Archive for the ‘Skin Stem Cells’ Category

The electronic newsletter I Love My Freedom on a regular basis blasts out e-mails hawking ostentatious rip-offs as well as serpent oil, such as a dementia-reversing miracle therapy, a diabetes destroyer material as well as a life-saving cancer cells treatment that a Nazi drug store allegedly established at Hitlers command. Peppered in between these messages funded by third-party hucksters are main advertisements from Donald Trumps governmental reelection campaign.

For months, participants of the head of states internal circle consisting of Donald Trump Jr., Senate Majority Leader Mitch McConnell (R-Ky), previous House Speaker Newt Gingrich as well as also Trump himself have actually been releasing require contributions with the newsletter, which usually heads out 5 or even more times each day. Many receivers were most likely unintentionally subscribed; I Love My Freedom, the team that runs the eponymous newsletter, has actually obtained an expanding checklist of Americans call info with a concealed e-mail collecting system including an internet of pro-Trump Facebook web pages.

Right- wing political leaders, companies as well as media electrical outlets have a background of dealing with unethical entities behind the scenes to earn money as well as press their programs. The Trump campaigns service with I Love My Freedom is no exemption.

I Love My Freedom (e-mail information multiplied by HuffPost).

By layout, its e-mails seem theyre sent out straight from Trump as well as his allies, though theyre in fact dispersed by means of [emailprotected] At all-time low, they birth please notes noting they were spent for by either the National Republican Senatorial Committee, its House equivalent, the McConnell Senate Committee, or the Trump Make America Great Again Committee (which is collectively run by the Republican National Committee as well as Trumps reelection campaign).

Renting out accessibility to collected e-mail listings is a typical as well as very profitable method worked out by traditional as well as liberal teams alike, commonly for political fundraising objectives. But points obtain morally dirty when e-mail representatives do not veterinarian their enrollers which can lead to e-mail receivers being flooded with ripoffs as well as scams, like the counterfeit cancer cells treatment. In this instance, nonetheless, the genuine inquiry is whether Trumps group troubled to veterinarian I Love My Freedom.

The campaign did not react to HuffPosts ask for remark.

I Love My Freedom, which makes up the newsletter as well as a conservative blog site called Trending Politics, belongs to Making Web LLC, a rare advertising company thats signed up in Minnesota to a 51- year-old male called Allan G. Ferretti.

Through the newsletter alone, I Love My Freedom has actually enhanced a list of aggressive rip-offs consisting of some that misleadingly link Trump, in spite of its negotiations with his campaign. Hours prior to dispersing a fundraising e-mail from the McConnell Senate Committee this month, I Love My Freedom discharged off a funded message advertising a breakthrough stem cell therapy which it baselessly suggested Trump is getting.

This has got Liberals jumping out of their seats, the e-mail checks out. President Trump is in perfect health how is it that hes so seemingly immune to old age? Well in recent years, billionaires like President Trump have increasingly turned to the power of Stem Cells.

Titled Trump Health Bombshell, the e-mail web links to a rambling item pitch that promotes $67 containers of stem cell tablets as the Holy Grail of aging backwards. These tablets make cells inside your body become physically younger, it asserts, without supplying a shred of clinical proof. I Love My Freedom has likewise spammed its customers with enrollers get-rich-quick plans consisting of a secret IRS loophole, as well as has actually routed them to video clips recommending elders ought to exchange their recommended medicines for tricksters supplements also advising that they can pass away if they do not.

Recent newsletter versions have actually circulated actual phony information, as well, installing advertisements camouflaged as write-ups that connect to internet sites stealthily copying genuine media electrical outlets.

I Love My Freedom e-newsletters have actually included misleading advertisements resulting in phony information websites copying genuine electrical outlets..

One such advertisement includes the message Royal Family Mourns As Tragedy Is Confirmed, along with a picture of Meghan Markle, the Duchess ofSussex Clicking on it causes a web site imitating U.S.A. Today that goes crazy regarding a skin care line, which it incorrectly asserts Markle released. Another, birthing the heading [BREAKING NEWS] Prayers Go Out to Oprah Winfrey, web links to a fraudulent information website marketing a Brain Booster supplement, which it brazenly states is in charge of Winfreys occupation success.

In enhancement to Trump, his oldest kid, McConnell as well as Gingrich, I Love My Freedom has actually likewise sent fundraising e-mails in behalf of previous White House press assistant Sarah Huckabee Sanders, House Minority Leader Kevin McCarthy (R-Calif), House Republican Whip Steve Scalise (R-La), previous United Nations Ambassador Nikki Haley,Rep Elise Stefanik (R-N.Y.),Rep David Joyce (R-Ohio), previous White House Deputy Chief of Staff Karl Rove as well as National Republican Congressional Committee Chairman TomEmmer

All were spent for by the NRCC, NRSC, McConnell Senate Committee or the Trump Make America Great AgainCommittee Only the NRCC reacted to an ask for remark.

We rented this list to prospect new donors. We do our best to vet each vendor, but similar to renting a car, it is impossible to know or control what every other renter does with a list they too are renting, spokesperson Chris Pack informed HuffPost.

We will not be using this vendor going forward.

I Love My Freedom constructed its cash-cow e-mail realm by spending virtually $2 million right into Facebook advertisements, which attract individuals in with clickbait surveys or pledges of free MAGA equipment, as well as result in web pages advising them to send their e-mail addresses. This immediately indications them as much as obtain the newsletter, in addition to its numerous funded messages.

The team likewise earns money by marketing Trump- themed product such as Make Liberals Cry Again hats, as well as organizing third-party advertisements on Trending Politics which was seen a million times last month alone, according to electronic analytics device ComparableWeb

I Love My Freedom did not accept HuffPosts ask for a meeting.

I Love My Freedom makes use of clickbait Facebook advertisements to gather individualss e-mails, after that subscribes them to its newsletter.

Ferretti released ilovemyfreedom.org in addition to the Facebook web page Trump for President Fan Club (currently President Donald Trump Fan Club, which has 1.6 million fans) in the summertime of 2015, as reporter April Glaser reported last loss in a write-up regarding I Love My Freedoms viral development on Facebook.

Its among greater than a lots preferred web pages the team runs to run its countless Facebook advertisements, consisting of Donald Trump Is My President, Donald Trump 2020 Voters, President Trump Has My Vote, Donald Trumps Americans, Team Trump Fan Club, The President Trump Fan Club, We Need Trump 2020 as well as President Trumps Patriot Army.

These web pages create a stream of hyper-partisan memes as well as Trending Politics post to their target market of millions. Boosted by Facebooks formula, the advertisements which largely target elders are in some cases seen thousands of countless times each.

This looks like an operation thats got a very highly engaged audience that would be a prime target for a lot of conservative politicians to try to raise grassroots money from, stated Michael Beckel, research study supervisor at the political reform team Issue One.

When you run a pro-Trump Facebook team with greater than a million participants, that can make your [email] checklist an appealing possession.

Trumps campaign has actually currently gathered a citizen e-mail checklist thats so big it leases it out to outdoors celebrations. So why would certainly his group wish to fundraise with I Love My Freedoms checklist particularly provided the teams historical connections to grifters as well as scam artist?

Its type of striking that the Trump campaign is making a financial investment in [I Love My Freedoms] checklist, kept in mindBeckel But a t completion of the day, he stated, much more e-mails still means more potential voters or donors for them.

Calling all HuffPost superfans!

Sign up for subscription to come to be a starting participant as well as aid form HuffPosts following phase

Read the rest here:
Donald Trump Is Using An Insanely Sketchy Newsletter To Find Campaign Donors - The Union Journal

Hair loss has long been a chief complaint among women, especially as they age. It affects some 30 million women in the United States alone, according to the Cleveland Clinic, and will significantly impact more than 50 percent of women during their lifetime. The most common cause is female-pattern hair loss (FPHL), also known as androgenetic alopecia. It's a chronic and progressive condition that has a genetic component, but it's also caused by factors related to the actions of hormonesovarian cysts, use of high androgen index birth control pills, pregnancy, and menopause, explains Ken L. Williams Jr., D.O., hair restoration specialist, surgeon, founder of Orange County Hair Restoration in Irvine, California.

Other medical conditions are also to blame for hair loss in women, including thyroid disorders, polycystic ovary syndrome, anemia, and chronic illnessand the use of certain medications, many of which treat these conditions, can also lead to hair loss in women. "Certain types of autoimmune disorders result in a slightly different and often less dramatic hair loss problem known as alopecia areata, an inflammatory condition that causes hair to come out in clumps or patches," says Dr. Williams Jr.

Luckily, we've come a long way in terms of treating hair loss. After all, 100 years ago, remedies involved things like snake oil and bat and chicken dung. "In more recent years, clinically tested topical and oral products, such as Minoxidil and Propecia, have become available, as well as procedures like PRP (platelet rich plasma therapy), and hair transplants," shares Anabel Kingsley, consultant trichologist and brand president for Philip Kingsley. She finds a holistic, personalized, multi-pronged approach to be the most effective way to treat any form of hair loss. "Since there is no 'one size fits all,' you want to optimize all possible factors that can affect the hair growth cycle, such as general health, nutrition, and stress levels, as well as the condition of your hair and scalp," she says.

At Philip Kingsley, she treats clients with their Trichotherapy Regime ($215, saksfifthavenue.com), which is specifically formulated for women with fine hair and reduced volume. "It tackles hair loss from all possible angles via the scalp with intensive daily Scalp Drops($89, neimanmarcus.com),a daily Stimulating Scalp Tonic ($28, net-a-porter.com), a thickening protein spray, and targeted masks to optimize the scalp environment," Kinglsey explains. "It also contains carefully formulated nutritional supplements to help give hair support from within."

Related: The Best Shampoos to Support Thinning Hair and Fight Female Hair Loss

Over-the-counter solutions won't work for every person suffering from hair loss, but there are a number of medical interventions that can stimulate hair growthanti-androgen medication, for example, is recommended for clients experiencing prolonged hair loss. "These medications help prevent further hair loss and encourage some hair regrowth from dormant hair follicles," says Dr. Williams Jr. There is also stem cell therapy, which has expanded greatly over the last few years in treating medical disease. "As opposed to embryonic cells, the initial stigma of using stem cells has decreased since the discovery of using bone marrow, fat cells, umbilical cord cells, and even skin cells to extract stem cells," he explains.

Surgery is also an option, and there are currently two primary surgical techniques or methods used in performing hair transplantation: Follicular Unit Transplantation (FUT) and Follicular Unit Extraction (FUE). "With the FUT technique, a section of scalp is excised with a scalpel, the scalp is brought together with sutures or staples and the hair follicles or hair grafts are inserted into tiny slits placed by the surgeon in the balding recipient area," Dr. Williams Jr. says. "The follicles with a single hair are placed in the front rows to define and create a natural hairline and the more dense, natural occurring follicular units are placed by hand in areas where hair density is needed the most."

