that I attracted an activist [investor]. Athena had a common data model for claims or insurance rules or insurance package benefits, but we were never able to get a common data model for a medical record. We were in the middle of it and we got shot down."

Your author also asked him what the app economy might look like if the rules are finalized. These days "it's hard for developers to get this data because of sclerosis," he said, referring to lack of common data standards or widely adopted mechanisms for that exchange. Over time, he expects more API-first platforms that developers can use to access data, and that charge very little money. Once data sharing does become standard, "they would be very profitable because they don't have to manually force things through," he said, adding that when he left athenahealth in 2018, "there were still 35 people whose job it was to manually put an ink signature on a paper claim."

APPLE, MICROSOFT SIGN LETTER TO OMB ON APIs Tech giants Apple and Microsoft are on board to get API access into HHS' final interoperability regulations, having signed on to a Thursday letter to OMB with more than two dozen co-signatories.

The letter runs through the standard arguments for API access that itll allow patients to better direct their care and enable better technology and boasts companies like Aledade and Ciitizen as well as the American Academy of Family Physicians as signatories, in addition to the tech giants.

... OpenNotes, an initiative promoting patient access to their doctors' visit notes, sent its own letter to OMB. "A growing evidence base indicates that patients who have access to their full medical record, including the notes their clinicians compose following office visits, report better understanding of their health and illness, feel more in control of their health care decisions, and are able to identify important errors and inaccuracies in their records," they wrote.

FCC BROADBAND PLAN ADVANCES DESPITE OBJECTIONS Agency Chairman Ajit Pai said auctions for broadband buildout subsidies should begin later this year, following this week's vote by commissioners to set rules for the $20.4 billion fund. Pai said the Rural Digital Opportunity Fund would "permanently change the broadband landscape in America for the better."

Telehealth advocates have warned that while virtual care could help patients access care in remote areas with clinician shortages, hospitals don't always have the broadband connectivity to support the technology.

The proposal wasn't without detractors. Commissioners made changes to a letter of credit requirement in an attempt to quell telecom industry concerns, but Democratic commissioners partially dissented over other unresolved spats, Pro Tech's John Hendel writes.

Commissioner Jessica Rosenworcel, for instance, said the proposal relies on flawed broadband mapping, uses "stale" proposed speeds and cuts New York state from eligibility due to its earlier subsidy arrangement with the commission.

Republicans dismissed New York's concerns, which GOP commissioner Mike O'Rielly called "self-serving." And flawed mapping, the commission majority said, still accurately shows the unserved areas targeted in phase 1 of the program.

FLORIDA HOUSE PASSES GENETIC TESTING BILL The Florida House this week passed a bill to prohibit life insurance and long-term care companies from using genetic information when setting prices, our POLITICO colleague Alexandra Glorioso reports.

Speaker-designate Chris Sprowls' bill, FL HB1189 (20R), would stop those industries from using genetic testing data when setting premiums; state law already bars health insurers companies from doing so. The bill is now in position to head to the Senate for a hearing.

A Senate companion, FL SB1564 (20R), was amended Tuesday to allow life insurance and long-term care companies to use genetic information if it's included in a patient's medical record.

The House bill "prioritizes the genetic privacy of Floridians over the desires of big insurance companies who want to deny coverage or charge higher premiums using peoples DNA," Sprowls said late Tuesday.

TELEDENTISTRY FIGHT RESUMES California state lawmakers will consider a bill this year that would require dentists to conduct in-person exams before approving orthodontic treatment, our colleague Alexander Nieves reports. The bill, CA AB 1998 (19R), by Democratic Assemblyman Evan Low, escalates a fight between teledentistry companies and dentists that began last year with legislation requiring in-state dentists to examine X-rays.

The teledentistry model keeps prices low by eliminating in-person exams, Alexander writes. Companies such as SmileDirectClub have storefronts in California, but consumers never meet the doctor prescribing their aligners. Under the bill, a patient couldn't see a local dentist and then get aligners in the mail from a different dentist via a teledentistry company.

California is proud to be the incubator of innovation but we cannot sacrifice patient health and safety in exchange for making billionaires out of tech bros, Low said in a statement. The industry should view AB 1998 as a sign that the Legislature is serious about requiring meaningful safeguards if these questionable and controversial business practices are allowed to continue.

Eran Segal writes in Nature about using detailed data about microbiomes, genomes, physiological measurements and other characteristics for drug design, potentially reducing the cost of drug discovery.

Stat's Sharon Begley writes about the Boston Biotech Working Group's efforts to fix the gender imbalance in biotechnology.

Continue reading here:
Jonathan Bush's take on the Epic feud - Politico

DUBLIN--(BUSINESS WIRE)--Jan 30, 2020--

The Molecular Diagnostics Market Share & Global Forecast, By Application, Technology, End User, Regions, Companies report has been added to ResearchAndMarkets.coms offering.

Increasing prevalence of Infectious diseases such as Influenza, HPV, Hepatitis, HIV and Tuberculosis despite rise in sanitation practices globally. In the past, antimicrobials medicines were used to fight powerful infectious disease but slowly in todays time antimicrobial agent is not able to give the desired results because the problem of drug resistant occurs in many people across the world.

Nowadays, a new diagnostic procedure is being followed to fight infectious disease like molecular diagnostic test is very effective which is quite fast and precise. The number of cancer patients is increasing very fast, so it is believed that in the coming time the molecular diagnostic test market will be growing at rapid pace. Global Molecular Diagnostics Market is likely to surpass US$ 22.5 Billion by the end of year 2025.

There are various reasons that will propel the market growth in forecast year; rising incidence rate of infectious disease, increasing incidence rate of cancer of all type, increasing people awareness regarding molecular diagnostic, rapid technological growth, widely acceptance of personalized medicine, rising healthcare infrastructure, increasing healthcare per capita expenditure across the developed and developing nation, accuracy of diagnosis, growing population of cardiovascular and neurological disorder etc. In addition, increasing prevalence of genetic disorder will further boost the market in forecast period of time.

The report titled Molecular Diagnostics Market Share & Forecast, By Application (Infectious Diseases, Blood Screening, Oncology, Genetic Testing, HLA (Tissue Typing), Microbiology, Cardiovascular Diseases, Neurological Diseases, Pharmacogenomics and Others), By Technology (PCR, Transcription-Mediated Amplification (TMA), Hybridiazation (In-situ Hybridiazation & FISH), DNA Sequencing & NGS, Microarray and Others), By End User (Hospitals & Academic Laboratories, Clinics and Commercial Laboratories, Others), By Regions [United States, Europe (Expect Russia), India, China, Japan, Brazil, South Korea, Mexico, Russia and ROW], Companies (Roche, Abbott, Myriad Genetics, Qiagen, BioMrieux and Others) provides a complete analysis of Molecular Diagnostics Market.

Market Insight by Application

The report provides comprehensive analysis of molecular diagnostic test market by application into ten parts: Infectious Diseases, Genetic Testing, Blood Screening, Oncology, HLA (Tissue Typing), Microbiology, Neurological Diseases, Pharmacogenomics, Cardiovascular Diseases, and Others. This report also provides key opportunities market and specific factors are given by each application market.

Market Insight by Technology

Here the market is fragmented into six parts; PCR, Transcription-Mediated Amplification (TMA), Hybridiazation (In-situ Hybridiazation & FISH), DNA Sequencing & NGS, Microarray and Others. Besides, many factors are analyzed that influence the growth, challenges and opportunities of market in technological context.

Market Insight by End User

The report provides complete insight of market by End User segments: Hospitals & Academic Laboratories, Clinics & Commercial Laboratories and Others. According to the publisher, Hospitals & Academic Laboratories will hold the largest market in global molecular diagnostic test market in forecast period of time.

Market Insight by Regions

This report covers the complete regional profile by 10 geographical market; United States, Europe, India, China, Japan, Brazil, South Korea, Mexico, Russia and Rest of World (ROW).

Key Topics Covered:

1. Executive Summary

2. Global Molecular Diagnostic Market

3. Market Share - Global Molecular Diagnostics

3.1 By Application

3.2 By Technology

3.3 By Countries

3.4 By Companies

4. Application - Molecular Diagnostics Market

4.1 Infectious Diseases

4.1.1 Hospital Acquired Infections (HAI)

4.1.2 HIV / HCV Testing

4.1.3 STD Testing

4.1.4 HPV Testing

4.2 Blood Screening

4.3 Oncology / Cancer

4.3.1 Breast

4.3.2 Colorectal

4.3.3 Prostate

4.3.4 Others

4.4 Genetic Testing

4.5 HLA (Tissue Typing)

4.6 Microbiology

4.7 Cardiovascular Diseases

4.8 Neurological Diseases

4.9 Pharmacogenomics

4.10 Others

5. Technology - Molecular Diagnostics Market

5.1 PCR

5.2 Transcription-Mediated Amplification (TMA)

5.3 Hybridiazation (In-situ Hybridiazation & FISH)

5.4 DNA Sequencing & NGS

5.5 Microarray

5.6 Others

6. Region - Molecular Diagnostics Market

6.1 United States

6.2 Europe

6.3 India

6.4 China

6.5 Japan

6.6 Brazil

6.7 South Korea

6.8 Mexico

6.9 Russia

6.10 Rest of World (ROW)

7. End Users - Molecular Diagnostics Market

7.1 Hospitals & Academic Laboratories

7.2 Clinics and Commercial Laboratories

7.3 Others

8. Roche Diagnostics - Company Analysis

8.1 Merger & Acquisitions

8.2 Sales Analysis

9. Abbott Laboratories - Company Analysis

9.1 Merger & Acquisitions

9.2 Sales Analysis

10. Myriad Genetics - Company Analysis

10.1 Merger & Acquisitions

10.2 Sales Analysis

11. Qiagen - Company Analysis

11.1 Merger & Acquisitions

11.2 Sales Analysis

12. BioMrieuxs Inc - Company Analysis

12.1 Merger & Acquisitions

12.2 Sales Analysis

13. Market Drivers

13.1 Various Developments in the Molecular Diagnostics Landscape

13.2 Integral to Traditional Labs

13.3 Improved Assay / Test Efficiencies

13.4 Targeting Antibiotic Resistance

13.5 Next Generation Ultrasensitive Molecular Diagnostics

13.6 Increasing Investment in Genomics & Proteomics Research

13.7 Technological Advances in Molecular Diagnostics

13.8 Increasing Acceptance of the Personalized Medicine

13.9 Growing Molecular Diagnostics for Food Safety

14. Challenges

14.1 Dearth of Trained Professionals

14.2 Regulatory Issues

14.3 Various Factors Slowing Growth of Molecular Diagnostics

14.4 Reimbursement Capabilities

14.5 Quality Checkpoints, Awareness & Acceptance

For more information about this report visit https://www.researchandmarkets.com/r/j3on5s

View source version on businesswire.com:https://www.businesswire.com/news/home/20200130005474/en/

CONTACT: ResearchAndMarkets.com

Laura Wood, Senior Press Manager

press@researchandmarkets.com

For E.S.T Office Hours Call 1-917-300-0470

Read the original post:
Global Molecular Diagnostics Market is Likely to Surpass US$ 22.5 Billion by the End of Year 2025 - ResearchAndMarkets.com - Associated Press

From NFL Hall of Famer Kurt Warner leading a recognition service for cancer caregivers during the Super Bowl to Tylenols key ingredient possibly being added to Californias proposition 65 list for chemicals that may cause cancer, heres what is making headlines in the cancer space this week.

We understand that they take their own journey, said Warner in a press release. They take on their own pain. They take on their own suffering. They are unselfishly giving of themselves in so many ways solely to have impact on so many that they are caring for.

Participants in the 30 Days of Cancer Prayer event are sent daily cancer prayer videos by phone, email or Facebook by well-known Christians, like Warner. The range of topics discussed and prayed over in the videos include finances, chemotherapy and multiple tumor types.

We live in a society where I feel like so many give simply due to an expectation of what they are going to receive, Warner explained. With caregivers we know that there is very little that they receive. That it is so much giving.

TrialJectory announced a new partnership with specialty cancer diagnostics companyPrecipio, Inc., to provide patients with cancer worldwide with a first-of-its-kind diagnostic and clinical trial-matching service combining the companies platforms.

While this partnership offers enormous benefits for both patients and physicians, it ultimately allows patients to take back control of their health and empowers them to make decisions that are right for them based on accurate information from advanced new technologies, said Tzvia Bader, TrialJectorys CEO and co-founder, in a press release.

TrialJectory is an A-based clinical trial matching platform that helps facilitate clinical trial searches and enrollment for patients with cancer and their physicians. Precipio is a platform that helps to create accurate diagnostic platforms by using all of the data from academic institutions, and providing that information to patients and physicians. The two combines are looking to their merger to help patients throughout the entirety of their cancer journey, from diagnosis to treatment.

Not only are patients entitled to receive an accurate diagnosis at the start of their battle with cancer, but they also deserve access to match and enroll in the best clinical trials available for their unique situation without having to struggle through the complex matching and enrollment process, explained Ilan Danieli, CEO of Precipio.

Five years after a group of patients were given synthetic psilocybin, the psychedelic compound of magic mushrooms, to help with cancer related depression and anxiety new research shows that they are still feeling the positive effects.

In the initial 2016 study, 80% of the patients reported their symptoms faded and the effects lasted up to 6 months a landmark finding at the time. In the follow up study, which included 15 patients, 80% were still experiencing significant improvement in their cancer-related depression and anxiety and nearly all of them attributed it to the psychedelic-assisted therapy.

Its a powerful experience that creates a lasting memory that involves them dealing with the demons of their cancer or their mortality, explained Dr. Stephen Ross, director of addiction psychiatry at New York Universitys Langone Medical Center, who led the 2016 study and co-authored the new research.

Although some patients in the follow up study noted the return of social anxiety, their fear of their cancer and own mortality did not.

Next Generation Sequencing for people with inherited ovarian or breast cancer will now be covered by the Centers for Medicare & Medicaid Services (CMS).