FUE, a minimally invasive technique that is being hailed as the most significant improvement in hair surgery, uses a minimal depth scoring punch device to loosen the follicle from the surrounding tissues. "With the FUE procedure, a 0.9 or 1.0 millimeter punch minimal depth scoring excision is used in the skin around the upper part of the follicular unit (hair follicles)," he continues. "The hair follicle is then extracted directly from the scalp and manually placed into tiny slits in the balding area similar to the strip method."

There are still several hair restoration solutions left to be discoveredand experts believe most of us will see the concept of hair cloning come to fruition in their lifetime. "Hair cloning would in effect, disassemble a few hair follicles, multiply these cells in the laboratory and then reintroduce them into the scalp to both rejuvenate miniaturizing hair follicles and induce brand new hairs," Dr. Williams Jr. says. "Other groups have tried this but it has been found that when human follicle cells are cultured, they rapidly lose their functionality."

Continue reading here:
The Forefront of Treating Hair Loss in Women - Yahoo Lifestyle

California: In a breakthrough study, researchers have found a potential treatment for life-threatening cardiac diseases by using gene therapy.

Danon disease is a very rare, life-threatening condition where the fundamental biological process of removing and recycling proteins does not work.

This impairment results in dysfunction of the heart, skeletal muscle, neurologic system, eyes, and liver. Most patients die or require heart transplants by the third decade of life.

In the study, which was published in Science Translational Medicine, researchers have identified a novel way to treat Danon disease using gene therapy.

Heart transplant is not always available for patients and does not treat the other organs affected in Danon disease. We knew we needed to find therapies specifically designed to address the underlying cause, said the lead researcher Eric Adler.

Danon disease is a result of mutations in the gene LAMP2. For nearly a decade, Adler and a team of researchers at UC San Diego Health have been working to determine whether gene therapy could provide a new treatment approach.

Gene therapy involves either replacing or repairing a gene that causes a medical problem or adding genes to help the body treat disease. In this case, Adler and the team focused on adding a specially designed gene that restores the LAMP2 function, resulting in improved cardiac and liver function.

We utilised mice that were a model for Danon disease and missing this specific LAMP gene. We applied gene therapy to a group of these mice and compared to mice that did not receive treatment, said Adler.

The mice that received gene therapy expressed positive results in heart, liver and muscle function. The hearts overall function of ejecting blood and relaxing improved, as did the bodys ability to degrade proteins and metabolism.

Danon disease is more common in males, and symptoms begin in early childhood or adolescence.

In many cases, the condition is inherited by a parent, typically the mother. We believe Danon disease is actually more common than we think, but it is often misdiagnosed, said Adler.

By utilising gene therapy, we were able to identify a possible new treatment approach other than a heart transplant. This study is a significant step for patients with Danon disease, Adler added.

Prior studies in Adlers lab have focused on using a patients skin cells to create stem cells. These stem cells were used to create a heart model, allowing researchers to study Danon disease at the cellular level.

The approach has provided new insight into the diseases pathology and led to the idea of using gene therapy. Our work is also proof that using stem cells to model diseases has great potential for helping develop new medicines, said Adler.

The next step, said Adler, is testing in patients with Danon disease. A Phase I clinical trial for safety and efficacy has begun.

This is the first trial using gene therapy to treat a genetic cardiac disorder and three patients are currently being treated, which means were that much closer to finding a cure for this terrible disease, and may be able to use similar methods to treat other diseases, said Adler.

Get the latest updates in Technology, Entertainment, Sports, Politics and Top Stories on WhatsApp & Telegram by subscribing to our channels. You can also download our app for Android and iOS.

More here:
Study reveals gene therapy may help in treating cardiac disease - The Siasat Daily

LEXINGTON, Mass., March 24, 2020 /PRNewswire/ --Partner Therapeutics, Inc. (PTx) announced that Leukine (sargramostim, rhu-GM-CSF)is being assessed in the SARPAC trial (sargramostim inpatients withacute hypoxic respiratory failure due toCOVID-19 EudraCT #2020-001254-22) at University Hospital Ghent to treat patients with respiratory illness associated with COVID-19. Major medical centers in Germany, Italy and Spain are considering joining the study. The study will evaluate the effect of Leukine on lung function and patient outcomes.

"Patients with COVID-19 who progress to acute hypoxic respiratory failure due to COVID-19 have very limited treatment options and a high mortality rate," said Prof. Bart Lambrecht, Principal Investigator for the trial at University Hospital Ghent and the Flanders Institute of Biotechnology (VIB). "We rapidly initiated this study with Leukine, because GM-CSF has profound effects on antiviral immunity, can provide the stimulus to restore immune homeostasis in the lung, and can promote lung repair mechanisms."

Granulocyte macrophage colony stimulating factor (GM-CSF) is essential for the health of the lungs. Alveolar macrophages, a cell type found in the lungs, are dependent on GM-CSF for differentiation and normal functioning. GM-CSF is an immunomodulator that plays a critical role in host defense against pathogens and maintaining proper functioning of the immune system.1 GM-CSF confers resistance to influenza by enhancing innate immune mechanisms.2 In animal studies, GM-CSF reduced morbidity and mortality due to acute respiratory distress syndrome (ARDS) from viral pneumonia.3 In clinical studies, use of Leukine showed beneficial effects in patients with viral pneumonia.4,5 Recent data highlight the importance of understanding the immune status of patients and role of immunomodulating agents like GM-CSF to activate the immune system to help clear virus and reduce the risk of secondary infections.6

"Partner Therapeutics is committed to investigating Leukine in patients with COVID-19 and we are working with academic and government agencies here in the US and in Europe in this effort," said Dr. Debasish Roychowdhury, Chief Medical Officer at Partner Therapeutics. "We believe, like many investigators and scientists, that GM-CSF has multiple ways by which it may help these patients, including playing a role in clearing the infection, boosting the immune system and repairing damaged tissues."

"In pre-clinical studies, GM-CSF protects the lungs from viral pneumonia and the influenza A virus", stated E. Scott Halstead, MD, PhD, Associate Professor, Penn State University College of Medicine, Department of Pediatrics, Division of Pediatric Critical Care Medicine. "Preliminary data indicate an apparent benefit of inhaled Leukine therapy for autoimmune pulmonary alveolar proteinosis ("aPAP") and suggest it has reduced the need for whole lung lavage therapy for patients receiving treatment. Collectively, the data suggest that aerosolized Leukine may prove to be a meaningful therapy to decrease mortality and increase ventilator-free days in patients with respiratory disorders associated with viruses such as COVID-19 and Influenza A."

For the treatment of COVID-19 associated acute hypoxic respiratory failure and ARDS, Leukine will be used in nebulized form for direct inhalation or through intravenous administration for patients already on a respirator. Nebulized Leukine has been studied in phase 2 and phase 3 randomizedtrials in pulmonary conditions that affect alveolar macrophages, such as aPAP. IV administration of Leukine has been studied extensively in other conditions and in phase 2 randomized trials in ARDS.

Leukine was initially approved in the United States in 1991 and has been approved for use in five clinical indications. Its safety and tolerability profile are well understood. In 2018, Leukine was approved for use as a medical countermeasure to treat Acute Radiation Syndrome (ARS) and has been procured for use by the U.S. Strategic National Stockpile. Leukine is distributed outside the U.S. on a named-patient basis through PTx's designated program manager, Tanner Pharma Group. The use of Leukine to treat respiratory disorders associated with COVID-19 is investigational and has not been fully evaluated by any regulatory authority.

Please see full Prescribing Information for LEUKINE at http://www.leukine.com

About Leukine(sargramostim)Leukine is a yeast-derived recombinant humanized granulocyte-macrophage colony stimulating factor (rhuGM-CSF) and the only FDA approved GM-CSF. GM-CSF is an important leukocyte growth factor known to play a key role in hematopoiesis, epithelial repair, and augmentation of innate host defense by effecting the growth and maturation of multiple cell lineages as well as the functional activities of these cells in antigen presentation and cell mediated immunity.

Important Safety Information for LEUKINE (sargramostim)

Contraindications

Warnings and Precautions

Adverse Reactions

Adverse events occurring in >10% of patients receiving LEUKINE in controlled clinical trials and reported in a higher frequency than placebo are:

Please see full Prescribing Information for LEUKINE at http://www.leukine.com

Indications and Usage

LEUKINE (sargramostim) is a leukocyte growth factor indicated for the following uses:

About Partner Therapeutics, Inc.: PTx is an U.S.-based commercial-stage biotech company focused on the development and commercialization of therapeutics that improve health outcomes in the treatment of cancer. PTx's development focus spans the entire range of cancer therapy from primary treatments to supportive care. The company believes in delivering great products with the purpose of creating the best possible outcomes for patients and their families.

References

Cited References

Other RelevantReferences

SOURCE Partner Therapeutics, Inc.

http://www.partnertx.com

Read this article:
Partner Therapeutics Announces Initiation of Clinical Trial to Evaluate Leukine in Patients with COVID-19 Associated Respiratory Illness - PRNewswire

Updated March 23, 2020 19:48:55

With the whole world talking, reading, posting and sharing all sorts of information about coronavirus, it can be hard to sort through what is actually a fact and what is a myth.

Maybe you've got a friend writing on Facebook about how coronavirus will die with a change of season, or another who thinks they've got an excellent home remedy to prevent themselves from getting the disease?

Whatever the case, there are some myths that keep popping up over and over again. So, we've gone to the experts.

Here's what our correspondents say are some of the most popular myths around, and two experts' takes on them.

Who is saying this? The President of the United States.

What's being said exactly? Donald Trump told Fox Business: "You know in April, supposedly, it dies with the hotter weather."

According to CNN, he also told state governors: "You know, a lot of people think that goes away in April with the heat as the heat comes in. Typically, that will go away in April."

How widespread is this? Well, Donald Trump's quotes have been reported by major news outlets.

Professor of respiratory diseases at the University of Technology Sydney Brian Oliver says it would depend on the temperature you're talking about.

"For example, your body temperature is 37 degrees Celsius and we know coronavirus can survive in that, so if it's 37C or 40C outside, it would probably survive," Professor Oliver said.

"If it were something like 50C, well then it probably wouldn't survive too well. But how many places reach 50C?"

Infectious disease experts have also told CNN that it's too early to say whether warmer weather could impact the virus, and "nobody knows enough about the novel coronavirus to make assessments about its behaviour".

However, Professor Oliver said extreme heat can be useful.

"Extreme heat is used as a form of sterilisation in hospitals," he said.

"And if it's a really sunny day, the UV rays contained in the sun could kill the virus as well. Basically, the UV light destroys the genetic material. But we don't know how long is needed to kill the virus.

"So heat can be useful, but a warm day and 37C would be regarded as a warm day is not going to do much."

As told by South-East Asia correspondent Amy Bainbridge and Indonesia correspondent Anne Barker

Who is saying this? Residents in Bangkok, Indonesians and even Indonesian President Joko Widodo.

What exactly are they doing? There is a clinic outside Bangkok that doubles as a medicinal cannabis clinic. It looks like they're being run off their feet producing pills that contain a special herb called Andrographis Paniculata.

It's traditionally believed to be a treatment for colds and sore throats and apparently people are lining up to use it.

Meanwhile, in Indonesia, herbs have also become popular with residents looking to ward off coronavirus. Indonesians have rushed to buy herbal and medicinal plants such as turmeric, curcumin, lemongrass and ginger.

They believe that 'jamu' medicinal drinks made with such ingredients can boost stamina and health, and help strengthen the immune system.

Mr Widodo even last week told an agricultural and food conference that he drinks the herbal elixir three times a day to help prevent infection by coronavirus.

"I drink the mixture instead of tea now," he said.

"I give the drinks to my guests, be it the morning, afternoon or evening."

How widespread is this? Jamu is popular across Indonesia, although its ingredients might differ from one province to another.

The demand for ginger and turmeric has soared in the capital Jakarta and much of Java, where the price of red ginger has almost doubled in some places, and turmeric has tripled.

University of Melbourne professor of virology Damian Purcell says we haven't seen any scientific validation of those kinds of things.

"It's a risky strategy to believe something works without proper clinical trials and as yet there are no trials focused on examining whether specific herbs would be effective."

As told by South Asia correspondent James Oaten

Who is saying this? Fringe Hindu groups and a politician.

What exactly are they doing? Dozens of Hindu activists gathered in New Delhi on the weekend to hold a cow-urine drinking party, believing the drink would ward off coronavirus (and many other illnesses).

Others have also touted the health benefits of cow urine and even cow dung, including recently a politician from the Prime Minister's own party in the north-eastern region of Assam.

Many Hindus regard the cow as sacred.

Is this a common belief? It's mostly being touted by fringe groups so is far from being a popular myth.

Professor Oliver says it would "not do anything good for you".

While he says urine would have some slightly disinfectant properties on surfaces, "you'd have to drown someone in urine to save them from coronavirus".

"The only thing it could partially be useful for is, if you didn't have access to soap and water, you could use it to partially disinfect surfaces," he said.

As told by Middle East correspondent Eric Tlozek

Who is saying this? People in Iran.

What's being said exactly? Some believe drinking alcohol can be a way of killing coronavirus, according to Iranian sources I've spoken to.

One contact told me: "You know how alcohol is prohibited in Iran so, one of the good businesses here is some people make alcoholic drinks at home and they sell it [at a high price]."

Is it a common belief? It doesn't appear to be too common at this stage.

That's unlikely, Professor Oliver says. He points out that "you'd need a high concentration of alcohol to kill a virus".

"In the handwash you use for example, you need 60-70 per cent ethanol to be effective," he said.

"If people are drinking spirits, the relative concentration of that is relatively low. So the amount you would need to drink would kill you before it kills the virus."

Professor Purcell agrees, adding "very few spirits have above 30 to 40 per cent which would not be enough to kill the virus".

As told by Papua New Guinea correspondent Natalie Whiting

Who is saying this? It appears to have started in the United States but is also being spread on social media in PNG.

What exactly are they saying? The most common myth that has been raised with me, and one I've seen shared widely on social media, is that black people can't get coronavirus.

When the virus first started making headlines, I was asked about this rumoured immunity by a few people in PNG. Some posts on social media here were claiming there was a link between the virus and melanin levels.

How widespread is this? Now that the virus has spread further and there have been cases recorded in the Pacific, there have been more people trying to debunk this myth on social media.

"That's crackers."

According to Professor Oliver, the theory makes "absolutely no sense".

"Whatever pigmentation you have is of no interest to the virus because it doesn't impact the skin," he said.

"It would perhaps play a role if the virus infected the skin. But in this case, it doesn't so I'm not sure where people are getting this idea from."

Professor Purcell says: "The virus doesn't replicate in skin."

"It targets cells where there is no melanin, in the lungs and gastrointestinal tract, and there are no difference in melanin levels in those tissues," he said.

"Nobody is immune."

As told by Indonesia correspondent Anne Barker

Who is saying this? Social media users in Indonesia.

What are they saying? Posts on social media in the past few weeks have claimed coronavirus does not attack people who smoke because the composition of tobacco and cloves can resist the attack.

One Facebook user said cigarette smoke is effective in killing the virus.

How widespread is this? The original claim has gone viral on Twitter and other social media. That's despite there also being many health messages warning of the dangers of smoking.

The claims have been denied by health experts, including Eijkman Institute for Biology and Higher Education molecular biologist Professor Amin Soebandrio.

He says smoking increases ACE 2 receptors in the lungs that cause the COVID-19 virus.

Professor Soebandrio says each receptor acts like a port, so if there are more berths, more "ships" will come.

Professor Oliver agrees, saying if anything "smoking makes the outcomes worse".

Who is saying this? The internet. Social media. Your neighbours/friends/family?

What exactly are they saying? According to Johns Hopkins Medicine, there have been a couple of myths around swallowing or gargling essential oils, salt water and other home remedies as a way to cure coronavirus.

How widespread is this? It appears to be a common enough query to prompt Johns Hopkins to respond to it on their website.

Once you're infected there is very little chance these would work, Professor Purcell says.

"The virus introduces genetic material into your body, so you have to get rid of the cell itself," he said.

"While some of these things [antibacterial mouth washes] can kill a virus on a sheet of stainless steel, once it's in your system, you might reduce the amount of virus that you're shedding, but you need your immune system to do the job."

Professor Oliver agrees, although he suggests that traditional medicines do "have some efficacy around various conditions".

"But even when they work, they don't work as well as Western medicines," he said.

"Even if they are successful one day, like with herbal teas and so on, part of the problem is that it's really hard to know whether that effect could be replicated on the next day.

"Whereas a drug designed in a lab is made to be the same each time, and you also know something of the safety measures used to make the drug."

Professor Purcell says one reason that you might see these myths pop up is because it's difficult to understand the science behind viruses, so people begin to introduce their own ideas.

"You can't see it, so you can't relate to the chemistry," he said.

Professor Oliver agrees, adding that some of these cures or prevention techniques are the equivalent of old wives' tales.

Or, sometimes, they can stem from cultural beliefs that are passed down.

Topics:respiratory-diseases,infectious-diseases-other,diseases-and-disorders,health,world-politics,government-and-politics,china,indonesia,united-states,thailand,iran-islamic-republic-of

First posted March 23, 2020 17:41:27

Link:
Coronavirus 'cures' and prevention techniques are popping up all over the world. So we asked the experts what actually works - ABC News

A team of University of California, Irvine researchers have published the first comprehensive overview of the major changes that occur in mammalian skin cells as they prepare to heal wounds. Results from the study provide a blueprint for future investigation into pathological conditions associated with poor wound healing, such as in diabetic patients.

"This study is the first comprehensive dissection of the major changes in cellular heterogeneity from a normal state to wound healing in skin," said Xing Dai, PhD, a professor of biological chemistry and dermatology in the UCI School of Medicine, and senior author. "This work also showcases the collaborative efforts between biologists, mathematician and physicists at UCI, with support from the National Institute of Arthritis & Musculoskeletal & Skin Diseases-funded UCI Skin Biology Resource-based Center and the NSF-Simons Center for Multiscale Cell Fate Research.

The study, titled, "Defining epidermal basal cell states during skin homeostasis and wound healing using single-cell transcriptomics," was published this week in Cell Reports.

"Our research uncovered at least four distinct transcriptional states in the epidermal basal layer as part of a 'hierarchical-lineage' model of the epidermal homeostasis, or stable state of the skin, clarifying a long-term debate in the skin stem cell field," said Dai.

Using single-cell RNA sequencing coupled with RNAScope and fluorescence lifetime imaging, the team identified three non-proliferative and one proliferative basal cell state in homeostatic skin that differ in metabolic preference and become spatially partitioned during wound re-epithelialization, which is the process by which the skin and mucous membranes replace superficial epithelial cells damaged or lost in a wound.

Epithelial tissue maintenance is driven by resident stem cells, the proliferation and differentiation dynamics of which need to be tailored to the tissue's homeostatic and regenerative needs. However, our understanding of tissue-specific cellular dynamics in vivo at single-cell and tissue scales is often very limited.

"Our study lays a foundation for future investigation into the adult epidermis, specifically how the skin is maintained and how it can robustly regenerate itself upon injury," said Dai.

Reference:Haensel, D., Jin, S., Sun, P., Cinco, R., Dragan, M., Nguyen, Q., Dai, X. (2020). Defining Epidermal Basal Cell States during Skin Homeostasis and Wound Healing Using Single-Cell Transcriptomics. Cell Reports, 30(11), 3932-3947.e6. https://doi.org/10.1016/j.celrep.2020.02.091

This article has been republished from the following materials. Note: material may have been edited for length and content. For further information, please contact the cited source.

Link:
How Skin Cells Prepare To Heal Wounds - Technology Networks

It's not your imagination, it turns out. Stress can turn a person's hair gray. It's said that if you look at before and after pictures of any eight-year U.S. president the impact of the office on hair color is clear, though in fairness, it may be that candidates dye their hair and then at some point stop doing so. Nonetheless, scientists from Harvard have not only verified the conventional wisdom on our graying noggins, but have also figured out why stress is so brutal to our follicular pigmentation.

The new research from Harvard scientists is published in the journal Nature.

Image source: Ververidis Vasilis/Evan El-Amin/Vacclav/Shutterstock/Big Think

Senior author of the study Ya-Chieh Hsu, professor of Stem Cell and Regenerative Biology at Harvard, explains what prompted her research:

"Everyone has an anecdote to share about how stress affects their body, particularly in their skin and hair the only tissues we can see from the outside. We wanted to understand if this connection is true, and if so, how stress leads to changes in diverse tissues. Hair pigmentation is such an accessible and tractable system to start with and besides, we were genuinely curious to see if stress indeed leads to hair graying."

It turns out that stress activates nerves associated with our basic fight-or-flight system, and these nerves permanently damage pigment-regenerating melanocyte stem cells in hair follicles, causing them to cease production of melanin that normal provides color to hair follicles.

Hsu's team studied the issue using mice, and was somewhat stunned at their findings. "When we started to study this, I expected that stress was bad for the body but the detrimental impact of stress that we discovered was beyond what I imagined," recalls Hsu.