We recognize that cancer patients shoulder a heavy burden, so were leaving no stone unturned in supporting womens health and getting all patients the care, they need, stated CMS Administrator Seema Verma in a press release. Next Generation Sequencing testing provides clinically valuable information to guide patients and physicians in developing a personalized treatment plan.

Patients with inherited ovarian and breast cancer have a limited number of treatments, and for patients on Medicare even more so. Now, patients will have access to the genetic testing that allows patients access to personalized treatments that can better target their cancers.

This spring, California lawmakers will hold a public hearing to determine whether acetaminophen, the key active ingredient in Tylenol, should be added to the states list of chemicals that are known to the state to cause cancer or reproductive toxicity.

This falls under the states Proposition 65, otherwise known as the Safe Drinking Water and Toxic Enforcement Act of 1986. The list includes arsenic, asbestos, cocaine, coke oven emissions, wood dust and over 900 other chemicals. However, acetaminophen marks a major possible addition to the list as its a key ingredient in drugs meant to relieve pain or reduce fever.

In addition to Tylenol, acetaminophen is also found in other over-the-counter medications, such as Alka-Seltzer Plus Liquid Gels, Dayquil, Dimetapp, Excedrin, Midol, Nyquil, Sudafed and Theraflu.Cancer risk associated with acetaminophen have only been associated in animal studies where mutations have been observed and indirect evidence in other studies where further study is ongoing. The Food and Drug Administration has not seen fit to issue a warning.

Continued here:
Friday Frontline: Cancer Updates, Research and Education on January 31, 2020 - Curetoday.com

You wouldnt know that Lynda Marino has a serious heart condition, save for the scar that ends near the top of her breastbone.

Marino, 40, a busy mother of two young children, is tall, slender and outgoing and fortunate to be alive.

She was diagnosed in her mid-20s with cardiomyopathy, nearly died from cardiac arrest four years ago and weathered open-heart surgery on New Years Eve at the Cleveland Clinic.

Her sister, 35-year-old Marianne Potratz, has the condition that thickens and endangers heart muscle, too.

We don't look like the average people you might expect to have heart disease, Marino said.

The two sisters have become leading advocates for the Buffalo Niagara affiliate of the American Heart Association during the last few years, not so much because their condition is rare but because heart disease is so common.

They dont want themselves or you to become another statistic for the No. 1 killer in the nation.

Cardiovascular disease can take a life suddenly or over time, at any age. Those stricken young often have a genetic predisposition like Marino, who lives in East Amherst, or Potratz, of Grand Island, but the Heart Association estimates that 80 % of cases can be prevented with healthy living and decision-making.

You need to eat right, exercise regularly and talk with your primary care provider about your family history of heart disease. Health care visits and screenings are important as often as your provider recommends, said Dr. Vijay Iyer, chief of cardiovascular medicine in the University at BuffaloJacobs School of Medicine and Biomedical Sciences.

Nobody should get to the age of 25 without knowing their blood pressure and their cholesterol numbers, he said.

Action saves lives when it comes to heart disease

Ignorance is hardly bliss when it comes to heart disease, either.

High blood pressure and even diabetes, for example, often don't manifest themselves till theyve gone too far, said Iyer, who also directs structural heart interventions at Gates Vascular Institute and the complex valve clinic at Buffalo General Medical Center.

Most of the early symptoms can be very subtle or there may be no symptoms at all, he said. People could have had hypertension for a long time, and slowly built blockages in the arteries, and the first time they show up is in the hospital when theyve had a heart attack or had a stroke so not knowing about your physical condition, your medical history, can be quite deleterious. It can be potentially fatal.

Lynda Marino, left, and her sister, Marianne Potratz, right, walk with their mother, Susan Minbiole, near the house where they grew up in East Amherst. Genetic testing after Marino suffered a cardiac arrest in 2015 showed that the sisters and their father, Barry Minbiole, have a genetic mutation that predisposes them to cardiomyopathy, a heart condition that must be closely monitored. (Robert Kirkham/Buffalo News)

It can be easy to take health for granted, particularly when you lead a busy life.

Marino knows. She learned she had cardiomyopathy in 2006, while in her mid-20s, when she was diagnosed with pneumonia. Her primary physician ordered a chest X-ray that showed signs of the condition, which thickens the heart walls, hampers blood flow and sometimes damages valves.

Marino was encouraged to see her doctor regularly, limit her exercise to moderate levels and eat right. She also was urged to be mindful of dizziness or extreme fatigue two signs of disease progression.

In the years that followed, she felt fine. She and her husband, John, chief technical officer in the Cleveland Hill School District, started a family. She also landed a job as marketing director with Canterbury Woods retirement communities.

Things changed unexpectedly on Sept. 12, 2015, when Marino went into cardiac arrest while driving home from T.J. Maxx and Aldi in the Town of Lockport.

I had a newborn son at home, she said. I had a 2-year-old daughter. I worked full time. Who knows what I was feeling, or just ignoring, beforehand because life was so insane.

Her right foot slipped off the gas as she slumped past the steering wheel onto the console. The car crawled south on Transit Road at 5 mph, while her daughter, Claire, cried frantically in a car seat behind her.

Thats when the miracles started happening, she said, recounting what others since have told her.

Chris James, a fellow motorist, saw what was happening, stopped his car, ran to the side of Marinos Forester SUV and was able to open the door because it didnt have automatic locks. He directed the car to the side of the road, turned off the ignition and called 911.

Bill and Peggy Killewald watched the commotion across four lanes of traffic while Bill, a retired veterinarian, pumped gas at a NOCO station. The couple ran to Marino, whose electrical impulses to her heart had stopped.

When Bill was doing CPR, he said I had no pulse, she said. My lips were blue and he, as a doctor, thought I was gone.

A Niagara County sheriffs deputy armed with an automated external defibrillator next joined the life-saving effort. At the time, the department was one of few in regional law enforcement that equipped its patrol cars with AEDs. Had she driven a few miles south into her home county, her odds of survival would have been worse.

Rescue workers rushed her first to Lockport Memorial Hospital, then Buffalo General, where she spent four days in an induced coma to help her recuperate.

In the coming weeks, both she, her sister and parents were tested for a gene mutation that predisposes people to cardiomyopathy.

Both sisters already knew they had the condition, confirmed through echocardiograms years earlier. They now learned they had the mutation, along with their father, Barry, 68, a retired Praxair engineer.

Nobody should get to the age of 25 without knowing their blood pressure and their cholesterol numbers, says said Dr. Vijay Iyer, a cardiologist at Gates Vascular Institute and Buffalo General Medical Center, as well as chief of cardiovascular medicine in the University at Buffalo Jacobs School of Medicine and Biomedical Sciences. (John Hickey/News file photo)

Several weeks later, surgeons at Buffalo General implanted defibrillators and pacemakers into Marino and Potratz, who have since called themselves the Sling Sisters because they needed to wear left arm supports for six weeks as they recovered.

The regional American Heart Association affiliate offered them support along the way, which is why they now share their stories as part of the Go Red for Women campaign, which encourages women to know their cardiovascular risks and take action to reduce them.

They were discouraged from eating too much salt, fatty meat and processed foods, running marathons or lifting heavy weights. They were encouraged to walk for exercise, eat more fruits, vegetables and seafood, and drink plenty of water.

Heart Association staff also encouraged the sisters to know their health screening numbers, particularly blood pressure, cholesterol, blood sugar, weight, and any sudden increases in fluid retention.

Both women also were put on beta blocker drugs to help regulate their heart rhythms.

We live very normal lives, Marino said, or at least I did for a couple of years.

She and her sister returned from a trip to Iceland and Paris in late 2018 and Marino began to experience more dizziness, shortness of breath and chest pressure when exerting herself. She led a nearly yearlong effort to find the best solution to removing substantial muscle scarring on her heart, and secure health insurance approval.

On New Years Eve, a cardiomyopathy team at the Cleveland Clinic performed an extensive myomectomy, slicing nearly a half ounce of damaged muscle from Marinos heart nearly twice as much as generally creates urgency for such open-heartsurgery.

Before this procedure was perfected, the only alternative was a heart transplant, said the sisters' mother, Susan Minbiole.

From left, Lynda Marino, Susan Minbiole and Marianne Potratz have become key supporters of the Go Red for Women campaign, which encourages women to know their cardiovascular risks and take action to reduce them. (Robert Kirkham/Buffalo News)

Marino hasnt been able to drive or lift anything heavier than a milk carton since her surgery. She has returned to the Cleveland Clinic twice since surgery and will do so less often going forward. She also continues to work with cardiologists and electrophysiologists in Buffalo.

The Minbiole family always has been tight. Marino lives just a few blocks from her parents, while Potratz and her husband, Seth, also are regulars at family gatherings that have taken on greater meaning in recent years. Family members vacation together more regularly, and their gratitude and giving has taken on greater proportions.

Friends and family members became part of the Sling Sisters team that has become a force in regional Heart Association fundraisers.

The experience also helped underline the importance of family, community and preparedness when it comes to good health.

We really promote hands-only CPR because my life was saved in part by bystanders, complete strangers, that jumped in to help me, Marino said. You could be someone else's hero by learning CPR or suggesting your friend go see the doctor because you're hearing her complain about an ache in her arm or other symptoms of heart disease.

The sisters are CPR-trained and, because there is little research on cardiomyopathy, Marino has enrolled in a Yale University study on exercise for those with the condition.

Meanwhile, they and their families marvel at medical advances that help Marino and Potratz stay on top of their challenges.

Marino has a device similar to an Apple Watch that can take an EKG, and both sisters have another device, half the size of a toaster, that takes heart readings from their pacemakers and defibrillators and transmit them by cell signal to health specialists in the event of an unusual reading.

The pacemaker and defibrillator will always be there to protect against any future cardiac arrest, Marino said. It doesn't stop it from happening, but it would stop it from killing me.

They hope more advances will come in the future and work toward that end in part because Marinos now 6-year-old daughter and 4-year-old son, Logan, also have the MYBPC3 gene mutation that predisposes them to the same condition.

As is the case for everyone, the sisters said, its better to know something like that than not.

Some say ignorance is bliss, Potratz said, but in my case, knowing that I'm protected is far more valuable than not having the information at all.

WNY's unhealthy habits could stunt economic growth, study says

Follow this link:
Two sisters, one near-death experience, and a warning about heart disease - Buffalo News

Ahead of Rare Disease Day, here is what you need to know about pheochromocytoma and paraganglioma, two rare types of tumors.

BY Kristie L. Kahl

In pheochromocytoma, the tumor originates from chromaffin cells in the inside portion of the adrenal gland (a small gland that makes steroid hormones like adrenaline, and noradrenaline). A neuroendocrine tumor is one that forms from cells that release hormones into the blood in response to a signal from the nervous system and may make higher-than-normal amounts of hormones.

Paraganglioma, which are closely related to pheochromocytoma, allows the nerve cells to form anywhere along the sympathetic and parasympathetic nervous systems. There are two types: chromaffin paragangliomas and nonchromaffin paragangliomas.

These two types of tumors can be benign in that the one tumor is surgically removed and does not spread or come back. However, some pheochromocytomas and paraganglioma can be metastatic.

Recent research, according to the Pheopara Alliance, shows that approximately one in 3,000 individuals have pheochromocytomas and/or paraganglioma.

(These tumors) are extremely rare, Dr. Daniel Pryma, division chief of Nuclear Medicine and Clinical Molecular Imaging at Penn Medicine, said in an interview with CURE. There are ones that are metastatic and ones that are non-metastatic, and it can be a difficult distinction. It's not like other cancers where you can tell on a biopsy which one is malignant, and which one is not. These are sort of, until they spread, in limbo.

Symptoms of the tumor types include:

To diagnose, a 24-hour urine test can measure the amounts of catecholamines (adrenaline or noradrenaline) or metanephrines in the urine, where an unusual amount of a substance can be a sign of disease in the organ or tissue that makes it. In addition, blood catecholamine studies can measure the amount of certain catecholamines into the blood. Moreover, CT scans, gallium dotatate scans (a procedure to detect areas of the body where cells are dividing rapidly), an MIBG scan (a procedure used to find neuroendocrine tumor), an MRI, PET scans, a plasma-free metanephrines test (a blood test that measures the amount of metanephrines in the blood) and a somatostatin receptor scintigraphy (a type of radionuclide scan that may be used to find tumors) can be used.

The tumors have a really, really well-developed blood supply and so they tend to bleed and also if you do anything to manipulate them, you can cause a huge release of hormones, which can be fatal, Pryma explained. So typically, biopsies are either not done or done with significant associated pre-medication and anesthesia. So very often these go straight to surgery.

Individuals can see an endocrinologist, a doctor who has special training in diagnosing and treating disorders of the endocrine system.

Of note, 30%-40% of those with pheochromocytomas and/or paraganglioma cases are hereditary. There is a 50% chance you can pass it down to your children if you carry a genetic mutation, the alliance noted in its website. If you are diagnosed with (pheochromocytomas and/or paraganglioma), discuss genetic testing with your doctor.

Currently, the only treatment for these tumor types is surgical resection. However, there are a few treatment options available to patients that cannot be operated on, or have tumor metastasis, according to the alliance, and there are more studies and research being done each year to find a cure. Azedra (iobenguane I 131) is currently the only medication approved by the Food and Drug Administration to treat these tumors.

Its a cancer but it behaves differently than many other cancers, Pryma said. It really shouldn't be treated the same way as cancer. We sometimes see patients who are diagnosed in a place that doesnt have expertise in it, and they sort of get this kitchen sink approach where they just try sort of generic things that work in cancers. (These therapies) really aren't effective and it ends up causing the patient more harm than good. So really getting that subspecialty information sooner rather than later is helpful.

For more information, visit pheopara.org.

More here:
The Basics of Pheochromocytoma and Paraganglioma - Curetoday.com

When Heather Woock was in her late 20s, she started researching her family history. As part of the project, she spit into a tube and sent it to Ancestry, a consumer DNA testing service. Then, in 2017, she started getting messages about the results from people who said they could be half siblings.