The scientists stressed the mice using a combination of three methods:

Image source: Helga Lei/Shutterstock

Hsu and her colleagues first suspected an immune system reaction was at the root of graying hairs only to discover that mice without immune systems still turned gray in response to stressors. The next suspect was cortisol produced by the adrenal glands however, this proved not to be so. "Stress always elevates levels of the hormone cortisol in the body," says Jsu, "so we thought that cortisol might play a role. But surprisingly, when we removed the adrenal gland from the mice so that they couldn't produce cortisol-like hormones, their hair still turned gray under stress."

Image source: Judy Blomquist/Harvard University

Finally, the researchers investigate the possibility that the system responding to stressors was the mice's sympathetic nervous systems, the part of the nervous system that kicks into action with the fight-or-flight impulse. The sympathetic nervous system is a vast network of nerves that connects, among other places, to hair follicles in the skin. In response to stress, the system sends a rush of the chemical norepinephrine to the follicles' melanocyte stem cell, causing them to quickly burn through and deplete their stores of pigment.

Say Hsu, "After just a few days, all of the pigment-regenerating stem cells were lost. Once they're gone, you can't regenerate pigments anymore. The damage is permanent." Great for survival, not so good for hair color.

Sympathetic system nerves are magenta above. Melanocyte stem cells are yellow.

Image source: Hsu Laboratory, Harvard University

"Acute stress," says lead author of the study Bing Zhang, "particularly the fight-or-flight response, has been traditionally viewed to be beneficial for an animal's survival. But in this case, acute stress causes permanent depletion of stem cells."

The research, done in collaboration with other Harvard researchers, presents a new appreciation of the effect the sympathetic system can have on the body's cells during stress.

One of these collaborators, Harvard immunologist Isaac Chu, notes, "We know that peripheral neurons powerfully regulate organ function, blood vessels, and immunity, but less is known about how they regulate stem cells. With this study, we now know that neurons can control stem cells and their function, and can explain how they interact at the cellular and molecular levels to link stress with hair graying."

Given this finding regarding the direct impact of stress on follicular stem cells, the question of what it else it may affect becomes an obvious one. As Hsu sums it up, "By understanding precisely how stress affects stem cells that regenerate pigment, we've laid the groundwork for understanding how stress affects other tissues and organs in the body."

This importance of the study therefore goes way beyond graying heads. "Understanding how our tissues change under stress is the first critical step," says Hsu, "toward eventual treatment that can halt or revert the detrimental impact of stress. We still have a lot to learn in this area."

Related Articles Around the Web

Read the rest here:
An unusual chance to see stress at work - Big Think

A breakthrough study provides a blueprint for future investigation into pathological conditions associated with poor wound healing, such as in diabetic patients. A team of researchers from the University of California has published the first comprehensive overview of the major changes that occur in mammalian skin cells as they prepare to heal wounds.

The study, "Defining epidermal basal cell states during skin homeostasis and wound healing using single-cell transcriptomics", was published this week in Cell Reports. According to Xing Dai, Ph.D., a professor of biological chemistry and dermatology in the UCI School of Medicine, and senior author, "This study is the first comprehensive dissection of the major changes in cellular heterogeneity from a normal state to wound healing in the skin."

This work also showcases the collaborative efforts between biologists, mathematicians and physicists at UCI, with support from the National Institute of Arthritis & Musculoskeletal & Skin Diseases-funded UCI Skin Biology Resource-based Center and the NSF-Simons Center for Multiscale Cell Fate Research. "Our research uncovered at least four distinct transcriptional states in the epidermal basal layer as part of a 'hierarchical-lineage' model of the epidermal homeostasis, or stable state of the skin, clarifying a long-term debate in the skin stem cell field," said Dai.

Using single-cell RNA sequencing coupled with RNAScope and fluorescence lifetime imaging, the team identified three non-proliferative and one proliferative basal cell state in homeostatic skin that differ in metabolic preference and become spatially partitioned during wound re-epithelialization, which is the process by which the skin and mucous membranes replace superficial epithelial cells damaged or lost in a wound. Epithelial tissue maintenance is driven by resident stem cells, the proliferation and differentiation dynamics of which need to be tailored to the tissue's homeostatic and regenerative needs. However, our understanding of tissue-specific cellular dynamics in vivo at single-cell and tissue scales is often very limited.

"Our study lays a foundation for future investigation into the adult epidermis, specifically how the skin is maintained and how it can robustly regenerate itself upon injury," said Dai.

(This story has not been edited by Devdiscourse staff and is auto-generated from a syndicated feed.)

Download The Devdiscourse News App for Latest News.

Read more here:
Study reveals how skin cells prepare to heal wounds - Devdiscourse

It's not your imagination, it turns out. Stress can turn a person's hair gray. It's said that if you look at before and after pictures of any eight-year U.S. president the impact of the office on hair color is clear, though in fairness, it may be that candidates dye their hair and then at some point stop doing so. Nonetheless, scientists from Harvard have not only verified the conventional wisdom on our graying noggins, but have also figured out why stress is so brutal to our follicular pigmentation.

The new research from Harvard scientists is published in the journal Nature.

Image source: Ververidis Vasilis/Evan El-Amin/Vacclav/Shutterstock/Big Think

Senior author of the study Ya-Chieh Hsu, professor of Stem Cell and Regenerative Biology at Harvard, explains what prompted her research:

"Everyone has an anecdote to share about how stress affects their body, particularly in their skin and hair the only tissues we can see from the outside. We wanted to understand if this connection is true, and if so, how stress leads to changes in diverse tissues. Hair pigmentation is such an accessible and tractable system to start with and besides, we were genuinely curious to see if stress indeed leads to hair graying."

It turns out that stress activates nerves associated with our basic fight-or-flight system, and these nerves permanently damage pigment-regenerating melanocyte stem cells in hair follicles, causing them to cease production of melanin that normal provides color to hair follicles.

Hsu's team studied the issue using mice, and was somewhat stunned at their findings. "When we started to study this, I expected that stress was bad for the body but the detrimental impact of stress that we discovered was beyond what I imagined," recalls Hsu.

The scientists stressed the mice using a combination of three methods:

Image source: Helga Lei/Shutterstock

Hsu and her colleagues first suspected an immune system reaction was at the root of graying hairs only to discover that mice without immune systems still turned gray in response to stressors. The next suspect was cortisol produced by the adrenal glands however, this proved not to be so. "Stress always elevates levels of the hormone cortisol in the body," says Jsu, "so we thought that cortisol might play a role. But surprisingly, when we removed the adrenal gland from the mice so that they couldn't produce cortisol-like hormones, their hair still turned gray under stress."

Image source: Judy Blomquist/Harvard University

Finally, the researchers investigate the possibility that the system responding to stressors was the mice's sympathetic nervous systems, the part of the nervous system that kicks into action with the fight-or-flight impulse. The sympathetic nervous system is a vast network of nerves that connects, among other places, to hair follicles in the skin. In response to stress, the system sends a rush of the chemical norepinephrine to the follicles' melanocyte stem cell, causing them to quickly burn through and deplete their stores of pigment.

Say Hsu, "After just a few days, all of the pigment-regenerating stem cells were lost. Once they're gone, you can't regenerate pigments anymore. The damage is permanent." Great for survival, not so good for hair color.

Sympathetic system nerves are magenta above. Melanocyte stem cells are yellow.

Image source: Hsu Laboratory, Harvard University

"Acute stress," says lead author of the study Bing Zhang, "particularly the fight-or-flight response, has been traditionally viewed to be beneficial for an animal's survival. But in this case, acute stress causes permanent depletion of stem cells."

The research, done in collaboration with other Harvard researchers, presents a new appreciation of the effect the sympathetic system can have on the body's cells during stress.

One of these collaborators, Harvard immunologist Isaac Chu, notes, "We know that peripheral neurons powerfully regulate organ function, blood vessels, and immunity, but less is known about how they regulate stem cells. With this study, we now know that neurons can control stem cells and their function, and can explain how they interact at the cellular and molecular levels to link stress with hair graying."

Given this finding regarding the direct impact of stress on follicular stem cells, the question of what it else it may affect becomes an obvious one. As Hsu sums it up, "By understanding precisely how stress affects stem cells that regenerate pigment, we've laid the groundwork for understanding how stress affects other tissues and organs in the body."

This importance of the study therefore goes way beyond graying heads. "Understanding how our tissues change under stress is the first critical step," says Hsu, "toward eventual treatment that can halt or revert the detrimental impact of stress. We still have a lot to learn in this area."

Related Articles Around the Web

Excerpt from:
Scientists figure out why stress turns your hair gray - Big Think

It's not your imagination, it turns out. Stress can turn a person's hair gray. It's said that if you look at before and after pictures of any eight-year U.S. president the impact of the office on hair color is clear, though in fairness, it may be that candidates dye their hair and then at some point stop doing so. Nonetheless, scientists from Harvard have not only verified the conventional wisdom on our graying noggins, but have also figured out why stress is so brutal to our follicular pigmentation.

The new research from Harvard scientists is published in the journal Nature.

Image source: Ververidis Vasilis/Evan El-Amin/Vacclav/Shutterstock/Big Think

Senior author of the study Ya-Chieh Hsu, professor of Stem Cell and Regenerative Biology at Harvard, explains what prompted her research:

"Everyone has an anecdote to share about how stress affects their body, particularly in their skin and hair the only tissues we can see from the outside. We wanted to understand if this connection is true, and if so, how stress leads to changes in diverse tissues. Hair pigmentation is such an accessible and tractable system to start with and besides, we were genuinely curious to see if stress indeed leads to hair graying."

It turns out that stress activates nerves associated with our basic fight-or-flight system, and these nerves permanently damage pigment-regenerating melanocyte stem cells in hair follicles, causing them to cease production of melanin that normal provides color to hair follicles.

Hsu's team studied the issue using mice, and was somewhat stunned at their findings. "When we started to study this, I expected that stress was bad for the body but the detrimental impact of stress that we discovered was beyond what I imagined," recalls Hsu.

The scientists stressed the mice using a combination of three methods:

Image source: Helga Lei/Shutterstock

Hsu and her colleagues first suspected an immune system reaction was at the root of graying hairs only to discover that mice without immune systems still turned gray in response to stressors. The next suspect was cortisol produced by the adrenal glands however, this proved not to be so. "Stress always elevates levels of the hormone cortisol in the body," says Jsu, "so we thought that cortisol might play a role. But surprisingly, when we removed the adrenal gland from the mice so that they couldn't produce cortisol-like hormones, their hair still turned gray under stress."

Image source: Judy Blomquist/Harvard University

Finally, the researchers investigate the possibility that the system responding to stressors was the mice's sympathetic nervous systems, the part of the nervous system that kicks into action with the fight-or-flight impulse. The sympathetic nervous system is a vast network of nerves that connects, among other places, to hair follicles in the skin. In response to stress, the system sends a rush of the chemical norepinephrine to the follicles' melanocyte stem cell, causing them to quickly burn through and deplete their stores of pigment.

Say Hsu, "After just a few days, all of the pigment-regenerating stem cells were lost. Once they're gone, you can't regenerate pigments anymore. The damage is permanent." Great for survival, not so good for hair color.

Sympathetic system nerves are magenta above. Melanocyte stem cells are yellow.

Image source: Hsu Laboratory, Harvard University

"Acute stress," says lead author of the study Bing Zhang, "particularly the fight-or-flight response, has been traditionally viewed to be beneficial for an animal's survival. But in this case, acute stress causes permanent depletion of stem cells."

The research, done in collaboration with other Harvard researchers, presents a new appreciation of the effect the sympathetic system can have on the body's cells during stress.

One of these collaborators, Harvard immunologist Isaac Chu, notes, "We know that peripheral neurons powerfully regulate organ function, blood vessels, and immunity, but less is known about how they regulate stem cells. With this study, we now know that neurons can control stem cells and their function, and can explain how they interact at the cellular and molecular levels to link stress with hair graying."

Given this finding regarding the direct impact of stress on follicular stem cells, the question of what it else it may affect becomes an obvious one. As Hsu sums it up, "By understanding precisely how stress affects stem cells that regenerate pigment, we've laid the groundwork for understanding how stress affects other tissues and organs in the body."

This importance of the study therefore goes way beyond graying heads. "Understanding how our tissues change under stress is the first critical step," says Hsu, "toward eventual treatment that can halt or revert the detrimental impact of stress. We still have a lot to learn in this area."

Related Articles Around the Web

More:
Who's in charge here? - Big Think

Jagasia was concerned that although G.V.H.D. was the most likely diagnosis, it might not be the right one. The patient had already been tested for the usual infections seen in immune-suppressed patients. So he looked for other possible causes of the patients diarrhea. He didnt find any. The patient lost another 15 pounds. When he looked in the mirror, he hardly recognized himself. Jagasia arranged for the patient to start getting intravenous nutrition and began tapering one immune-suppressing medication in order to start another.

The patients son was in medical school in another part of the state and called home frequently. When his father finally told him how sick he was, his son got scared. His father was a minimizer. If he was saying this, things must be bad.

When he got off the phone, the young man immediately turned to the internet. He typed in gastroenteritis after ... stem-cell transplant. The first results that came up referred to a paper in a medical journal, Clinical Infectious Diseases, published nearly a decade earlier that identified an unexpected culprit: norovirus.

Norovirus is one of the most common causes of gastroenteritis in the world. In the United States, its linked to an estimated 21 million cases of nausea and vomiting every year. Diarrhea can be present but is not typically as severe as other symptoms. In a normal host, the infection resolves on its own after 48 to 72 hours, thanks to the hard work of the immune system. Even so, norovirus was not a common cause of diarrhea in those who are immunosuppressed. But in the medical-journal paper, the first of its kind, 12 patients who had a stem-cell transplant and developed a persistent diarrheal illness were found to have norovirus. And of those 12, 11 were initially thought to have G.V.H.D. In most of those cases, it was only after the immune-suppressing medications were reduced that the patients own defenses could come to the rescue and vanquish the virus.

The son immediately sent the paper to his father. Had he been tested for norovirus? he asked. The patient wasnt sure. He forwarded the journal article to Jagasia and asked if hed had this test. He hadnt. Jagasia was 99 percent certain that this was a wild-goose chase. Hed never seen norovirus in patients with compromised immune systems. Still, testing was easy.

When the test came back positive, Jagasia was stunned. He repeated the test. Positive again. He immediately started to taper the immune-suppressing medications. As the doses came down, the diarrhea slowed, and after a few weeks, it stopped completely. With the help of the IV nutrition, and a slowly improving appetite, the patient began to gain back the weight he lost. From the patients point of view, his son saved his life.

Go here to read the rest:
His Immune System Went Out of Whack. The Usual Treatment Didnt Work. Why? - The New York Times

For Earth, bleak times lay ahead. TheCOVID-19 diseaseis known to cause respiratory illness and fever, but some extra symptoms sweeping across the globe right now seem to be stress, fear, and anxiety. To provide some light relief in these dark times, weve collated 15 of our favorite good news stories to remind you that not everything is awful. Hold tight everybody, 2021 will come eventually.

The Super Pink Moon is comingYou might be stuck at home as part of your self-isolation, but luckily the night sky is about to put on quite a show as April sees the return of the Super Pink Moon. Full moons happen every month and were given different names by the Native Americans to map out the year based on significant events that ran in tandem with the occurrence of a full Moon. Aprils is known as the pink moon because it appeared at the same time as pink spring flowers. This Aprils will be a Super Pink Moon as it is the second supermoon of the year, a term used to describe the slightly enlarged appearance of the Moon as its fully illuminated by the Sun due to Earths position between the two. Quarantine or no, if you've got access to a window you should be able to catch sight of this beauty on April 7 and when you do, think of all the other people looking up at the same moon. Self isolation doesn't mean you're alone.

Mice have been cured of diabetesAn astonishing discovery at the Washington University School of Medicine in St. Louis has revealed that human stem cells could be successfully engineered to cure diabetes in mice, offering an avenue of hope for the treatment of this debilitating disease. They used human pluripotent stem cells, cells that have the capacity to become any cell in the body, to create insulin-producing pancreatic beta cells. The engineered stem cells supplemented the diabetic mices inability to produce insulin, curing them of the disease for 9 months to a year before relapse occurred.

Theres a new green fuel in townHydrogen fuel was fast shaping up to be a hopeful route for a zero-emissions means of running things, but its costly production in terms of energy was affecting hopes for it being a sustainable resource. A team in Tokyo has now managed to refine the process to yield 25 times more hydrogen than previous methods all while using thrifty ingredients including light and a specific kind of rust. Combined with all the solar power breakthroughs currently occurring, green energy is on the up.

A crash course in what not to do, according to one Stanford University psychologist.

Babies love baby talkEven if it makes your skin crawl to hear adults cooing over little uns, it turns out babies across the globe are universally partial to baby talk. The news comes fromStanford psychologist Michael Frank who led the largeststudyto date looking at how the different ways adults speak is received by babies across the world. While all babies were fans, older babies liked it best and even showed a preference for baby talk in their native language as they likely recognized it most even if they couldnt speak it yet. The overall winner was oohs and coos, so think twice before scorning your new-parent friends for embarrassing you in public the babies have spoken.

Important change in the winds for HIV treatmentShortly after a UK man became the second person cured of HIV a fantastic breakthrough in the treatment of this once devastating disease theres more good news in the UK as PrEP, a preventative drug that prevents HIV infection, will finally be available nationwide on the NHS having already been made available in Scotland. After a 3-year study involving 20,000 participants, the drug will be made available to those at higher risk of exposure from April. PrEP is already available in the US and you can find PrEP providers near you here.

-

Plasters finally take a step towards racial inclusivityMajor UK superstore Tesco has taken the long-awaited step to introduce skin tone diversity into their range of bandaids. Previously, widely available bandaids, or plasters in the UK, have mainly catered to Caucasian individuals and the racial oversight was brought to light by a moving Tweet from Domonique Apollon in April 2019 after he wore a bandaid suitable for his skin tone for the first time. Longtime readers of Malorie Blackman's literary series Noughts and Crosseswill appreciate this poignant detail becoming a reality, as will those watching the current BBC dramatization available to watch via iPlayer in the US (excellent for those self-isolating).

Universal flu vaccine passes integral stageWatchers of the Pandemic documentary on Netflix (we wouldnt recommend catching up now if you missed it) may remember the plight of flu-fighting epidemiologists as the constantly shape-shifting nature of influenza meant strains were annually moving beyond existing vaccinations. Now, a universal vaccine is becoming a reality as for the first time a vaccine, called FLU-v, has been developed that can induce immune responses that last at least six months. Phase I and II of the clinical trial have been approved meaning its safety for use in human subjects and we hotly await what comes next for the groundbreaking vaccine.

Top marks for lights out in dark sky nationSometimes a bit of darkness can be a good thing, and when it comes to nighttime, the tiny South Pacific island of Niue tops the charts. The International Dark-Sky Association (IDA) is a non-profit working to protect our most precious natural spaces from light pollution, and this year chose Niue as the first entire country ever to be accredited as a Dark Sky Place. This classification recognizes responsible lighting policies that preserve the natural darkness of nighttime carrying with it endless benefits for the biological cycles of animals, plants and humans.

-

People hating on National Parks created beautiful artIn a glimmering example of you cant please everybody, artist Amber Share decided to take some of the best worst reviews of National Parks in America and turn them intotourism posters, showing that we can still make something funny in the face of people's negativity. You can see the whole collection on her Instagram account @subparparks, but a personal favorite has to be the above magnificent minimization of Yellowstone.

CRISPR may hold the key for curing genetic blindnessSurgeons at Oregon Health & Science Institute have attempted to use gene hacking to cure Leber congenital amaurosis, a genetic condition that leads to the onset of blindness in early childhood. By directly gene editing within the patients eye, researchers hope to ...take people who are essentially blind and make them see," according to researchers.

The Arctic seed vault in Svalbard is thrivingLast month saw an enormous glut of 60,000 seed samples added to the ever-growing collecting in the Svalbard Global Seed Vault. Tucked beneath a mountain in Norway's Svalbard archipelago, the initiative began with hopes to create a Noahs ark for plant diversity to protect our green spaces should a global catastrophe occur up top. The collection now includes 1.05 million seed varieties including the first-ever donation from an indigenous US tribe. Nicknamed the "Doomsday vault", we may need it sooner than thought.

Sea sponges can sneeze, and the footage is amazingThe aah and choo of asneezing sea spongehas been caught on camera for the first time and the recording is hilarious. Stumbled upon almost by accident, the discovery came about while researchers were observing sea cucumbers and sea urchins sniffing the sea floor. The video shows the two-part sneeze of a tulip-shaped sponge as it expands before contracting, expelling particles as it goes. Researchers arent yet sure what the sneezes are in response to. Lets hope its not a case ofthe suds.

Vernal equinox brings early springThe times might be dark but for the Northern hemisphere, the days wont be, as spring arrives on March 19, the earliest date in 124 years. The variation in the date is the result of leap years and daylight savings time. It should be noted this is the astronomical definition of spring, which refers specifically to the position of Earth's orbit in relation to the Sun, so perhaps dont expect to hear a gay little spring song in your garden just yet.