I immediately called my mom and said, Mom, is it possible that I have random siblings out there somewhere?' said Woock, of Indianapolis. She recalled her mom responded, No, why? Thats ridiculous.

But the messages continued, and some of them mentioned an Indianapolis fertility practice that she knew her mom had consulted when she had trouble conceiving.

Woock researched and finally learned the truth. Dr. Donald Cline, the fertility doctor her mother saw in 1985, is her biological father.

I went through an identity crisis, she said. I couldnt look in the mirror and think about, Where did my eyes come from? Where did my hair color come from? I didnt even want to think about any of that.

Woock hadnt known that her mom had used artificial insemination to conceive her, and neither of them knew the doctor had used his own sperm.

We now know Cline used his own sample and squirted it into my mom, Woock said.

In the 1970s and 80s, Cline deceived dozens of patients and used his sperm to impregnate them. He has more than 60 biological children and counting.

For Woock, as the story of her parentage sunk in, it was distressing for another reason: She wanted to start her own family and was having trouble conceiving. And now she needed to turn to the fertility industry that had so badly betrayed her mom.

We were doing all of the calendaring everything that is out there to help you get pregnant, we were doing that, Woock recalled.

But after six months, when she still wasnt pregnant at 32, she went to a fertility clinic for some tests.

I had to fill out all this paperwork, and theres a slot that says kind of like, Is there anything else youd like to share? Woock said.

Yes, there most certainly was.

The Odds Of Fertility Fraud These Days

New allegations of doctors using their own sperm keep coming to light because of genetic-testing services like Ancestry revealing networks of half siblings in states like Idaho, Ohio, Colorado and Arkansas.

But those doctors performed artificial inseminations decades ago. Could what happened to Woocks mom happen in a modern fertility clinic?

Dr. Bob Colver, a fertility specialist in Carmel, Indiana, said its a question many of his patients have asked. But its unlikely, he said. These days, there are more people involved in the process, and in vitro fertilization happens in a lab, not an exam room.

Unless youre in a small clinic where theres absolutely no checks and balances, I cant even imagine that today, Colver said.

Its now illegal inIndiana, Texas and California for a doctor to use his sperm to impregnate his patients. But theres no national law criminalizing whats called fertility fraud.

Fertility medicine has advanced a lot since the 1980s, but women trying to get pregnant today with the help of medicine face a baffling array of treatment options that can be hard to navigate and can be hugely expensive. And some critics say the growing, multibillion-dollar fertility industry needs more regulation.

For example, sperm banks may not get accurate medical histories from their donors, who could pass along genetic diseases. And theres no limit on how many times a donors sperm can be used, which some donor children worry could increase the chance of inbreeding. Sperm donation guidelines from organizations like the American Society for Reproductive Medicine are voluntary. There was a contestant onThe Bachelorette last year who said his sperm had helped father more than 100 kids.

Unrealistic Expectations

When Woock decided to get her first fertility treatment, she set preconditions with the clinic. She insisted on having a female doctor and insisted that a doctor be in the room for all appointments and oversee everything that happened.

Her experience with her clinic was very different from her mothers with Cline, but nonetheless there were surprises along the way.

The clinic told her that her problems conceiving could be because of husband Robs low sperm count and motility (meaning his sperm werent great swimmers). They advised a form of in vitro fertilization that involved injecting one sperm directly into one of her eggs in a petri dish.

When doctors told Woock she needed IVF, she felt pretty optimistic.

Im thinking going into this that our chances of success are 70, 75%, Woock said.

Fertility treatment can be really expensive, and patients may start treatment with unrealistic expectations. Thats because success rates are complicated, and some clinics use only the best numbers in theiradvertising.

For example, clinics can advertise high fertilization rates. But a 70% fertilization rate doesnt mean 70% of eggs turn into babies plenty can go wrong after the lab combines egg and sperm.

Success depends on your age, your clinic and the type of procedure you need. But most of the time, assisted reproduction procedures such as IVF dont work. The Centers for Disease Control and Prevention, which tracks assisted reproduction ratesin the U.S., reports only about 24% of attempts result in a baby.

Add-On Technology And Prices

When Woock started her first IVF cycle, she gave herself shots, a couple a day, to stimulate her ovaries to get multiple eggs ready at once. Multiple eggs means more chances for fertilization.

But the drugs have side effects. They gave her headaches and made her moody and less patient.

I was actually allergic to one of the medications, which just means that you keep taking it and deal with the itching and rash, Woock said.

But she hung on until it was time for a doctor to surgically retrieve her eggs, at which point patients can face even more choices. Because the couples fertility problem appeared to be with Robs sperm, the clinic offered to use a special device to help pick the best sperm for IVF.

We were kind of like, Yeah, why wouldnt you?' Woock said. If its gonna give us a better chance, do it.

A device like that is called an add-on. Add-ons are often new technology, described as cutting-edge, which can appeal to patients. Examples of add-ons include genetic testing for chromosomal abnormalities in embryos which some specialists argue improves the odds of a live birth and assisted hatchingandendometrial scratching, both methods claiming to facilitate implantation.

Jack Wilkinson, a biostatistician at the University of Manchester in England, researches add-ons, which he has found can increase costs and, he said, they may not work.

We quite often see theres no benefit at all, Wilkinson said. Or, possibly even worse, that theres a disadvantage of using that treatment.

Wilkinson said the device Woocks clinic offered could work, but the evidence supporting it is thin.

Failed Fertilizations

The clinic called Woock the morning after her egg retrieval. None of Woocks eggs fertilized. The procedure revealed that her husbands sperm quality wasnt the only fertility issue the couple faced.

They immediately saw that there was something wrong with my eggs, Woock said. My eggs are just total crap.

She underwent a second round of IVF with the same result no fertilization.

Getting that news the second time felt even more set in stone that this was going to be a very long, challenging road, Woock said.

Challenging and expensive. Most states, including Indiana, dont require insurers to cover fertility treatment. Without insurance, a round of IVF can cost more than $10,000 even more than $20,000 with no guarantee the patient will get pregnant.

Woock was lucky that her employer-provided insurance covered a lot. But it still wasnt cheap. She had to pay for some medications, plus, you have to pay lab and facility fees that insurance doesnt pay, Woock said.

Donor sperm and eggs arent generally covered, either. Those can be tens of thousands of dollars.

Woock faced a hard choice: After two failed attempts, did she want a kid enough to go through IVF again? She and her husband decided they did. So Woock did a third round of IVF. And then a fourth. When that didnt work, she gave up on using her own eggs.

What I expected as I was growing up and picturing my children is not what I will see, Woock said.

Woock and her husband decided to try donor eggs. If all goes according to plan, she could still carry a child. She wants to keep trying.

I realize that pregnancy is incredibly challenging on your body and your mental state, she said. If I can make it through a year of IVF, I can make it through morning sickness.

This story is part of a partnership that includes Side Effects Public Media, NPR and Kaiser Health News. The story was adapted from Episode 6 of the podcast Sick. You can hear more about the fallout from Dr. Donald Clines deception on Sicks first season, atsickpodcast.org.

Read the original here:
Conceived Through Fertility Fraud, She Now Needs Fertility Treatment - Kaiser Health News

Monday marks the beginning of the first Jewish Genetic Screening Awareness Week.

And, this being February, there are at least a dozen other awareness efforts just as there were in January and will be come March and the nine months that follow. February is, of course, the month in which we raise awareness about HIV/AIDS, Teen Dating Violence and screen for eating disorders, among a long list of other things.

Now comes Feb. 3-7, the week JScreen hopes will get us to focus on genetic screening and more specifically the need for people here and across the country to take charge of their health and any children they hope to have in the future. To kick things off, the Georgia Legislature is expected to pass a proclamation to highlight the effort midweek.

JScreen, you might recall, is a national nonprofit public health initiative dedicated to preventing Jewish genetic diseases. But the goal is to prevent diseases common in other ethnic groups as well, said Karen Arnovitz Grinzaid, an assistant professor of human genetics at Emory University and JScreens executive director.

The nonprofit, based at Emory University, began in 2010 as a pilot project in Atlanta and has since evolved into a national initiative offering affordable, accessible and comprehensive genetic screening.

RELATED |DeKalb couples personal tragedy becomes crusade for genetic testing

Since its national launch in 2013, Grinzaid said, JScreen has helped thousands, testing people from every state across the country and offering services remotely.

That means once you register for a genetic screen kit atjscreen.org, JScreen will mail the kit to your home. All you have to do is spit in a tube and mail the saliva sample to the lab. A genetic counselor will then report the results either by phone or secure video conference.

For people with health insurance, the cost, regardless of coverage, is $149 and includes the testing and follow-up genetic counseling. The self-pay price is $349.

While the focus is on the Jewish community, screening is encouraged for anyone planning to have a family, Grinzaid said.

JScreen screens for over 200 diseases. For most of these diseases, both parents must carry the same recessive gene in order for their children to be at risk.

So why an awareness week?

Were always trying to raise awareness, but by dedicating a week and calling this out, we can save lives, Grinzaid said. So many people dont hear about genetic screening until they show up pregnant in their doctors office. At that point, if they are a high-risk couple, they dont have as many options to help them plan ahead for a healthy baby. Genetic screening is something people should ideally do before they get pregnant.

Unlike other awareness campaigns, JScreens promises to be very purposeful, focusing each day on a specific theme in hopes that more people will take advantage of screening.

RELATED |A mother and her daughters bare all to help prevent breast cancer

On Monday, organizers will be laser focused on Tay-Sachs, a rare, inherited disorder that destroys nerve cells in the brain and spinal cord.

On Tuesday, theyll turn their focus to college students. While having a baby may be the farthest thing from any students mind, discounted screenings will be provided at colleges and universities across the country so students will have access to important information they need for future family planning.

BRCA awareness will follow on Wednesday. Ashkenazi Jews are at 10 times greater risk to have a mutation in a BRCA gene, increasing their risk for breast, ovarian, prostate and pancreatic cancer.

Then on Thursday, Jews with Sephardi and Mizrahi ancestry, such as Persians, Syrians and Bukharians, are encouraged to be screened.

Finally on Friday, interfaith couples will be the focus. While there are a number of diseases that are commonly found in people with Jewish background, Grinzaid said these diseases also occur in the general population, making screening important for interfaith couples as well.

Thats not all.

Beyond carrier screening, Grinzaid said that JScreen is running the PEACH BRCA study for people with Jewish background who are at risk for carrying a BRCA mutation based on their ancestry. Knowing ones BRCA status can be life-saving.

Were piloting BRCA testing in metro Atlanta, she said. Participation in the study is free, but you must be at least 25 or older, male or female, and have at least one Jewish grandparent and no personal or close family history of related cancers.

Of the 500 available slots, only 100 are left. People interested in learning more about the PEACH BRCA study can log on here:jscreen.org/brca.

Once the study is complete, JScreen will launch a cancer genetic testing program nationally.

For information about any of these programs or to register for a screening kit,log onto jscreen.org.

Sure, the focus for now is on this week, but you can get screened any time and you should. Genetic testing is just that important.

Find Gracie on Facebook (www.facebook.com/graciestaplesajc/) and Twitter (@GStaples_AJC) or email her at gstaples@ajc.com.

Support real journalism. Support local journalism. Subscribe to The Atlanta Journal-Constitution today. See offers.

Your subscription to the Atlanta Journal-Constitution funds in-depth reporting and investigations that keep you informed. Thank you for supporting real journalism.

See the rest here:
Jewish or not, this week could save you a lot of heartache - Atlanta Journal Constitution

Say precision medicine and people think of personalized cancer treatment. But this innovation has already begun to revolutionize primary care tooeven though the jury is still out, in many cases, on whether it makes a clear difference in outcomes.

Just what precision (alias personalized) medicine is isnt always spelled out precisely. But usually it is discussed as prevention or treatment that takes into account individual differences among patients, most often genetic differences. Some people expand the concept to consider individual differences in environment and lifestyle.

In adult primary care, two subsets of precision medicine have attracted the most attention recently: predictive genetic testing and pharmacogenomics.

Predictive genetic testing is what it sounds like: A genetic test that forecasts a persons chance of getting a disease. The term is also applied to germline genetic tests that provide some indication of the predisposition being passed down to offspring. Proponents see predictive genetic testing for certain inherited conditions as a way to unearth risks in people who can then get early treatment or take preventive steps to head off serious and possibly costly conditions. Actor Angelina Jolie put BRCA testing as a predictive genetic test into the public consciousness with her announcement in 2013 that she underwent a double mastectomy after testing positive for a BRCA mutation.

Pharmacogenomics studies show how a persons genes can affect his or her response to medications. Ideally, pharmacogenomic (sometimes called pharmacogenetic) results could end some of the trial and error with drugs and help providers and patients choose the most effective drug right off the bat.

Where federal dollars are concerned, precision medicine has already stepped out of the cancer box. In 2015, President Barack Obama committed $215 million to precision medicine research, including a genomic study of more than a million Americans to extend precision medicine from cancer to other diseases. A year later, the 21st Century Cures Act expanded this funding to $1.5 billion over the next 10 years.

Aided by a multibillion-dollar genomic testing industry, some providers have started testing precision medicine beyond oncology. In 2018, Geisinger Health System in central Pennsylvania made a splash by announcing that it would add DNA sequencing to routine primary care. A small number of other hospitals are starting to monetize these tests. In August 2019, STAT reported that a handful of academic medical centers, including Brigham and Womens Hospital and the Mayo Clinic, have started elective genome sequencing clinics for generally healthy patients willing to pay hundreds, sometimes thousands of dollars in cash for a genetic workup.

Skeptics see carts preceding horses; solid evidence that routine genetic testing results in better outcomes is lacking. As one genome-sequencing clinic leader conceded in the STAT article, such testing can lead to expensive follow-up testing. Not surprisingly, payers have been reluctant to cover sequencing tests of various kinds.