Its possible some dinosaurs could GLOW IN THE DARKA titillating discovery published in the journal Historical Biology recently revealed that some dinosaurs may have glowed in the dark thanks to ultraviolet fluorescing feathers and horns. Many extant bird species are tetrachromats, defined by a fourth cone in their retina that means they can see the UV spectrum. Co-author Jamie Dunning's work on the photoluminescence of puffin beaks under UV light inspired the questions, could dinosaurs have this too? We'd like the answer to be yes, please. The only thing cooler than dinosaurs is glow-in-the-dark dinosaurs.

If you need more positivity in your life right now, take a look at these ingenious social distancing moments from around the world that will restore your faith in humanity.

More here:
15 Good News Stories To Tackle The COVID-19 Sadness - IFLScience

Blood cancer prevents your blood cells from functioning properly. Which symptom, that appears at night, could signal you may have the deadly disease?

When stem cells in your bone marrow which creates red blood cells mutates, the blood cells may grow abnormally or fail to die when they should this is cancerous cells.

There are three main types of blood cancer: leukaemia, lymphoma and myeloma.

These types of blood cancers affect different cells: leukaemia is the name given when white blood cells become cancerous; lymphoma happens certain white blood cells are affected; and myeloma is when plasma cells become cancerous.

Drenching night sweats is one symptom of the blood cancer lymphoma.

It's currently not known why this happens for this certain type of cancer.

The NHS states: "Night sweats are when you sweat so much that your night clothes and bedding are soaking wet, even though where you're sleeping is cool."

Bloodwise list other symptoms of blood cancer, which include unexplained bruising or bleeding.

In addition to these symptoms, Bloodwise list the following as symptoms of blood cancer:

An unexplained rash, bruising or bleeding is caused by low levels of blood-clotting cells.

The rash could be purple in colour (purpura), and the bruising could be tiny pin-sized red spots on the skin, called petechiae.

Lumps and swelling may be caused by abnormal white blood cells building up in lymph nodes. This is most noticeable in the neck, groin and armpit.

Read more:
Blood cancer symptoms: Watch out for this sign at night - it could be the deadly disease - Express

Boca Raton, Florida--(Newsfile Corp. - March 20, 2020) - LifeGaines reaches out to its patients and community who are concerned about COVID-19, the novel coronavirus.

"Dear LifeGaines Medical & Aesthetics Family,

"The staff at LifeGaines takes your health and safety seriously and we won't compromise when it comes to protecting our patients. We are closely monitoring the World Health Organization and CDC with regard to ongoing developments of the coronavirus (COVID-19) and we are committed to providing you a safe and clean environment.

"In an effort to reassure our patients, we want to inform you that we are continuing our rigorous routines to keep our practice sanitized and clean and will continue to take every precaution to keep you safe. Our daily safety standards include disinfecting our treatment rooms and equipment after each treatment and thoroughly washing our hands. We also wear new, clean gloves when applying products to our patients' skin and discard after each use. Also, our office is cleaned daily including wiping down tabletops, doorknobs, and equipment using medical-grade disinfectants."

Dr. LifeGaines reaches out to patients and community in light of COVID-19

To view an enhanced version of this graphic, please visit:https://orders.newsfilecorp.com/files/6848/53638_6ce3ae9244cd7992_001full.jpg

Please don't hesitate to contact us with any questions or concerns at (561) 931-2430. We look forward to seeing you soon.

https://www.facebook.com/LifeGaines/posts/1067452740282001 - Dr. Gaines gives a message on Facebook about how he is boosting his immune system as the COVID-19 virus spreads across the U.S.

Dr. Gaines talks about the benefits of IV ozone therapy. In addition to immunotherapy which helps boost someone's immune system, one should also drink plenty of water and get enough rest.

LifeGaines is mobile and visiting patients at their homes with the IV ozone therapy treatment. Inquire about this by calling LifeGaines.Learn about IV Vitamin Therapy here: https://lifegaines.com/wellness-therapies/iv-vitamin-therapy/

Don't hesitate to contact LifeGaines with any questions or concerns at (561) 931-2430.

About Dr. Gaines' LifeGaines team:

LifeGaines is one of the most highly respected age management medical teams anywhere. Age management medicine pioneer Dr. Richard Gaines has years of experience specializing in hormone replacement therapy, sexual wellness, platelet-rich plasma, stem cells, aesthetics, and advanced age management protocols.

About Dr. Gaines:

Dr. Richard Gaines graduated from Boston University School of Medicine in 1981. He completed his internship at Tufts University School of Medicine in 1981 and his residency at Harvard Medical School in 1985, where he was an anesthesiology fellow at Brigham and Women's Hospital. He served as a physician at Huntington General Hospital, as an anesthesiologist at Harvard Community Health Plan and at Sheridan Healthcorp. Dr. Gaines opened an age management and wellness practice after a 40-year career as a physician and health care executive. He has a Fellowship in Anti-Aging and Regenerative Medicine (FAARM) from the American Academy of Anti-Aging Medicine, he's board-certified from the American Board of Anti-Aging & Regenerative Medicine (ABAARM) and he's certified as a Functional Medicine Practitioner with advanced training at The Institute for Functional Medicine.

LifeGaines is responsible for this press release.

To view the source version of this press release, please visit https://www.newsfilecorp.com/release/53638

Read this article:
Dr. Gaines Provides Insight Into How People Can Best Protect Themselves and Their Families From the COVID-19 Virus - Marketscreener.com

When the World Health Organization (WHO)labeled the new COVID-19a "pandemic", that is, a disease that is occurringall over the world at the same time, there were moments reminiscentof times of war: thedeserted streets, supermarkets overwhelmed by hundreds of people scrambling for goods, and the constant media monitoring of the infection's progress the number of sick and dead increasing daily.Although our health system is not what it was in 1918, when the Spanish Fluwreaked havoc, nor will the coronavirus be as lethal as smallpox the most deadly pandemic some people will still make historical comparisons.To keep you up to date with what's happening now and what's happened in the past, here's tour of the five most devastating pandemics that we've emerged from.

HIV/AIDS

It has killed more than 25 million people worldwide, and although preventive treatments such as PrEP have been developed toreduce infections by 90%, a global cure has yet to be found.HIV originated in Africa, where apes have an HIV-like virus known as SIV.

Scientists still speculate on whether interspecies contagion occurred from hunting or eating infected chimp meat.AIDS wasn't detected as a disease until the 1980s, when it was observed in the United States, especially among homosexual patients in New York and California. It was later determined an evolution of the HIV infection, which transmitted through any passage of bodily fluid (intravenous drug usage and sexual intercourse were the most common). Doctors named it acquired immunodeficiency syndrome (AIDS)because the virus attacks the white blood cells that help fight infection.Today, there are two patients worldwide who have been cured of HIV thanks to a stem cell transplant whose donor carried a mutation known as CCR5-delta 32.

The Black Death or Bubonic Plague

It ravaged the European continent from the mid-14th century until its last outbreak three hundred years later and is responsible for more than 75 million deaths.

Although at that time the devastating epidemic was attributed to Divine Cholera and even to the passage of a comet, the origin was a bacterium that appeared in Asia and spread through parasites such as rat fleas. Its spread originated at trade ports, and was helped by the poor hygiene conditions and diet of the time period.

Death occurred in less than a week after the disease manifested, with the appearance of buboes - or swelling of nodes in the lymphatic system - accompanied by high fevers, delirium, chills and stinking suppurations. The sick were confined to their homes along with their families as means of containment. In some cases, it wiped out whole villages in Europe, which were sometimes discovered hundreds of years later.

Spanish Flu

The disease gotits name during WWI fromSpanish newspapers, which remained neutral in the conflict, and were the only ones to report on its lethality without censorship.

It is believed that Spanish Flu was responsible for between 50 and 100 million deaths and some the first cases reported were among the United States military, who could have broughtit to Europe when they landed to fight the Germans. Regardless, there are many theories around its origin.

As deadly as it is heartbreaking, there were cases in the United States of people rising with fever and dying on their way to work.

In a previous article, we commented on why its fatality rate, which is often used incomparisontoCovid-19, is wrong, as it is well over the 2% reported by WHO.

Smallpox

Holding the position of the most devastating global pandemic,Smallpoxhas contributed to the decline of entire civilizations such as the Aztec and Inca Empires when theSpanish brought the disease in their "conquest" of the New World in 1519. It is estimated that 90% of indigenous deaths during European colonization were not due to "fire," but rather, disease.

In Europe, smallpox killed 60 million people in the 18th century alone, and a hundred years later there were 300 million deaths worldwide.

Its Latin name means "spotted", because of the bumps and bruises that appeared on the faces of those afflicted. It was highly contagious and those who survived would carry marks on their skin for the rest of their lives, and some even wentblind.

One of modern medicine's greatest achievements was the creation of a vaccine for smallpox in 1979. As a result, Smallpox is considered eradicated.

See the rest here:
Four pandemics that changed the world - AL DIA News

They're extremely now. Covetable, even the kind of thing some celebrity would Instagram from their "survival condo" in Kansas. In a series of large photographs, Elaine Whittaker sits for a variety of "face mask selfies" closeup portraits of the artist wearing hand-painted respirators. Cholera makes for a pleasingly haphazard pattern of kidney-shaped blobs. Ebola, that stringy so-and-so, could double for a handwritten logo a black-market YSL dupe. (An extremely busted one, maybe, but masks were the breakout dystopian trend at this year's Paris Fashion Week, after all.)

"A quick little story about the masks," says Whittaker, calling the same afternoon COVID-19 was declared a pandemic. "When I first displayed the photographs in a gallery, there were some people standing way at the back [of the room]. One was saying: 'Oh my god, she put ebola on your face! She has malaria on her face!'"

That was in 2015, when this project (Screened For) debuted at Toronto's Red Head Gallery. Like much of Whittaker's art, the series is meant to connect us with the unseen world of microorganisms in this case, infectious diseases. It wasn't her doomsday prediction of a global outbreak, and it's not a house of bio-horrors images designed to terrify the impressionable,like that panicked duo who thought a photo could give them SARS.

"They read them literally," says Whittaker. "It's interesting, that instinct we have to be fearful."

I wonder how those two are dealing with the news right now. In pictures alone, the story of coronavirus is empty shelves, empty airports,mobbed Costcos. It's people in surgical masks, just like the ones in Screened For. (And to repeat the official advice: save those items for healthcare workers and the ill, please. They help stop the spread of disease.)

It's a time for acting with caution, not panic. But if pictures of COVID-19 or any contagion prick at our reflex to freak out, how do we, as viewers, manage what we're seeing?

Earlier this month, Toronto's Photo Laureate Michle Pearson Clarke raised a few points on the subject of how we're illustrating COVID-19. "I've been thinking about the visual representation of this public health crisis, with the most commonly used images depicting people wearing masks," she wrote on Instagram. "We can't photograph this virus, which perhaps makes it more threatening for some folks."

It's Clarke's job to be thinking about issues of representation, she explains. And since the novel coronavirus was discovered in China, media images of COVID-19 have raised her concern. There's a lot of history to consider when reading images of COVID-19, Clarke says. When humans are facing some new invisible menace, they have a long track record of blaming an easier target, and Asian communities have borne the brunt. To pull one widely cited example, when New York's first confirmed case of COVID-19 was reported in early March, outlets including the New York Times and New York Post initially ran the piece with photos of Chinatown, though the patient caught the virus in Iran. Lazy editorial choices can wind up spreading a racist narrative, one that's textbook "fear of the other."

When Clarke was musing on the visual culture of COVID-19, she didn't Instagram a news photo. Instead, she posted a scientific illustration, a now-familiar 3-D rendering of the virus. "I just Googled COVID-19 that day, just to see what was coming up, and then saw that CDC image," she says. "And that particular illustration it is so stunning. It's gorgeous, you know? But also, right away seeing that image, seeing the kind of spikes on the virus you think about how a virus spreads."

That instant lesson is the power of medical illustration: communicating scientific data as quickly as your brain can process an image (which is as little 13 milliseconds.) And for scientists like Tahani Baakdhah, a PhD student at the University of Toronto, information is her Purell for panic.

"As a science communicator, I like to explain everything using a model," says Baakdhah, who teaches workshops to the general public. Past topics include neuroscience and retinal stem cells (her area of research). Her hand-made visual aids, however, are unique. Baakdhah crochets them.

Unlike the potential threat of contagion, there is absolutely nothing scary about a huggable pink virus with a super-kawaii grin. That's a strategic move on Baakdhah's part. Her Instagram photos are cute-overload clickbait, but the captions summarize the latest research. Says Baakdhah: "People all over the world are talking about this. Why not design a model to explain what COVID is?"

Baakdhah also sells her visual aids on Etsy, which has caused at least one goofy misunderstanding at the post office. (Question: "What are you shipping today?" Answer: "Coronavirus!") As of last week, she'd already made more than 40, and had 20 additional orders in progress.

Etsy, however, has banned all listings that mention COVID-19 or coronavirus, a policy they put in effect earlier this month. As of writing, if you try searching those terms, you'll be served a corporate statement explaining the action. The online marketplace says it's working to protect shoppers from snake-oil salesmen sellers out to hock phony remedies. But the ban's also stymied Baakdhah's educational outreach. Her coronavirus models and patterns are still available through the site (shop name: PurpleLilacAmigurumi) but can't be found if you search the disease.

"You cannot prevent scientists from explaining their science in whatever way they like," she says. "Some scientists like to talk, some scientists like to draw, some scientists like to crochet!"

Some, like California-based biologist David S. Goodsell, prefer painting. He debuted this illustration of a coronavirus on Twitter last month. "Art is the work of transforming fear and pain into beauty," one user replied. Tweeted another: "Would be a good puzzle to do while in quarantine." Luke Jerram, the same American artist behind the "Museum of the Moon" installation that appeared in Edmonton and Toronto (among other cities) in recent years, makes sculptures out of clear glass an instructional choice. Per his website: "Viruses have no colour as they are smaller than the wavelength of light."

"We need to do something to visualize the unknown, because it makes it less threatening and less frightening," says Tagny Duff. But as an artist, not a scientist, Duff approaches the challenge differently.

"It's the unknown that I find really exciting," says Duff. "It's the big question, right? How can we know something we don't see?"

Based in Montreal, Duff says she began researching viruses in 2007. At the time, she was teaching a course on the HIV/AIDS epidemic at Concordia University. "I realized that for all the knowledge I had about the social and cultural aspects of it, I didn't really understand the biological reality of HIV," she explains. And after learning some of the basic science, she was inspired to not just make work about viruses, but with them.

"I really felt this responsibility to not only teach myself but students the deeper levels of what a virus is, and how it can be used as a way to really teach us about different kinds of phenomena."

Living Viral Tattoos, an ongoing project she launched more than 10 years ago, expresses both the actual process of infection and the fear that surrounds it. Using a synthetic retrovirus (Lentivirus), Duff effectively inks lumps of actual skin. (A cosmetic surgery patient donated the samples.) As part of the project, Duff outlines her process in exhaustive detail, explaining the steps through video and written instruction. It's the same methodology used in gene therapy, a treatment for conditions including HIV/AIDS, she explains. But here, dye used to mark the site of a cellular reaction appears as bruised skin or, per the title, a tattoo.

"I wanted to be able to show how this was done, and demystify the fear around it," she says. Like a scientist, information is Duff's top strategy. But, she says: "I'm certainly not a science communicator. I mean, first and foremost, I'm interested in people having an experience, having conversations and having a kind of philosophical encounter with visual objects."

"These 3D graphics of a coronavirus: they're very colourful and easy to look at. And they kind of look not so intimidating," she says. "It's easier for people to look at [a scientific illustration] than, say, people with masks, running away from each other in the metro."

"But it's also very removed from the relationship to us as humans," she continues. And as an artist, that's where she comes in.

For Whittaker, her art invites people to think beyond a disaster scenarioand consider our larger relationship with the environment, including the organisms we can't see. "What I'm interested in is people seeing the natural world," she says. "And they can be enchanted by it, and they can be in awe of it and they can have respect for it."

"Looking at microscopic images, they're absolutely gorgeous. They're just really beautiful," she says. "I love that double-sidedness that right beside this beauty there is this terror and fear that we can't see them. They're invisible and we get sick from them. And that plays in all my work all my work about infectious diseases."

"[I'm] hoping to encourage people to think about what the critical role that microorganisms play in our lives, play on this earth, and how they've been here longer than we have and are due their respect. I want people to think about them culturally, historically, scientifically and I want to empower them to see the world in new and different ways by looking at them."

Beyond fear and crisis, viruses can symbolize change. They invade and transform host cells, sure, but there's a positive spin to consider, too. Facing a pandemic, how do we, as humanity, respond?

There's a strain of that in Duff's work, and her latest project, Wastelands, builds a speculative sci-fi world,suggesting a possible future where we've developed a new sustainable fuel. The stuff's generated using bacteriophages (viruses that attack bacteria). "It's really thinking about how these bacteriophages could be our friends," she says, chuckling. "Viruses could help us survive." Maybe they're not as friendly as one of those crocheted COVID-19s, but still.

As communities work to "flatten the curve," so to speak working from home, limiting travel, cancelling large gatherings, etc. these actions could ripple into our habits going forward. "I know it sounds really utopian," Duff says, "but right now, the coronavirus has been instrumental in reducing carbon emissions around the globe."

That consequence comes with complications, but it's a thought to chew before reacting to the latest COVID-19 update. And reflection is needed if we are going to prevent panic. Maybethis moment is a prompt to seek out art like Whittaker's, for instance: images that might scare people, but ask them to consider where the fear is coming from, too.

"I think there is an important role for art at this time," says Whittaker. "I think it's important to empower people, so that they can see art as a way of aiding them in living through these difficult times."

CBC News is keeping track ofdevelopments in the COVID-19 pandemic. This guide toCOVID-19 and its impact on life in Canada is regularly updated with the latest information.

Read more:
What is the role of art in helping us better understand coronavirus? - CBC.ca

a Team of researchers from the University of Minnesota tested a new approach to growing human blood vessels. It will allow you to get unlimited number of vessels for transplantation, the risk of rejection is minimized.

Scientists have long known that human physiology has a lot to do with the physiology of pigs, so the latter often act as models for the design and testing of various drugs and treatment strategies.

In the new work, the team tried to grow human blood vessels in the body of a pig.

Specialists have got the Mature skin cells of a patient and reprogrammed them into induced pluripotent stem cells (IPSC), giving rise to endothelial cells. The latter, as we lined the inner surface of blood vessels.

the IPSC were injected into the fetal pig, and he was hoisted to a surrogate mother.

In the first phase of the test, the embryo has developed over 27 days. No non-target effects were found, all endothelial cells were of human origin.

the Team believes that proved the viability of its concept, and is now awaiting approval for further study of the embryo in the later stages of pregnancy.

as planned By the scientists, their method permits to obtain a viable piglets with blood vessels that will precisely fit the vessels of each patient awaiting transplantation. Thus, after the operation the man will not need to take immunosuppressants drugs for artificial immunosuppression.

the Authors hope that their approach will help patients with many chronic and incurable diseases requiring organ transplantation, and patients with damage to the peripheral arteries, for example, due to Smoking or diabetes (in many cases this disease leads to amputation of limbs).

Scientific article on the results of this work are presented in the journal Nature Biotechnology.

by the Way, earlier News.Science (nauka.vesti.ru) wrote about the universal acellular blood vessels and the artificial blood vessels from cells of patients and drug administration.

Text: To.Science

View original post here:
Human blood vessels began to grow in the body of pigs - The KXAN 36 News

The world of Netflix's Altered Carbon is one where consciousness is no longer tethered to the physical body. It can be, and regularly is, uploaded into "cortical stacks," which are implanted at the base of the neck. In the event of death, a persons consciousness can be reloaded into a new body, known as a "sleeve." For those less fortunate, like protagonist Takeshi Kovacs, that might mean receiving a body thats not your own. In one particularly existential example from the series first episode, it might even mean a young child being uploaded into the body of an adult.

For those with means, however, the mind can be placed into a swiftly made, identical clone, allowing them to return to their lives with little interruption. We've covered what it might take to create a digital copy of a persons mind before (spoiler: it wouldnt be easy), but Altered Carbon's techno-immortality requires a second piece: the swift creation of replacement bodies.

One of the major hurdles that has kept real-world cloning from being the game changer everyone suspected it might be after the birth of Dolly, the first successfully cloned mammal, is the relatively slow development of human bodies. If you wanted to clone a 50-year-old human and get them back to the same stage of development, it would take you 50 years. That's a little too slow to make use of in the same way science fiction does.

We don't have the means to artificially age a body at a rapid pace, but what if we were able to shortcut these limitations to put it plainly, what would it take to build an adult body from scratch?

BONES

If you want to build a person from scratch, you must first make the universe. Carl Sagan said something like that, I think. Just after that, though, youll need a skeleton. Without bones, youll be left with little more than a Cronenbergian nightmare, cool in its own way, but not what were shooting for.