Regulators have breathed life into some kinds of testing and poured cold water on others. Last year, 23andMe was the first testing company to get FDA approval to market a direct-to-consumer genetic test for three (of the more than 1,000 known) BRCA gene mutations linked to increased risk of breast, ovarian, and prostate cancer. But in April 2019, the agency issued a warning letter to Inova Health System in Northern Virginia to stop marketing pharmacogenomics tests it claimed could predict patients responses to antidepressants, opioids, and other drugs. The FDA said it was unaware of data to support these claims.

A survey published two years ago in Clinical Pharmacology and Therapeutics found that clopidogrel, a blood thinner, was the medication most commonly tested for a druggene interaction, followed by simvastatin and warfarin. Nearly 40 academic medical centers and community health systems testing ways to implement pharmacogenomics in clinical practice were surveyed.

Some evidence suggests that traditional screening methods may not identify everyone at risk for certain inherited conditions. In a study published in Science three years ago, researchers at Geisinger and Regeneron (which manufactures Praluent, a drug used to treat familial hypercholesterolemia) found that only about one in four people carrying the familial hypercholesterolemia gene variant met the Dutch Lipid Clinic Network criteria (widely used diagnostic criteria) for genetic testing. Still, evidence for the clinical utility of many pharmacogenomic or predictive genetic tests is pretty scanty at this point.

Right now, for the average primary care provider, there are a relatively limited number of situations where pharmacogenomic testing is clearly beneficial to outcomes in a way thats dramatic, says Greg Feero, MD, a faculty member at Maine Dartmouth Family Medicine Residency and a former senior advisor to the director of the NIHs genomics research division.

For predictive genetic testing, there are a few notable exceptionshereditary breast and ovarian cancer, Lynch syndrome, and familial hypercholesterolemiaif certain criteria such as family history of the condition are met. The CDC has designated genomics applications for these conditions as Tier 1, the highest tier on its evidence-based ranking system of genomic applications by their potential for a positive public health impact.

In a 2017 editorial published in American Family Physician, Vinay Prasad, MD, and Adam Obley, MD, of Oregon Health and Science University said that rigorous meta-analyses havent yet shown that genotype-guided dosing for warfarin, clopidogrel, or antidepressant selection is better than usual care. Prasad is a well-known critic of what he sees as the proliferation of medical treatments and therapies without good evidence behind them. We need to know on a broad scale that [these tests] improve outcomes for patients, and dont just reassure physicians theyre choosing a better drug, Obley tells Managed Care.

Prasad and Obley also argued in their editorial that without further proof of improved outcomes, routine genetic testing could just fuel more inappropriate care. Guidelines carve out clear boundaries for who should get tested because there are scenarios in which the risks and benefits of preventive measures arent known, they said, noting that the U.S. Preventive Services Task Force advises against genetic testing for BRCA mutations in women without a family history of BRCA-related cancers.

A small pilot study suggests that genetic testing in primary care may not lead to improved outcomes. In 2017, The Annals of Internal Medicine published the first randomized trial of whole-genome sequencing in primary care. Gene variants were found in 20% of the participants whose genomes were sequenced. But six months later none of them had improved outcomes.

The test produces lots of information, says Obley, who wasnt involved in the study. But its not clear that any patient was managed differently in a way that improved their health.

Without evidence supporting the clinical utility of routine pharmacogenomics or genetic testing, most payers are unwilling to cover them. Some exceptions exist, such as employers that offer routine genetic testing as an employee benefit. In a blog post published in 2018, Color Genomics touted Visa and the German software company SAP as customers. Medicare covers pharmacogenomic testing of two gene variants that predict warfarin responsiveness for beneficiaries enrolled in a randomized, controlled clinical study that meets certain standards.

The high cost of genetic testing has been cited as another reason insurance coverage is limited, but payers may not budge even as testing gets cheaper. The cost of doing the test itself has been declining quite rapidly, says Kathryn Phillips, a health economics professor at University of CaliforniaSan Francisco who researches personalized medicine access, quality, and reimbursement. She has disclosed in recent studies that she is a paid consultant for Illumina, a DNA sequencing company. But she says its hardand its going to take longerto figure out where to use genetics in primary care in healthy populations, and [for insurers] to pay for it.

The current state of evidence and bleak reimbursement prospects havent deterred early adopters from embracing precision medicine in primary care. For Megan Mahoney, MD, chief of general primary care at Stanford Medicine, precision medicine begins with going after data on key determinants of healthnot just genes, but also environmental factors, social determinants, and health behaviors.

In a yearlong pilot of 50 patientsmore than half of whom were at risk for cardiovascular conditionsStanford Medicine care teams created personalized care plans to prevent and manage chronic illness. The plans leveraged data from several sources, including genetic-risk assessments and genetic testing for the three CDC Tier 1 conditions and remote monitoring devices.

Before the pilot, which ended in 2018, Stanford did not offer routine genetic testing in primary care. So far, that hasnt changed. But Stanford is making the genetic-risk assessment tested in the pilot available to its primary care providers, hoping it can increase screening rates for the Tier 1 conditions, says Mahoney. Studies show that many primary care providers are uncomfortable evaluating and addressing genetic risk. Five patients in the pilot discovered through the genetic risk screening that theyre at high risk for breast cancer, demonstrating that this type of tool can help to identify previously unknown risks.

Post-pilot, Stanford is also offering patients with poorly controlled blood pressure connection to a Bluetooth-enabled blood pressure cuff and health coaching as part of a larger study. Genetic testing has dominated the discussion of precision medicine in primary care, but Stanfords experience shows that it isnt the only way to tailor preventive care to individual patients needs.

Even if clinical utility is ultimately shown, folding precision medicine into primary care will likely follow the path of many new developments in medicine: There will be some early adopters, but most practices will have a wait-and-see and depends-on-the-reimbursement attitude.

Educating doctors on how to interpret, use, and communicate genetic testing results to patients will be one of the biggest hurdles. Theyll be learning on the job, says Susanne Haga, associate professor of internal medicine at Duke Universitys medical school, who leads educational activities in genetics and genomics for the Duke Center for Applied Genomics. An obstacle course of other possible barriers awaits: the limited number of certified genetic counselors, concerns about privacy and genetic discrimination, and the potential for the lack of diversity in genomic data sets to exacerbate disparities in care.

Still, Haga sees the convergence of three factors that will force the health care systems hand and usher in precision medicine in primary care: patients increasing ability to influence decisions about their care, the declining cost of testing, and a critical mass of people, numbering in the millions, who will have had their DNA sequenced in genome programs such as Geisingers or several national genomics research initiatives.

Its coming, she says, one way or another.

Visit link:
Precision Medicine in Primary Care: Bespoke. Genetic and Genomic. And Maybe Not Ready. - Managed Care magazine

NEW YORK (PRWEB) January 30, 2020

At-home DNA testing service 23andMe is more than just a tool to discover ancestry - it also offers insight into how genes can impact overall health and wellness. 23andMe offers a wealth of reports that provide genetic health information that can help customers be more proactive about their health. Recently, 23andMe Genetics Trends Expert, Madeline Lynch, and customer Michelle Martinez, teamed with YourUpdateTV to discuss.

A video accompanying this announcement is available at: https://youtu.be/VAKAywAd4VY

A recent survey of 23andMes Health + Ancestry Service customers found that more than three-quarters reported that after receiving their personalized genetic reports they made at least one positive change in their health behavior. Designed by 23andMe and M/A/R/C Research, researchers asked 23andMe Health + Ancestry customers about the overall impact of their 23andMe experience, regardless of their results.

51 percent of respondents reporting theyve set future goals to be healthier. Changes included eating healthier, getting more sleep, and exercising more, among others. Of those who responded to the survey:

For more information and to get started, visit 23andMe.com

Madeline Lynch:Madeline Lynch is the Genetics Trends Expert at 23andMe. She serves as a subject matter expert and company spokesperson for media engagements, the analyst community, online communities, and the general public at large. Her responsibilities on the customer care team include providing input on prioritization and resolution of customer-facing issues and working directly with cross-functional teams to influence and support development of new and existing communications materials and messaging from the perspective of the customer. She holds a BA from University of California, Davis.

About Michelle Martinez:Michelle Martinez is a 51-year-old lab assistant from Arlington, Texas. Michelle was inspired to order a 23andMe Health + Ancestry kit to help prepare for any potential genetic health risks, due to several serious health risks running in her family. When she opened her Genetic Weight wellness report, she saw that she is genetically predisposed to weigh less than average. She thought, "I've been denying my genetics and just falling into bad habits. I'm not being my best self." That report, along with the knowledge of lifestyle and environmental factors that affect one's health, inspired Michelle to make better lifestyle decisions like eating healthier. She has since lost more than 50 pounds and gained confidence in being in her own skin. She believes that her weight loss journey is one of patience and acceptance with and of herself -- no matter her size.

About 23andMe:23andMe, Inc. is the leading consumer genetics and research company. Founded in 2006, the mission of the company is to help people access, understand and benefit from the human genome. The company was named by TIME as a Genius Company in 2018 and featured as Fast Company's #2 Most Innovative Health Company in 2018. 23andMe has millions of customers worldwide, with more than 80 percent of customers consented to participate in research. 23andMe, Inc. is located in Sunnyvale, CA. More information is available at http://www.23andMe.com.

About YourUpdateTV: YourUpdateTV is a social media video portal for organizations to share their content, produced by award-winning video communications firm, D S Simon Media (http://www.dssimon.com). It includes separate channels for Health and Wellness, Lifestyle, Media and Entertainment, Money and Finance, Social Responsibility, Sports and Technology.

Share article on social media or email:

See original here:
How Genetic Testing with 23andMe Can Improve Your Health - PR Web

The "Molecular Diagnostics Market Share & Global Forecast, By Application, Technology, End User, Regions, Companies" report has been added to ResearchAndMarkets.com's offering.

Increasing prevalence of Infectious diseases such as Influenza, HPV, Hepatitis, HIV and Tuberculosis despite rise in sanitation practices globally. In the past, antimicrobials medicines were used to fight powerful infectious disease but slowly in today's time antimicrobial agent is not able to give the desired results because the problem of drug resistant occurs in many people across the world.

Nowadays, a new diagnostic procedure is being followed to fight infectious disease like molecular diagnostic test is very effective which is quite fast and precise. The number of cancer patients is increasing very fast, so it is believed that in the coming time the molecular diagnostic test market will be growing at rapid pace. Global Molecular Diagnostics Market is likely to surpass US$ 22.5 Billion by the end of year 2025.

There are various reasons that will propel the market growth in forecast year; rising incidence rate of infectious disease, increasing incidence rate of cancer of all type, increasing people awareness regarding molecular diagnostic, rapid technological growth, widely acceptance of personalized medicine, rising healthcare infrastructure, increasing healthcare per capita expenditure across the developed and developing nation, accuracy of diagnosis, growing population of cardiovascular and neurological disorder etc. In addition, increasing prevalence of genetic disorder will further boost the market in forecast period of time.

The report titled Molecular Diagnostics Market Share & Forecast, By Application (Infectious Diseases, Blood Screening, Oncology, Genetic Testing, HLA (Tissue Typing), Microbiology, Cardiovascular Diseases, Neurological Diseases, Pharmacogenomics and Others), By Technology (PCR, Transcription-Mediated Amplification (TMA), Hybridiazation (In-situ Hybridiazation & FISH), DNA Sequencing & NGS, Microarray and Others), By End User (Hospitals & Academic Laboratories, Clinics and Commercial Laboratories, Others), By Regions [United States, Europe (Expect Russia), India, China, Japan, Brazil, South Korea, Mexico, Russia and ROW], Companies (Roche, Abbott, Myriad Genetics, Qiagen, BioMrieux and Others) provides a complete analysis of Molecular Diagnostics Market.

Market Insight by Application

The report provides comprehensive analysis of molecular diagnostic test market by application into ten parts: Infectious Diseases, Genetic Testing, Blood Screening, Oncology, HLA (Tissue Typing), Microbiology, Neurological Diseases, Pharmacogenomics, Cardiovascular Diseases, and Others. This report also provides key opportunities market and specific factors are given by each application market.

Market Insight by Technology

Here the market is fragmented into six parts; PCR, Transcription-Mediated Amplification (TMA), Hybridiazation (In-situ Hybridiazation & FISH), DNA Sequencing & NGS, Microarray and Others. Besides, many factors are analyzed that influence the growth, challenges and opportunities of market in technological context.

Market Insight by End User

The report provides complete insight of market by End User segments: Hospitals & Academic Laboratories, Clinics & Commercial Laboratories and Others. According to the publisher, Hospitals & Academic Laboratories will hold the largest market in global molecular diagnostic test market in forecast period of time.

Market Insight by Regions

This report covers the complete regional profile by 10 geographical market; United States, Europe, India, China, Japan, Brazil, South Korea, Mexico, Russia and Rest of World (ROW).

Key Topics Covered:

1. Executive Summary

2. Global Molecular Diagnostic Market

3. Market Share - Global Molecular Diagnostics

3.1 By Application

3.2 By Technology

3.3 By Countries

3.4 By Companies

4. Application - Molecular Diagnostics Market

4.1 Infectious Diseases

4.1.1 Hospital Acquired Infections (HAI)

4.1.2 HIV / HCV Testing

4.1.3 STD Testing

4.1.4 HPV Testing

4.2 Blood Screening

4.3 Oncology / Cancer

4.3.1 Breast

4.3.2 Colorectal

4.3.3 Prostate

4.3.4 Others

4.4 Genetic Testing

4.5 HLA (Tissue Typing)

4.6 Microbiology

Story continues

4.7 Cardiovascular Diseases

4.8 Neurological Diseases

4.9 Pharmacogenomics

4.10 Others

5. Technology - Molecular Diagnostics Market

5.1 PCR

5.2 Transcription-Mediated Amplification (TMA)

5.3 Hybridiazation (In-situ Hybridiazation & FISH)

5.4 DNA Sequencing & NGS

5.5 Microarray

5.6 Others

6. Region - Molecular Diagnostics Market

6.1 United States

6.2 Europe

6.3 India

6.4 China

6.5 Japan

6.6 Brazil

6.7 South Korea

6.8 Mexico

6.9 Russia

6.10 Rest of World (ROW)

7. End Users - Molecular Diagnostics Market

7.1 Hospitals & Academic Laboratories

7.2 Clinics and Commercial Laboratories

7.3 Others

8. Roche Diagnostics - Company Analysis

8.1 Merger & Acquisitions

8.2 Sales Analysis

9. Abbott Laboratories - Company Analysis

9.1 Merger & Acquisitions

9.2 Sales Analysis

10. Myriad Genetics - Company Analysis

10.1 Merger & Acquisitions

10.2 Sales Analysis

11. Qiagen - Company Analysis

11.1 Merger & Acquisitions

11.2 Sales Analysis

12. BioMrieux's Inc - Company Analysis

12.1 Merger & Acquisitions

12.2 Sales Analysis

13. Market Drivers

13.1 Various Developments in the Molecular Diagnostics Landscape

13.2 Integral to Traditional Labs

13.3 Improved Assay / Test Efficiencies

13.4 Targeting Antibiotic Resistance

13.5 Next Generation Ultrasensitive Molecular Diagnostics

13.6 Increasing Investment in Genomics & Proteomics Research

13.7 Technological Advances in Molecular Diagnostics

13.8 Increasing Acceptance of the Personalized Medicine

13.9 Growing Molecular Diagnostics for Food Safety

14. Challenges

14.1 Dearth of Trained Professionals

14.2 Regulatory Issues

14.3 Various Factors Slowing Growth of Molecular Diagnostics

14.4 Reimbursement Capabilities

14.5 Quality Checkpoints, Awareness & Acceptance

For more information about this report visit https://www.researchandmarkets.com/r/j3on5s

View source version on businesswire.com: https://www.businesswire.com/news/home/20200130005474/en/

Contacts

ResearchAndMarkets.comLaura Wood, Senior Press Managerpress@researchandmarkets.com For E.S.T Office Hours Call 1-917-300-0470For U.S./CAN Toll Free Call 1-800-526-8630For GMT Office Hours Call +353-1-416-8900

Follow this link:
Global Molecular Diagnostics Market is Likely to Surpass US$ 22.5 Billion by the End of Year 2025 - ResearchAndMarkets.com - Yahoo Finance

AMHERST, Mass. Allison Vorderstrasse, a faculty member and Ph.D. program director at New York University, has been named the dean of the College of Nursing at the University of Massachusetts Amherst. She will begin her appointment on July 1.

Vorderstrasse currently serves as a faculty member and director of the Florence S. Downs Ph.D. Program in Nursing Research and Theory Development at New York University (NYU) Rory Meyers College of Nursing. The appointment was made by John J. McCarthy, provost and senior vice chancellor for academic affairs.

Dr. Vorderstrasse emerged as the best in an exceptionally well-qualified pool of candidates. I look forward to working with her as she leads the College of Nursing into its 67th year, McCarthy said.

An adult nurse practitioner with clinical experience, Vorderstrasse received her doctorate and masters degrees in nursing at the Yale University School of Nursing, with specialties in chronic illness self-management research and diabetes. She received her bachelors degree in nursing from Mount Saint Mary College in Newburgh, N.Y.

As a researcher, Vorderstrasse focuses on development and implementation of innovative behavioral interventions for diabetes and cardiovascular disease that could expand preventive and self-care management support for adults at risk for, or living with, chronic diseases. Her contributions to chronic disease prevention have identified that genetic testing for chronic conditions may improve risk reduction in certain groups. She was among the first researchers to demonstrate that virtual environments are an effective way to provide self-management education and support to improve outcomes for patients with diabetes and cardiovascular disease.

Prior to joining the faculty at NYU, Vorderstrasse was an associate professor of nursing and faculty lead for precision health research at the Duke University School of Nursing. She taught at the Duke University School of Nursing from 2009 to 2014. In 2014, she received the Duke University School of Nursing Distinguished Teaching Award. She was inducted as a fellow of the American Academy of Nursing in 2015, and in 2017 received the International Society of Nurses in Genetics Founders Award for Excellence in Genomic Nursing Research.

While at NYU, Vorderstrasse led curriculum and program changes in its nursing Ph.D. program that included a new entry point for post-bachelor to Ph.D. students to facilitate earlier entry into careers in research without sacrificing academic rigor in the program. She has worked with global partners to establish a global track option for Ph.D. students that will launch in the fall of 2020. She also focused on faculty and student culture and wellness as a part of her leadership at NYU.

View original post here:
Allison Vorderstrasse Named Dean of UMass Amherst College of Nursing - UMass News and Media Relations

Illumina (ILMN) came out with quarterly earnings of $1.70 per share, beating the Zacks Consensus Estimate of $1.59 per share. This compares to earnings of $1.32 per share a year ago. These figures are adjusted for non-recurring items.

This quarterly report represents an earnings surprise of 6.92%. A quarter ago, it was expected that this genetic testing tools company would post earnings of $1.40 per share when it actually produced earnings of $1.93, delivering a surprise of 37.86%.

Over the last four quarters, the company has surpassed consensus EPS estimates four times.

Illumina, which belongs to the Zacks Medical - Biomedical and Genetics industry, posted revenues of $953 million for the quarter ended December 2019, surpassing the Zacks Consensus Estimate by 0.63%. This compares to year-ago revenues of $867 million. The company has topped consensus revenue estimates four times over the last four quarters.

The sustainability of the stock's immediate price movement based on the recently-released numbers and future earnings expectations will mostly depend on management's commentary on the earnings call.

Illumina shares have lost about 5.3% since the beginning of the year versus the S&P 500's gain of 1.4%.

What's Next for Illumina?

While Illumina has underperformed the market so far this year, the question that comes to investors' minds is: what's next for the stock?

There are no easy answers to this key question, but one reliable measure that can help investors address this is the company's earnings outlook. Not only does this include current consensus earnings expectations for the coming quarter(s), but also how these expectations have changed lately.

Empirical research shows a strong correlation between near-term stock movements and trends in earnings estimate revisions. Investors can track such revisions by themselves or rely on a tried-and-tested rating tool like the Zacks Rank, which has an impressive track record of harnessing the power of earnings estimate revisions.

Ahead of this earnings release, the estimate revisions trend for Illumina was unfavorable. While the magnitude and direction of estimate revisions could change following the company's just-released earnings report, the current status translates into a Zacks Rank #4 (Sell) for the stock. So, the shares are expected to underperform the market in the near future. You can see the complete list of today's Zacks #1 Rank (Strong Buy) stocks here.

It will be interesting to see how estimates for the coming quarters and current fiscal year change in the days ahead. The current consensus EPS estimate is $1.55 on $907.18 million in revenues for the coming quarter and $6.99 on $3.90 billion in revenues for the current fiscal year.

Investors should be mindful of the fact that the outlook for the industry can have a material impact on the performance of the stock as well. In terms of the Zacks Industry Rank, Medical - Biomedical and Genetics is currently in the top 31% of the 250 plus Zacks industries. Our research shows that the top 50% of the Zacks-ranked industries outperform the bottom 50% by a factor of more than 2 to 1.

Want the latest recommendations from Zacks Investment Research? Today, you can download 7 Best Stocks for the Next 30 Days. Click to get this free reportIllumina, Inc. (ILMN) : Free Stock Analysis ReportTo read this article on Zacks.com click here.

View original post here:
Illumina (ILMN) Q4 Earnings and Revenues Top Estimates - Yahoo Finance

As per a report Market-research, the Genetic Testing Services economy is likely to see a CAGR increase of XX% within the forecast period (2019-2029) and reach at a value of US$ at the ending of 2029. The macro economic and micro elements which are predicted to influence the trajectory of this market are examined from the market analysis that was presented.

Light onto the material throws Providers, vendors, manufacturers, and market participants at the value string of their industry that is Genetic Testing Services . Whats more, its particular influence on the market and the political and economic scenarios of regions are discussed within the analysis.

Critical Details included from this record:

Request Sample Report @https://www.mrrse.com/sample/15214?source=atm

Competitive Outlook

Light onto the throws Business prospects of players operating from the industry that is Genetic Testing Services . The item pricing plans, marketing stations that were preferred and product portfolio of most players, and promote presence of every and every provider is contained in the title. The players comprise Business 4, Business two, Business 3, and Business.

Regional Assessment

The marketplace research that is introduced sheds light onto the Marketplace Scenario in numerous markets. Additionally, the effects of the governmental and regulatory policies to this market in every regions prospects is examined from the report.

companies profiled in the report are Laboratory Corporation of America Holdings, Quest Diagnostics Incorporated, Genomic Health, Inc., NeoGenomics Laboratories, Inc., Eurofins Scientific, Ambry Genetics, Hoffmann-La Roche Ltd, Illumina, Inc., CENTOGENE AG, and 23andMe, Inc.

The global genetic testing services market has been segmented as follows:

Global Genetic Testing Services Market, by Test Type

Global Genetic Testing Services Market, by Service Provider

Global Genetic Testing Services Market, by Application

Global Genetic Testing Services Market, by Geography

Request For Discount On This Report @ https://www.mrrse.com/checkdiscount/15214?source=atm

The report Suits the questions pertaining Into the Genetic Testing Services economy:

Reasons Genetic Testing Services Market Report Sticks out

Buy This Report @ https://www.mrrse.com/checkout/15214?source=atm

Read more:
Trends in the Ready To Use Genetic Testing Services Market 2019-2021 - Dagoretti News

Genetic testing, also known as DNA testing, is used to identify changes in DNA sequence or chromosome structure. Genetic testing can also include measuring the results of genetic changes, such as RNA analysis as an output of gene expression, or through biochemical analysis to measure specific protein

The Global Direct Patients Genetic Testing Industry estimated to be Increasing awareness about the risk of genetic diseases and growing proactive tendency among the public about prevention and efficient management of chronic diseases mainly drive the market. However, high cost of testing service is one of the major factors expected to hamper the growth of the global market.

Get Sample Copy of this Report Visit @ https://www.orianresearch.com/request-sample/1381456

Direct Patients Genetic Testing Industry 2020 research analysts provide an elaborate description of the value chain and its distributor analysis. This Market study Research Report provides comprehensive data that enhances the understanding, scope, and application of this report. The study also consists of data regarding the consumption aspect of the Direct Patients Genetic Testing Market. It provides details regarding the consumption volume as well as value of the product.

Major Key Players in Direct Patients Genetic Testing Market are:-

Key Benefits of the Report:

Inquire more or share questions if any before the purchase on this report @ https://www.orianresearch.com/enquiry-before-buying/1381456

On the basis of type, the market is split into:

On the basis of technology, the market is split into:

The market estimates and forecasts have been verified through exhaustive primary research with the Key Industry Participants (KIPs), which typically include:-

Research Methodology:-

The market is derived through extensive use of secondary, primary, in-house research followed by expert validation and third party perspective, such as, analyst reports of investment banks. The secondary research is the primary base of our study wherein we conducted extensive data mining, referring to verified data sources, such as, white papers, government and regulatory published articles, technical journals, trade magazines, and paid data sources.

For forecasting, regional demand & supply factors, recent investments, market dynamics including technical growth scenario, consumer behavior, and end use trends and dynamics, and production capacity were taken into consideration. Different weightages have been assigned to these parameters and quantified their market impacts using the weighted average analysis to derive the market growth rate.

Order a copy of Global Direct Patients Genetic Testing Market Report @ https://www.orianresearch.com/checkout/1381456

Why to Buy this Report:-

Table of Content:-

Customization Service of the Report:-

Orian Research provides customisation of reports as per your need. This report can be personalised to meet your requirements. Get in touch with our sales team, who will guarantee you to get a report that suits your necessities.

About us: Orian Researchis one of the most comprehensive collections of market intelligence reports on the World Wide Web. Our reports repository boasts of over 500000+ industry and country research reports from over 100 top publishers. We continuously update our repository so as to provide our clients easy access to the worlds most complete and current database of expert insights on global industries, companies, and products. We also specialize in custom research in situations where our syndicate research offerings do not meet the specific requirements of our esteemed clients.

Contact Us:-

Ruwin Mendez

Vice President Global Sales & Partner Relations

Orian Research Consultants

US +1 (415) 830-3727| UK +44 020 8144-71-27

Email: [emailprotected]

See the article here:
Global Direct Patients Genetic Testing Market Analysis and Forecast to by Top Key Players, Trend, Size, Industry Growth, Demand, Applications, Share...

Abstract

Women harboring heterozygous germline mutations of BRCA2 have a 50 to 80% risk of developing breast cancer, yet the pathogenesis of these cancers is poorly understood. To reveal early steps in BRCA2-associated carcinogenesis, we analyzed sorted cell populations from freshly-isolated, non-cancerous breast tissues of BRCA2 mutation carriers and matched controls. Single-cell whole-genome sequencing demonstrates that >25% of BRCA2 carrier (BRCA2mut/+) luminal progenitor (LP) cells exhibit sub-chromosomal copy number variations, which are rarely observed in non-carriers. Correspondingly, primary BRCA2mut/+ breast epithelia exhibit DNA damage together with attenuated replication checkpoint and apoptotic responses, and an age-associated expansion of the LP compartment. We provide evidence that these phenotypes do not require loss of the wild-type BRCA2 allele. Collectively, our findings suggest that BRCA2 haploinsufficiency and associated DNA damage precede histologic abnormalities in vivo. Using these hallmarks of cancer predisposition will yield unanticipated opportunities for improved risk assessment and prevention strategies in high-risk patients.

Breast cancers arising in women who inherit heterozygous mutations in BRCA2 are associated with a high prevalence of genomic alterations and aggressive clinical behavior (1, 2). Because of the high risk of these cancers in BRCA2 mutation carriers, many such women elect to undergo bilateral mastectomy for breast cancer prevention. However, despite the unmet need for more effective breast cancer prevention approaches in this setting, the stepwise evolution from an otherwise normal BRCA2 heterozygous mutant (BRCA2mut/+) cell to an invasive malignancy has not been defined. Homozygous loss of BRCA2 is embryonically lethal (35), and acute loss in cultured cells rapidly leads to DNA damage and growth arrest or cell death (68). These observations suggest a multistep pathogenesis in which homozygous BRCA2 loss is not the earliest genetic event but rather that the wild-type BRCA2 allele may remain intact as early genetic changes accumulate. Critically, however, this scenario leaves unresolved the nature and enabling mechanism for early cancer evolution. Haploinsufficiency for BRCA2 has been proposed as a possible driver of early pathogenesis, but direct evidence for such an effect in the normal human mammary gland is inconsistent. Furthermore, heterozygous genetically engineered mouse models (GEMMs) of BRCA2 are not tumor prone and therefore represent a poor model of precancerous evolution in this setting (35, 8, 9). While the BRCA1 tumor suppressor shares many of these features (9, 10), the pathogenesis of BRCA1- versus BRCA2-associated breast cancers may differ in important ways, as the former are primarily hormone receptor (HR) and HER2-negative tumors, while the latter are primarily HR positive (11).

We sought to unveil the earliest steps in the pathogenesis of BRCA2-associated breast tumors through detailed analysis of histologically normal glands from women harboring germline deleterious mutations who elected to undergo bilateral prophylactic mastectomy. Genomic analysis of individual cells revealed frequent polyclonal chromosomal damage, which was most prevalent among the subset of epithelial cells that are the suspected cells of origin of these cancers. Corresponding defects in replication stress and DNA damage checkpoint responses in these same cells collectively define a previously unappreciated phenotype for BRCA2 that precedes histologic abnormalities in the human breast. The discovery of these precancerous hallmarks paves the way for improving clinical risk prediction and cancer prevention in this population.

We carried out detailed analysis of noncancerous glands from BRCA2 carriers who elected to undergo bilateral prophylactic mastectomy, using as control tissues from women matched for age, menopausal status, and hormonal exposure electing cosmetic breast surgery (Fig. 1A and table S1). None of these women had a previous breast cancer diagnosis or chemotherapy exposure, and no occult cancers were detected upon histologic analysis of the tissues we analyzed (table S1). We used established markers to carry out flow cytometrybased isolation and sorting of the three major epithelial cell subpopulations: mature luminal (ML), luminal progenitor (LP), and basal epithelial cells (Fig. 1A). Notably, data from GEMMs and gene expression analyses of human tumors have suggested that the cell of origin of BRCA1-associated breast cancer is the LP cell (12, 13), while BRCA2-associated tumors may arise from an LP-related cell or a more ML cell (14).

(A) Workflow depicts dissociation and isolation of human breast epithelial cells from BRCA2 carrier (BRCA2mut/+) prophylactic mastectomy and control [wild-type (WT)] elective mammoplasty cases for subsequent analyses, as indicated. Dot plot at center shows representative flow cytometry sorting via CD49f and EpCAM of ML, LP, and basal epithelial cells. FACS, fluorescence-activated cell sorting. (B) Summary of single-cell whole-genome sequencing (WGS) analysis of flow-sorted, primary uncultured breast epithelial cells. Copy number variation (CNV) calls for individual cells (rows) across the genome (x axis; Chr, chromosome) are shown, with gains and losses boxed. Cell types and genotypes are indicated at the top left, and individual patient ID numbers are indicated at the right. In total, 252 sequenced breast epithelial cells from BRCA2mut/+ (n = 5) and control (n = 2) tissue specimens are depicted. (C) Bar chart depicting the prevalence of CNVs in LP (L) and basal (B) cells of BRCA2 carrier and control (WT) patients. Color code depicts the number of CNVs identified per cell. (D) LP cells from BRCA2 carriers are significantly more likely to harbor CNVs than basal cells. P value is determined by 2 test.

Among the earliest events in cancer evolution are thought to be polyclonal somatic genomic alterations. Accordingly, we looked for the presence of somatic copy number variations (CNVs) at high resolution through single-cell whole-genome sequencing (WGS) of uncultured, flow-sorted primary LP and basal epithelial cells from BRCA2 carriers and controls. Low-coverage WGS provides sufficiently high resolution to identify subchromosomal CNVs as small as 10 Mb, and our methodology for single-cell whole-genome amplification and analysis has been previously validated (15, 16). We carried out WGS to an average depth between 0.1 to 0.05 and then used two independent algorithms (HMMcopy and DNAcopy) to assign and confirm copy number changes across the genome (15, 16). Previous studies using this methodology have demonstrated that in unselected individuals, the proportion of cells with any such CNVs is very low (<5% of cells) in normal epithelial and brain tissues (16). In contrast, among nearly 100 individual LP cells from a cohort of BRCA2 carriers analyzed by WGS, we observed that 27% demonstrated one or more CNVs of >10 Mb (Fig. 1, B to D). Applying this methodology to an equal number of basal breast epithelial cells from the same individuals also revealed a substantial excess of cells harboring CNVs (13%), although significantly less than the proportion of CNV-positive LP cells (P = 0.04) (Fig. 1, B to D). By comparison, a parallel WGS analysis of sorted LP and basal cells from noncarriers revealed a single CNV in 90 cells (Fig. 1, B and C). As further validation of our sequencing and analysis pipelines, we reanalyzed existing data from normal skin and brain cells sequenced on the same platform. The overall sequence quality was comparable between these cells and the breast epithelial cells, and we confirmed the low prevalence of CNV-positive cells in 142 skin and brain cells sequenced (fig. S1). Thus, breast epithelia, and particularly, LP cells from noncancerous breast tissue of BRCA2 carriers harbor frequent subchromosomal aneuploid events (Fig. 1D and fig. S2A).

One notable CNV we observed was duplication of the entire chromosome 1q arm, which is a common genomic abnormality in breast cancer (Fig. 2A) (17). Most of the identified CNVs were subchromosomal haploid losses, consistent with the widespread pattern of losses observed in BRCA2-associated breast cancer (Fig. 2A and fig. S2B) (1). In some cases, identical losses were shared between multiple cells of the same patient, a finding that could conceivably correspond to early clonal evolution (Fig. 2B). None of the losses in any cell involved the BRCA2 locus on chromosome 13 (Fig. 1B and fig. S2, B to E). Previous analyses of germline BRCA2-associated breast cancers have demonstrated that most genetic loss-of-heterozygosity (LOH) events for BRCA2 itself are >10 Mb and therefore would have been detected by our analysis (18). This observation suggests that the wild-type BRCA2 allele is intact in our cases, implying that accumulation of subchromosomal aneuploidy may be a haploinsufficient phenotype. To confirm the integrity of the wild-type allele, we performed targeted polymerase chain reaction (PCR) amplification of the locus surrounding the patient-specific BRCA2 mutation from individual cells. Although efficiency for detection of either allele was low, we did not observe a bias toward detection of the mutant allele alone in the cells analyzed (Fig. 2C and table S2). Together, these findings imply that subchromosomal aneuploidy is an early and potentially haploinsufficient phenotype in BRCA2mut/+ breast epithelia.

(A) Representative segmentation plots of individual LP (n = 4) and basal (n = 2) cells harboring CNVs from four BRCA2 mutation carriers. Y axis depicts normalized WGS read counts across the genome (x axis). Red dots indicate region of gain, whereas blue dots indicate losses. Patient ID numbers are indicated at the right. (B) Segmentation plots of three LP cells that share a clonal loss (red box) in a BRCA2 carrier (patient 131). Zoomed-in images of the clonal loss are shown at the right. (C) Representative chromatograms from single-cell PCR-based Sanger sequencing of genomic DNA in a BRCA2mut/+ LP cell. The presence of a heterozygous single-nucleotide polymorphism (SNP) and the superimposition of sequences adjacent to the frameshift mutation suggest that LOH has not occurred.

The presence of viable aneuploid cells in BRCA2mut/+ tissues suggested ongoing DNA damage and/or a deregulated stress/damage response. Thus, we next used an independent method to directly assess DNA damage in single cells, the comet assay. This assay uses cells embedded in agarose that are lysed and then subjected to electrophoresis, causing broken DNA structures to migrate toward the anode, thus forming a comet tail (19). We briefly cultured freshly collected cells from BRCA2 carriers or controls under ultralow attachment conditions (48 to 72 hours) to select for epithelial progenitor cells before plating (20). Consistently, cells from BRCA2 carriers demonstrated increased DNA breaks at baseline compared to controls (Fig. 3A). In addition, inducing replication stress by treatment with hydroxyurea (HU) led to further increases in DNA damage in BRCA2mut/+ cells, potentially reflecting the established role of BRCA2 in protection of stalled replication forks (Fig. 3A) (21).

(A) Representative images of comet assays performed on primary human breast epithelial cells isolated from control (WT) and BRCA2mut/+ tissues. Red lines highlight tail of broken DNA. Graph below summarizes data from n = 3 patients per genotype (50 cells per patient). Cells were either untreated (Unt) or treated with HU for 4 hours. Data are depicted as fold change in tail DNA intensity. P values are determined by unpaired t test. ***P < 0.001 and ****P < 0.0001. Error bars indicate SD. (B) Representative confocal immunofluorescence staining of primary breast epithelial cells for p-CHEK1 (Ser317) shows increased nuclear staining following HU treatment only in control (WT) but not in BRCA2mut/+ cells. Graph at the right summarizes nuclear fluorescence of individual cells (dots) (n = 4 patients for control and n = 3 patients for BRCA2mut/+; four fields counted per condition per patient). P values are determined by unpaired t test. ***P < 0.001 and ****P < 0.0001. Horizontal lines indicate means and SDs. Scale bars, 20 m. (C) Chromatograms depicting Sanger DNA sequencing of a cytospin of primary breast cells assayed in (B) from a BRCA2mut/+ patient harboring BRCA2 5799_5802delCCAA (p.Asn1933Lysfs). The superimposition of sequences adjacent to the frameshift mutation suggests that LOH has not occurred. (D) Heat map of RNA sequencing (RNA-seq) data from freshly sorted cells shows differential expression of RSRD (replication stress response deficiency) genes (24) in BRCA2mut/+ LP cells (n = 7 patients) compared to control (WT) LP cells (n = 9 patients). Columns correspond to individual patients.

We then examined the response to this genomic stress by analyzing phosphorylation of CHEK1, a central coordinator of the response to replication stress and DNA damage (22, 23). Cytospins of primary epithelial progenitor cultures prepared as above were stained for phosphorylated CHEK1 at baseline or following 4 hours of exposure to HU. As anticipated, control primary epithelia exhibited increased CHEK1 phosphorylation within 4 hours of HU treatment (Fig. 3B). In contrast, however, cells from BRCA2 carriers exhibited a failure to activate CHEK1 in response to HU, despite normal levels of total CHEK1 protein (Fig. 3B and fig. S3A). DNA sequencing of these cells revealed the presence of both wild-type and mutant BRCA2 alleles (Fig. 3C). These findings provide further support for a haploinsufficient phenotype of BRCA2 in the response to genomic stress.

Because we observed a deregulated genomic stress response in vitro, we wanted to know whether this also occurs in vivo. Thus, we carried out RNA sequencing (RNA-seq) analysis of freshly sorted LP and basal epithelial cell populations from BRCA2 carrier tissues or controls (Fig. 1A). Analysis of these data revealed enrichment in BRCA2mut/+ LP cells of an established signature reflecting a failure of the ATR (Ataxia telangiectasia mutated and Rad3-related)/CHEK1 (checkpoint kinase 1)mediated replication stress checkpoint in nontransformed mammary epithelial cells (Fig. 3D and fig. S3B) (24). This replication stress response deficiency signature is known to predict future cancer risk (24), and it contains some of the top most differentially expressed genes between BRCA2mut/+ and control LP cells (Fig. 3D). Among these are genes of potential relevance to HR-positive breast cancer (which comprise 80% of BRCA2-associated breast cancers), including the estrogen receptor target gene HOXC4 and the GATA transcription factorbinding partner gene ZFPM1 (Fig. 3D) (25, 26). Furthermore, evaluation of differentially expressed programs through gene set enrichment analysis (GSEA) revealed the highly significant deregulation of a radiation response signature in BRCA2mut/+ LP cells (fig. S3C) (27). Notably, the differential expression of this signature between BRCA2mut/+ and control cells was far more significant within the LP compared to the basal population, in keeping with the more frequent occurrence of CNVs among LP cells (fig. S3C). Again, consistent with haploinsufficiency for BRCA2, the RNA-seq data showed no evidence for exclusive expression of the mutant allele in BRCA2mut/+ LP cells (fig. S3D). Thus, BRCA2mut/+ LP cells exhibit evidence of aberrant replication stress and DNA damage responses in vivo.

We then turned to examine the downstream consequences of the DNA damage detected in LP cells of BRCA2 carriers. A hallmark genetic event that cooperates with BRCA2 deficiency in cancer pathogenesis is loss of TP53, suggesting that activation of TP53 may be an early barrier to malignant progression in this setting (28). We therefore hypothesized that the failed CHEK1-dependent replication stress response we observed might ultimately lead to DNA double-strand breaks and thereby trigger TP53 activation through a CHEK1-independent pathway (29). Recent studies suggest that CHEK1 is not required for TP53 activation in primary breast epithelial cells following DNA damage (30). RNA-seq analysis did suggest activation of TP53 in BRCA2mut/+ LP cells, evidenced by the increased expression of multiple direct TP53 target genes (Fig. 4A) (31, 32). This in vivo effect was associated with a strong transcriptional profile indicating suppression of nuclear factor B (NF-B) signaling, including numerous cytokine and inflammatory factors associated with the senescence-associated secretory phenotype (SASP) (Fig. 4, B to D). TP53 is known to suppress the NF-B/SASP response (33, 34), and this effect is emerging as a relevant component of TP53-dependent tumor suppression given that accumulation of SASP-expressing cells is an established driver of tumorigenesis (35). We independently validated the corresponding alterations in NF-B protein expression, demonstrating that the NFKB1 (p50) and NFKB2 (p52) subunits were expressed at lower levels in BRCA2 carrier tissues compared to controls (Fig. 4C). Furthermore, knockdown of BRCA2 in nontransformed mammary epithelial cells via lentiviral short hairpin RNA attenuated expression of the same cytokine and NF-B target genes that were down-regulated in BRCA2mut/+ progenitor cells in vivo (fig. S4A). Similar to the damage response signature (fig. S3C), deregulation of the SASP program was selective for LP cells in BRCA2 carriers, as no significant suppression of SASP was observed in the corresponding basal epithelial cells of these same patients (fig. S4B). These results suggest that DNA damage and TP53 activation in BRCA2mut/+ LP cells are associated with suppression of the NF-B/SASP response.

(A) Bar charts show the mean expression levels of canonical TP53 target genes in freshly sorted BRCA2 carrier LP cells (n = 7 patients) compared to controls (WT; n = 9 patients), assessed by RNA-seq. Error bars denote SEM. P values are determined by Mann-Whitney test. *P < 0.05 and **P < 0.01. XPC, Xeroderma pigmentosum group C-complementing protein; FPKM, Fragments Per Kilobase of transcript per Million mapped reads. (B) Heat map depicts down-regulation of NF-B/SASP pathway genes in BRCA2 carrier LP cells compared to controls (WT), assessed by RNA-seq as in (A). Columns correspond to individual patients. Direct NF-B target genes are highlighted in red. (C) Western blot analysis shows that NFKB1 (p50) and NFKB2 (p52) subunits are expressed at lower levels in BRCA2mut/+ breast tissues compared to control (WT) tissues (n = 3 patients per genotype). -Tubulin serves as a loading control. (D) Negative enrichment of a SASP signature in GSEA of RNA-seq data from freshly sorted LP cells of BRCA2 carriers (n = 7 patients) and controls (WT; n = 9 patients). NES, normalized enrichment score; FDR, false discovery rate.

Deregulated DNA damage and senescence/SASP responses in BRCA2 LP cells might be expected to alter the proportion of these cells over time (36). We thus sought to address whether there were differences in the proportions of progenitor or other epithelial subpopulations in BRCA2mut/+ tissues compared to controls. We collected a larger cohort of tissues from BRCA2 carriers (n = 26) and controls (n = 28), then performed flow cytometric analysis on these specimens, and plotted the proportions of each epithelial subpopulation as a function of age for each cohort (Fig. 5A). In noncarrier controls, no significant age-associated changes in the prevalence of these subpopulations were noted. In contrast, BRCA2 carriers showed an age-associated expansion in the proportion of LP cells and a decline in the basal cell fraction (Fig. 5B and fig. S5, A and B). These differences were not accounted for by demographic factors such as parity or menopausal status, as these factors were not associated with significant differences in epithelial cell proportions (fig. S5, C and D). Thus, DNA damage and suppression of a senescence-associated program in BRCA2mut/+ LP cells are accompanied by an age-associated expansion of this progenitor cell compartment (36).

(A) Representative flow cytometry analysis showing distinct epithelial subpopulations (basal, LP, and ML) isolated from breast tissues of control (WT) and BRCA2 mutation carriers following sorting via CD49f and EpCAM staining. Numbers indicate percentages of each epithelial cell subpopulation. (B) Linear regression analysis of LP and basal cell proportions by age for controls (WT) (n = 26 patients) and BRCA2 carriers (n = 28 patients). The LP/basal ratio by patient provides additional validation as it accounts for technical factors that may have subtle effects on absolute cell numbers. (C) TUNEL (terminal deoxynucleotidyl transferasemediated deoxyuridine triphosphate nick end labeling) staining of representative control (WT) and BRCA2 carrier tissues. Summary data obtained by counting four fields for five patients per genotype are shown. ****P < 0.0001 by Fishers exact test.

Last, we hypothesized that altered epithelial cell proportions and a deregulated NF-B/SASP program in BRCA2 carrier tissues may be associated with differences in cell proliferation and/or survival in vivo (36). We did not observe strong differences in proliferation assessed by Ki67 staining between these BRCA2 carrier breast tissues and controls, prompting us to ask whether differences in cell survival might contribute to the age-associated expansion of the LP population in this context. We therefore carried out TUNEL (terminal deoxynucleotidyl transferasemediated deoxyuridine triphosphate nick end labeling) staining, an established marker of apoptosis, in BRCA2 carrier tissues and controls. The proportion of TUNEL-positive cells is well documented in normal human breast epithelial tissues, and we observed a similar prevalence of these cells in the control tissues we tested (Fig. 5C) (37). In contrast, however, BRCA2 mutation carrier tissues consistently showed a paucity of TUNEL-positive luminal epithelial cells across all patients tested, in keeping with established links between checkpoint and NF-B suppression and a defective apoptotic response (Fig. 5C) (38, 39). Collectively, our findings suggest that noncancerous BRCA2mut/+ breast tissues exhibit BRCA2 haploinsufficiency and an age-associated accumulation of DNA-damaged luminal epithelial progenitor cells bearing altered checkpoint and survival responses (Fig. 6).

Epithelial progenitor cells of heterozygous germline BRCA2 carriers exhibit DNA damage, failed replication stress, and damage responses, together with attenuated apoptosis. LOH analyses suggest that these findings may reflect a haploinsufficient phenotype for BRCA2 in vivo.

This study advances our understanding of early changes in BRCA2mut/+ breast tissues, defining unanticipated phenotypes in this setting with implications for both cancer risk assessment and prevention. Most of the tissues we studied were deemed to be histologically normal by highly experienced breast pathologists, suggesting that the alterations we report precede clinically defined cellular abnormalities (tables S1 and S3). We present evidence that a failed replication stress response and DNA damage in BRCA2mut/+ tissues result from haploinsufficiency for BRCA2 rather than homozygous loss of function. While the presence of haploinsufficiency for either BRCA1 or BRCA2 in vivo has been controversial, our findings are in accord with data suggesting that LOH for the wild-type BRCA2 is not universal in BRCA2-associated cancers (40). Our observations are also in keeping with a recent report that the BRCA2 protein is selectively susceptible to degradation by environmental aldehydes (41), an effect that could contribute to a haploinsufficient phenotype in cells with only one functional BRCA2 allele. Nonetheless, we analyzed a relatively small number of cells and tissues, and it is difficult to definitively rule out LOH in a subset of cells. Thus, our study suggests, rather than confirms, haploinsufficiency for BRCA2 as a potential initiating event for these cancers.

A prominent feature of the phenotype we have uncovered is frequent subchromosomal aneuploidy, most prevalent within the LP cell population. LP cells are a potential target cell for BRCA2-associated carcinogenesis in the breast, and indeed we observe instances of apparently clonally related genomic alterations among these cells. While our study does not prove that they are direct cancer precursors, these alterations could conceivably represent the earliest somatic genetic abnormalities that underlie these malignancies. Notably, all the CNVs we identified were subchromosomal and therefore are to be distinguished from whole-chromosome gains and losses that are typically later events and associated with TP53 inactivation (42).

Although the early genomic changes we observed are likely to include many passenger events, they, nevertheless, may provide a quantifiable hallmark of the preneoplastic BRCA2 carrier state. Tracking the prevalence of DNA-damaged cells in the clinical setting could possibly improve risk prediction for these women, who are faced with the difficult choice of whether to undergo mastectomy long before cancer develops. Last, the BRCA2 haploinsufficient phenotype we report may portend particular vulnerabilities of certain BRCA2mut/+ cancer precursor cells. Accordingly, this work provides a foundation for future studies seeking to identify improved pharmacologic approaches to cancer prevention in this setting.

Fresh human breast tissues were obtained from the Massachusetts General Hospital with approval by the local Institutional Review Board and signed informed patient consent (protocols 93-085 and 2008-P-1789). Samples were either normal breast tissues from reduction mammoplasties (confirmed by pathology) or noncancerous breast tissues from prophylactic mastectomies of known BRCA1 or BRCA2 mutation carriers. All BRCA1/2 carrier status was determined through clinical germline genetic testing performed by commercial providers before tissue collection.

Tissue samples were minced and digested with collagenase/hyaluronidase (STEMCELL Technologies) in complete EpiCult-B medium supplemented with hydrocortisone (0.48 g/ml; STEMCELL Technologies) overnight at 37C. The resulting suspensions were either cryopreserved or further sequentially digested with 0.25% trypsin, dispase (5 mg/ml), and deoxyribonuclease I (1 mg/ml). Single-cell suspensions were collected by filtration through a 40-m cell strainer.

Cells were blocked with rat immunoglobulin (Jackson ImmunoLabs) and antibody to Fc receptorbinding inhibitor (eBioscience) before incubation with the following primary antibodies: phycoerythrin (PE)conjugated anti-human CD31 (BD Pharmingen), PE-conjugated anti-human CD45 (BD Pharmingen), PE-conjugated anti-human CD235a (BD Pharmingen), BV650-conjugated anti-human epithelial cell adhesion molecule (EpCAM) CD326 (BioLegend), and biotin-conjugated anti-human ITGA6 (eBioscience). Where required, cells were incubated with allophycocyanin-Cy7conjugated streptavidin (BD Pharmingen). Cells were either stained with 4,6-diamidino-2-phenylindole (DAPI) for viability or fixed with 1% paraformaldehyde and stained with the Zombie Aqua Fixable Viability Kit (BioLegend). Viable cells were sorted on a FACSAria flow cytometer (Becton Dickinson). Data were analyzed using FlowJo software (Tree Star).

Microaspirated single cells were transferred into PCR tubes containing lysis buffer [water + proteinase K (400 ng/l) + 17 M SDS], and DNA was amplified by nested PCR using primers flanking BRCA2 mutations. Sanger sequencing was performed by the Center for Computational and Integrative Biology DNA Core Facility at the Massachusetts General Hospital.

Primer sequences for patient 128 (Val3079PhefsX4) are as follows: first PCR, TGGCGTCCATCATCAGATTT (forward) and TCAGAGGTTCAAAGAGGCTTAC (reverse); second PCR, CAGATTTACCAGCCACGGGA (forward) and GCCAACTGGTAGCTCCAACTAA (reverse). Primer sequences for patient 140 (6027del4) are as follows: first PCR, GGGCCACCTGCATTTAGGAT (forward) and TGAGCTGGTCTGAATGTTCGT (reverse); second PCR, GCAGGTTGTTACGAGGCATT (forward) and CCTGGACAGATTTTCCACTTGC (reverse).

Single-cell suspensions from patient samples were plated in ultralow adherence plates in Dulbeccos modified Eagles medium/F12 medium containing insulin (5 g/ml), epidermal growth factor (10 ng/ml), basic fibroblast growth factor (5 ng/ml), heparin (4 g/ml), hydrocortisone (500 ng/ml), B27, GlutaMAX, and penicillin-streptomycin. Cells were either treated with HU (10 mM; Sigma) for 4 hours or left untreated and washed with phosphate-buffered saline (PBS), and alkaline comet assays were performed using a Trevigen Comet Assay kit according to the manufacturers instructions. Olive tail movement was quantified with ImageJ, and 50 individual cells were quantified per condition.

Immunofluorescence for paraffin sections and TUNEL staining were performed by Dana-Farber/Harvard Cancer Center Specialized Histopathology Core. For immunofluorescence in cells, fixation was performed with methanol for 10 min, followed by permeabilization in 0.1% Triton X-100 for 2 min. Blocking was performed with 10% horse serum for 30 min, and cells were further incubated with primary p-CHEK1 antibody (Novus Biologicals) for 2 hours, washed with wash buffer (PBS + 10% horse serum + 0.1% Triton X-100), incubated with appropriate secondary antibody for 1 hour, and stained with DAPI. All immunofluorescence images were captured by a confocal microscope (Leica TCS SP8) and were analyzed by ImageJ.

Snap-frozen tissues were homogenized using Precellys 24 homogenizer (Bertin Technologies). For total protein extraction, cells were lysed in radioimmunoprecipitation assay buffer [10 mM tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% sodium deoxycholate, 0.1% (w/v) SDS, 1% (v/v) NP-40, proteinase inhibitor cocktail, and phosphatase inhibitor cocktail] for 30 min on ice. Western blotting was performed using NFKB1 p50 (Santa Cruz Biotechnology) and NFKB2 p52 (Millipore) antibodies by standard protocol.

Fresh tissues were dissociated as described above, and single cells were isolated by microaspiration. Genomic DNA was amplified and sequenced as described in (16). Fastqs were aligned using bwa-mem, with resulting bams sorted and duplicates marked using Picard. Coverage was then computed over 500-kb bins across the entire genome. The count for each bin was then divided by the sum across all bins for the relative sample (to correct for library size) and then by the median for that genomic bin across all samples from the same batch. The coverage profiles were then transformed into .wig files and fed into the R package HMMcopy for segmentation and CNV calling. HMMCopy was run with e = 0.9999999 and nu = 5, with all other parameters set to default. A noise statistic termed VS was computed in the same manner as (16), with cells with values greater than or equal to 0.5 being excluded from the analysis. CNVs that mapped to the Y chromosome were less than 10 Mb in size or had an absolute log2 ratio of less than 0.4 that were excluded from the analysis.

Total RNA from sorted cell populations was extracted using an RNeasy FFPE kit according to the manufacturers instructions. Libraries for ribosomally reduced RNA were prepared by the Harvard Biopolymers Facility using directional RNA-seq Wafergen protocol. Libraries were sequenced on Illumina HiSeq 2000 at Next-Generation Sequencing Core at Massachusetts General Hospital. Transcripts per million (TPM) values were computed using Salmon and batch-corrected using ComBat. The two samples with the lowest total counts were excluded from the analysis. GSEA was run on the ComBat-corrected TPM values using phenotype permutation and default parameters. The heat maps in Fig. 4 (B and D) were made using the ComBat-corrected TPM values, subset to the comparison of interest, and transformed into z scores by gene.

P values were determined using Students unpaired t test, unless indicated otherwise.

Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/5/eaay2611/DC1

Supplementary Materials and Methods

Fig. S1. Analysis of single-cell WGS data from normal human skin and brain cells.

Fig. S2. Identification and characterization of CNVs in freshly collected BRCA2mut/+ breast epithelial cells.

Fig. S3. Characterization of replication stress response deficiency and haploinsufficiency in BRCA2mut/+ breast epithelial cells.

Fig. S4. Suppression of NF-B/SASP response associated with loss of BRCA2.

Fig. S5. Proportions of mammary epithelial cell subsets in BRCA2 carrier and control tissues.

Table S1. Characteristics of patients undergoing WGS of breast tissues.

Table S2. Summary of single-cell site-specific PCR/sequencing data.

Table S3. Characteristics of patients undergoing RNA-seq of breast tissues.

Reference (43)

This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial license, which permits use, distribution, and reproduction in any medium, so long as the resultant use is not for commercial advantage and provided the original work is properly cited.

Acknowledgments: We thank the HSCI-CRM Flow Cytometry Core Facility for assistance with cell sorting and the MGH DF/HCC Specialized Histopathology Service Core for immunostaining experiments. We thank the Biopolymers Facility at Harvard Medical School for library processing of RNA samples and the MGH Next Generation Sequencing Core for performing RNA-seq. We are grateful to the MIT BioMicroCenter for performing genome sequencing reactions. Funding: This work was supported by DOD/CDMRP grant BC140903 (to L.W.E.), the Tracey Davis Breast Cancer Research Fund (to L.W.E.), the Weissman Family MGH Research Scholar grant (to L.W.E.), the Susan G. Komen Foundation grant PDF16380794 (to M.K.-Y.), a Terri Brodeur Breast Cancer Foundation grant 2016D001483 (to M.K.-Y.), and the Howard Hughes Medical Institute (to A.A.). Author contributions: M.K.-Y., A.A., and L.W.E. conceived and designed the study. M.C.S. contributed patient samples. M.K.-Y., R.E.S., and S.V.S. designed and performed the experiments and interpreted the data. H.R., R.M., and V.V. performed the experiments. M.K.-Y., S.V.S., E.Z., A.D., and M.Y. performed the data analysis. M.K.-Y., A.L., K.N.R., S.R., and M.L. performed the bioinformatic analysis and interpreted the data. L.W.E., A.A., and M.L. conceived the experiments, interpreted the data, and provided the funding. L.W.E. and M.K.-Y. wrote the manuscript. All authors approved the final submitted manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read the original here:
Aneuploidy and a deregulated DNA damage response suggest haploinsufficiency in breast tissues of BRCA2 mutation carriers - Science Advances

APPLETON, Wis. (NBC26) -- Genetic testing kits have grown in popularity.

Doctors say there's a time where it is appropriate to use them and a time when the information might not be sufficient.

At 59-years-old, Robin Vandermoss was diagnosed with cancer.

"It has tracked through my father and his father," said Vandermoss. "I just kind of want to put the puzzle together."

Now more than 6 months later he's undergoing genetic testing at ThedaCare.

"Hopefully we end up with some results that can be useful for my children and their children going on," said Vandermoss.

He's taking a route that doctors say is best under his circumstances.

As direct-to-consumer genetic testing kits grow in demand, doctors are informing people there are times to use them and times to seek an alternate route.

"If anybody has a strong personal or family history of cancer, heart disease or other conditions running in their family, then they really need a more formal evaluation," said Bobby McGivern, a Genetic Counselor with ThedaCare Regional Cancer Center.

Here's how these tests work.

You send a saliva sample in the mail. Your sample is tested in a lab and you receive your results revealing a plethora of new information about yourself.

Some examples of traits you can learn from a direct-to-consumer kit are:

Doctors say if you choose to use a gene testing kit that you've ordered online it's best to read the fine print.

Make sure you understand the capabilities of the test and look closely at the privacy information so you know what the lab is doing with your DNA.

Overall doctors say direct-to-consumer genetic testing kits have inspired a valuable trend.

"Families are talking more about family history," said McGivern. "They're asking some of the older relatives what is in the family, or maybe they're initiating some conversations with primary care doctors that they wouldn't have otherwise."

Use the kits wisely and seek a genetics referral from your primary care doctor if you have risk factors or a family history.

Continue reading here:
Local News Doctors weigh in on pros and cons of genetic testing kits Brooke Hafs 5 - WGBA-TV

Medicare will pay for certain genetic tests for people with inherited ovarian and breast cancer while allowing Medicare administrative contractors (MACs) flexibility to decide whether to cover these tests for other uses.

The Centers for Medicare & Medicaid Services (CMS) on Monday released an update of its payment rules for diagnostic tests using next-generation sequencing (NGS).

It was just in 2018 that Medicare issued its first national coverage policy for this kind of testing, opting to cover NGS for recurrent, relapsed, refractory, metastatic, or advanced cancers (stage III or IV). But the giant federal health program has faced calls to revise its coverage of NGS, even as researchers continue to try to prove strong clinical benefits for this testing.

"The evidence for ovarian and breast cancer suggests that using NGS to identify germline mutations can lead to better stratification of patients in the physician management of inherited cancers of the breast and ovary," CMS staff wrote in the decision memo.

The American Society of Breast Surgeons recommends that all patients with breast cancer be offered universal genetic testing. However, the question of whether all breast cancer patients should be tested with multigene panels remains controversial, as reported previously by Medscape Medical News, with critics arguing that "more genes create more problems." A pertinent issue, until now, has been the question of who should pay for this testing.

That issue has now been resolved, at least for Medicare patients.

As part of this mandated coverage, Medicare will require use of NGS tests that have been approved by the US Food and Drug Administration (FDA). In these cases, results must be provided to physicians for management of the patient using a report template to specify treatment options, CMS said.

Medicare covers about 60 million Americans who are aged 65 years or older or who have disabilities. Its policies can influence those of other insurers, even beyond its role as the largest single purchaser of healthcare in the United States. Many groups and individuals asked CMS during its reconsideration of the NGS payment policy to mandate national coverage of other cancers. For now, the agency has rebuffed those requests while allowing MACs discretion in setting payment policies for NGS tests.

"At this time, there is insufficient evidence of clinical utility for other cancer types including male breast cancer, colorectal, lung, pancreatic and prostate cancer," CMS staff wrote in the memo while stressing that "evidence in this field is rapidly developing."

In the memo, CMS officials said the agency's intent is "to expand coverage" of NGS.

With this aim, CMS made several revisions to its draft coverage decision.

These included clarifying language to emphasize MACs' ability to consider coverage "for any cancer diagnosis including tests that are not FDA approved or cleared for breast and ovarian cancer provided all the criteria is met."

The memo also spelled out that MACs have discretion even for uses outside the scope of the national coverage decision.

The contractors have discretion to determine coverage of diagnostic laboratory tests using NGS "for any non-cancer (eg, infectious disease and heart disease)," CMS staff wrote.

CMS also said it changed its stance about cases of repeated NGS testing for patients.

"In response to public comments and to support further innovation and patient access, we have clarified our decision to include coverage for appropriate repeat NGS testing for germline (inherited) cancer and somatic cancers when criteria are met," CMS said.

However, agency staff noted limitations with the current body of evidence about use of NGS testing. These include a lack of meta-analyses and randomized controlled trials that specifically addressed NGS testing. The available studies "varied in quality for a number of reasons," including small samples of patients, agency staff wrote.

"Of all of the different types of cancers associated with germline mutations, only studies of breast and ovarian cancer had high quality evidence, and were able to demonstrate clinical utility through the use of NGS," CMS staff said.

Follow Medscape on Facebook, Twitter, Instagram, and YouTube.

View original post here:
Medicare to Cover Gene Tests in Inherited Breast, Ovarian Cancer - Medscape

White-nose syndrome, an often-fatal disease of hibernating bats, has been confirmed for the first time in a fringed myotis (Myotis thysanodes) in King County. This finding brings the total number of bat species confirmed with the disease in North America to 13.

First seen in North America in 2006 in eastern New York, white-nose syndrome is a fungal disease that has killed millions of hibernating bats in eastern North America and has now spread to 33 states and seven Canadian provinces. The disease does not affect humans, livestock or other wildlife.

According to the release, the disease is caused by the fungus Pseudogymnoascus destructans, which attacks the skin of hibernating bats and damages their delicate wings, making it difficult to fly. Infected bats often leave hibernation too early, which causes them to burn through their fat reserves and become dehydrated or starve to death.

The Cedar River Education Center near North Bend reported a dead bat outside its facility in April 2017. A biologist with the Washington Department of Fish and Wildlife (WDFW) retrieved the dead bat and did a field test using ultraviolet (UV) light to detect the fungus that causes white-nose syndrome. Under UV light, bats with white-nose syndrome usually have an orange glow on their wings.

The North Bend bat was later confirmed to have white-nose syndrome by the University of California, Davis School of Veterinary Medicine. To identify its bat species, the Northern Arizona Universitys bat ecology and genetic lab tested the bat and although the results did not show a conclusive identification, scientists were able to narrow it down to two closely-related bat species long-eared myotis and fringed myotis.

With the possibility of a new bat species affected by white-nose syndrome, we explored ways to confirm the species using additional genetic testing, Abby Tobin, white-nose syndrome coordinator for WDFW said in the release. Fortunately, our partners at the U.S. Geological Survey (USGS) National Wildlife Health Center in Madison, Wisconsin stepped up to the challenge.

Jeff Lorch, a microbiologist at the USGS National Wildlife Health Center, used nuclear DNA testing to confirm the bat as a fringed myotis in December 2019.

There are two parts of a cell that carry DNA the nucleus and the mitochondria, Lorch said in the release. Most bat genetic testing has used mitochondria DNA, which does not allow us to distinguish the long-eared bat from the fringed bat. By using nuclear DNA, we were able to get more accurate results.

According to the release, fringed bats are widely dispersed in dry forests throughout western North America from Mexico to British Columbia. However, there is a lack of data on the bats population size, health trends, or where they hibernate in winter.

Tracking white-nose syndrome and its effects on bat populations is challenging when little is known about bats in Washington, and this species in particular, Tobin said in the release. The confirmation of white-nose syndrome in another bat species is a reminder of how much we still have to learn about this devastating disease.

In 2016, scientists first documented white-nose syndrome in Washington near North Bend in King County. Since then, WDFW has confirmed 46 cases of the disease and/or the fungus in four bat species in the state. A timeline of fungus and white-nose syndrome detections in Washington is available online atwdfw.wa.gov/bats.

WDFW staff urge people to not handle wild animals, and to not touch bats that appear sick or are found dead. Even though the fungus is primarily spread by bats themselves, humans can unintentionally spread it as well. People can carry fungal spores on clothing, shoes, or recreation equipment that touches the fungus.

Those who find sick or dead bats, or notice bats acting strangely, such as flying outside during the day or in freezing weather, can report their sightings online at wdfw.wa.gov/bats or call the WDFW at (360) 902-2515. WDFW also seeks reports of groups of healthy bats.

To learn more about the disease and the national white-nose syndrome response, and to get the most updated decontamination protocols and other guidance documents, visit whitenosesyndrome.org.

For more information on Washington bats, visit https://wdfw.wa.gov/species-habitats/living/species-facts/bats.

WDFW

Follow this link:
Genetic testing confirms first case of white-nose syndrome in a fringed myotis bat - The Reflector

The real privacy risks are DNA kits

Insurers want your genetic info | Jan. 13

As at-home genetic testing kits grow in popularity, some lawmakers in Florida are raising important concerns about the privacy risks facing consumers. But the bill recently brought forward by Rep. Chris Sprowls a proposal that met significant pushback in the Senate last year would fail to hold the companies that sell these tests accountable, and worse, let government tell Floridians what they can and cannot do with their own genetic code. Sprowls proposal attempts to prevent a hypothetical future in which life, long-term care or disability insurers all strictly regulated somehow access genetic information without a persons consent. Sprowls says it is conceivable that the alternate reality he sets up could come true and asks people to imagine what it would be like. He invents a scenario albeit extreme, in his words where certain types of insurance are only available to a genetic superclass. This is the stuff of science fiction, not the basis of a policy that could disrupt the life, long-term care and disability insurance markets and affect millions of Floridians.

Lawmakers should focus on the real threat consumers face, as direct-to-consumer genetic testing companies operate in a Wild West environment. Instead of trying to thwart an imagined future by making a preemptive strike on insurers, Florida should set clear rules for these companies.

Lawmakers should develop a solution that actually addresses the root problem: Many at-home genetic testing companies are roping consumers into exploitative agreements they do not understand and then sharing their private information far and wide.

Wanda Grubbs Schwerer, Belleair Bluffs

East Lake fights Tarpon annexation | Jan. 27

Tarpon Springs and Pinellas County officials should oppose any annexations of East Lake and Lake Tarpon areas for development. These areas should remain rural and natural. There is a greater benefit to the environment and the culture of our county by leaving these properties zoned agricultural and low density. The annexation plan proposed by Pioneer Homes would greatly add to suburban sprawl, which has already been detrimental to the character of Tarpon Springs, once a scenic small town surrounded by rural areas and wilderness. It will further isolate the wildlife at Brooker Creek Preserve, and endanger wildlife with heavy automobile traffic. What Pioneer Homes is achieving in short-term profit for its owners will come at a severe cost to everyone else. The loss of our rural areas, our wilderness and the character of our communities is irreplaceable.

Joseph Weinzettle, Tarpon Springs

Senate must hear Bolton | Column, Jan. 28

Does anyone believe that John Boltons testimony would sway enough Republican senators? Many dont believe the president committed an impeachable offense even if the accusation turns out to be true. Its time for the Republicans to high-five. This ones over.

Hal Batey, St. Petersburg

At least one important witness is absent from the impeachment trial of Donald J. Trump. Not John Bolton. The missing witness is someone who would call upon the senators who sit in judgment of the president to reflect upon his background as a person, businessman and politician, and ask themselves: Is Donald Trump capable of this wrongdoing? Or is he simply incapable of such treachery? Does such a credible character witness exist anywhere?

Fred Kalhammer, Sun City Center

Go here to see the original:
Home DNA kits, not insurers, are the real privacy risk - Tampa Bay Times