Today, if you have trouble with your bones, your options are limited. The first option, and in most cases the best one, is to let the bone heal itself. Your body is pretty resilient and capable of repairing most day-to-day injuries, even the ones accompanied by a sickening crack. If the injury is really bad, things get a little more medieval. Surgeons might use a series of metal plates and screws to hold your bones in place and give them time for your bodys healing processes to do their work. But those solutions only work for relatively minor injuries where the bone tissue is at least moderately intact.

When it comes to bone replacements, things are a little tougher.

Again, we can return to metal. Like the Wolverine, you might have part of your skeleton replaced or covered over with metal. This might be sufficient in specific cases, but it all feels a little crude.

Ramille Shah, Ph.D., headed a team out of Northwestern's McCormick School of Engineering to create a new material capable of instigating rapid bone regeneration. The team used 3D printers (the invention that never stops giving) and a mixture of 90 percent hydroxyapatite, a natural element of human bones, and 10 percent medical polymer to build bone constructs.

The result is a bit of artificial bone modeled in whatever shape the patient needs. It is porous, allowing for blood vessels and other tissues to easily integrate. The elastibone (perhaps the worst superhero name, trademark pending) stimulates bone regeneration and degrades over time. The intent is for the artificial structure to dissipate, leaving actual bone in its place. A technology like this would go a long way to repairing complex bone defects in all manner of patients, but is particularly promising in pediatrics, where the patients are still growing.

But, in order to truly build a bone from scratch, well need something even better. Thats where Nina Tandon and EpiBone come in.

This technology would work by taking a sample of fatty tissue, something readily available if your plan is to build a copy of an existing person, and use it to extract stem cells. Those cells would then be applied to a 3D printed scaffold of a cows bone which has been scrubbed of all its living cells. Those undifferentiated stem cells would then be placed into a bioreactor (something which sounds made up but is very real) and coaxed into growing into a fully formed bone in just a few weeks. Given enough bioreactors, and enough cows (pour one out for our fallen bovine brethren) you could feasibly grow an entire skeleton in the time it takes for you to finally fold the laundry thats been sitting in the corner of your room.

Now that youve got a skeleton, youre going to need some

ORGANS

For a long time, there weren't many ways to get a new organ if you needed one. The most commonly used method (we hope) was to get your name on a list and wait for a donor. The unfortunate reality of organ donation is that there are more people who need organs than there are organs available. Even when an organ does become available, the odds are against you that theyll match your bodys preferences, and even if you get a match, theres always the threat of rejection.

Organ transplants are a veritable miracle procedure and, while we sometimes take them for granted, they are evidence of our living in truly wizardly times in medical science. But science is never content with the status quo and humanity is forever wondering if we can further laugh in the face of nature. The preferred solution would be to develop a way to craft bespoke organs, made from the recipients' own cells.

Growing cells in a petri dish is old hat. Weve been doing that for longer than many of us have been alive. The trouble is, you can take a heart cell and induce it to multiply in a dish, but all you end up with is a dish-shaped collection of heart cells. That might be good for studying cellular biology, not so good for pumping blood through a person.

A collection of cells does not an organ make. You need something more a scaffold. Each of your organs is a complex collection of various cell types clinging to a protein structure. You can think of that structure as the framing around which the rest of a house is built. Without it, you've got little more than some insulation and drywall tossed into a haphazard stack. You need that scaffold.

There are hopes that one day well be able to build them via (drum roll please) 3D printing, but were not there yet. The level of minute detail involved is beyond our current ability. So, we have to borrow from nature.

Scientists are able to take an existing organ and strip it of its surface cells by pumping detergent through it (good for removing pesky stains and unwanted biological material). Whats left is a ghostly protein structure ready for seeding.

All that's left is to take tissue samples from the recipient and seed them onto the structure, pop it into one of those handy bioreactors, and let the cells get to work. Eventually, youll end up with an organ made of the patients own tissues. Current tests are pretty impressive, but were still a ways off from having a functioning process. The number of different tissue types involved in complex organs is a barrier and the complexity of small structures like circulatory vessels is another. Still, the technology is promising and would not only allow us to build any and all organs in record time, it would solve the organ transplant shortage and save countless lives.

So, now youve got a rigid skeleton filled with juicy oozing organs. Your neighbors are starting to wonder about the smell coming from your garage and youre grateful this abominable creature is not yet sentient because it would very likely go running for the hills. At least it would if it had

MUSCLES

Look, we all know its been a while since youve been to the gym. You bought a membership for the new year and you went a few times. You really meant well but life happened and, somehow, it all got away from you. We get it. It happens to the best of us.

While you might not have the muscle mass you wish you had, you still have quite a lot. The average persons body is comprised of somewhere between 35 and 40 percent muscle, give or take. Thats a lot. Even after all of your efforts with bioreactors, youve only managed to make 60 percent of a person. Its nothing to be scoffed at, but you arent done yet.

In order to complete next steps, youre going to need more tissue samples and a few friends from Duke University.

Using human cells that were no longer stem cells but not yet muscle cells, Nenad Bursac and Lauran Madden, an associate professor of biomedical engineering and a postdoctoral researcher, respectively, were able to successfully create functioning muscle tissues in a lab.

They grew the tissue samples and, using a 3D scaffold and a nutritive gel, ended up with working muscle fibers. These bundles of muscle fibers included receptors capable of taking in external stimuli and contracted when acted on by electricity.

For their part, the intent is not to build novel muscular structures, but to test the efficacy of drugs to treat diseases. According to Bursac, drug tests in the laboratory matched results seen in living patients. Those patients with muscular ailments could provide a tissue sample, that sample could then be grown into fiber bundles and used to test various drug treatments, ex vivo, to find a workable treatment without all the trial and error usually required.

Thanks to Bursac and the team at Duke, youve now built almost all of Takeshi Kovacs. Hes twitching and moving around on the table. He might be screaming a little, thanks to those vat-grown lungs and hes still oozing a bit. Most of all, hes embarrassed by his nakedness. A lots changed in the intervening centuries, but not the need for

SKIN

Youve got your terrible Frankensteinian gift all put together, all thats left is the wrapping. Here, too, is an area were moderately familiar with. When a patient loses skin through injury, a graft can be taken from elsewhere and used to replace the damaged tissue. It gets the job done, some skin is better than no skin of course, but theres still room for improvement.

More recently, bioengineers have had some success in growing sheets of epithelial tissue for implantation but they lacked oil and sweat glands. Again, close, but not quite. Until

A study undertaken at the RIKEN Center for Developmental Biology, led by Takashi Tsuji took cells from the gums of mice and used chemicals to revert them to a stem-cell-like state. The cells were used to grow complex skin tissues.

Once the tissues were ready, they were transplanted onto living mice and were found to develop normally. Not only did those tissues function as a protective barrier, the primary function of skin, but they also succeeded in developing hair follicles and sweat glands. Even more importantly, they successfully integrated with surrounding tissue systems like muscle groups and nerves.

There are, of course, other tissue types weve not covered, each of them important to the successful functioning of a body, but if these emerging technologies are any indication, were well on our way in those areas as well.

So, youve done it. Youve made a full-grown human from scratch in months rather than decades. All thats left is to upload a mind and youre well on your way to cyberpunk chicanery. Go forth, Kovacs, we're rooting for you. And dont mess up this body, please. It was really hard to make. Thanks.

Read more:
How to build a body from scratch, Altered Carbon-style - SYFY WIRE

I'm just going to come out and say it: Everyone has been complimenting my skin lately. My co-workers, random peopleat the grocery store, my friends and familyeveryone. While I've never dealt with any major skin woes like acne, I still never considered myself to be someone with particularly good skin (whatever that means). My skin has always been on thedry side, and like many women of color, I've dealt with my fair share of stubborn hyperpigmentation. The sudden influx of complimentshasn't just been a nice little boost to my newly 30-year-old ego but also a testament to my current skincare routine, which I've tweaked to perfectionover the course of several months.

As a beauty editor, I have access to every product under the sun. But ever since last fall, I felt like my skin had just lost something. When I think back, it makes sense, as there was lot was happening at the time. I had moved, turned 30, gotten engaged, andmade a major professional moveall in a matter of months, and while each of these life developments was exciting and positive, I found myself overwhelmed with stress. I wasn't sleeping well, I wasn't eating properly, my skincare routine had fallen by the wayside, and all of that was showing up on my face. I was getting pimples, my skin tone was blotchy and uneven, and my skin texture was less than smooth.

But then, something started to happen around January: Every time I posted a photo of my mug on Instagram, a sea of adulation would flood into my comments. I started catching glimpses of my makeup-free face and being truly happy with what I saw staring back at me. Maybe it was the newfound self-love I'd been practicing in therapy, or maybe it was my skincare regimen, whichhadadmittedly reached an all-time level of bougie, even for me. Now, I'm at a place where I'llfreely leave the house without makeup on and am genuinely pleased with how healthy and smooth my skin looks. I'm not perfect, by any means, but Iamgenuinely happy, and I have to believe that my fresh, smooth skin has something to do with it. So here it goes: the exact skincare routine thatdelivered smooth, glowing skin in a month's time and continues to do so to this day. Try it out for yourself and let me know what you think.

Klur Gentle Matter ($22)

I thoroughly cleanse my skin at night, so I don't always use a cleanser in the morning. Most days, I find that warm water is enough. When I do feel the need to cleanse in the morning, though,this gel cleanser is the onlyone I'll reach for. It's so gentle and actually adds moisture and nutrients like green tea, dandelion, and olive oil into my skin instead ofjust pulling everything out.

SkinCeuticals C E Ferulic ($166)

Vitamin C is probably the most important component of my skincare routine right now. While there's a lot of debate around L-ascorbic acid and whether or not its potency is actually good for the skin (jury's still out on that one), I find thatmy skin responds really well to it. Vitamin E and ferulic acid round out this formula with extra skin lipid and antioxidant protection. I can alwaystell when I've gotten lazy with my vitamin C regimen because marks from old blemishes will start to deepen, and my skin will lose some of the glow and refinement that earns me an insane amount of compliments.

Bioderma Sensibio Eye Contour Gel ($20)

I'll admit that I didn't take eye cream seriously until about a year ago, and this non-intimidating tube is to thank for that change of heart. The cream inside is lightweight and easy to lightly tap into my eye area. When I'm using eye cream consistently, I notice that any fine lines in the area soften over time, giving me that smooth, even texture I'm always after.

Kiehl's Ultra Facial Cream ($32)

This moisturizer has been an on-again, off-again staple on my vanity for years now. It's unscented, lightweight, and super effective. If I'm feeling extra dry, I'll even add afew small drops of marula oil to give it an extra hit of moisture.

Victoria Beckham by Augustinus Bader Cell Rejuvenating Priming Moisturizer ($145)

This moisturizing primer is basically like a blurring filter for your skin. It has tiny sparkly particles and theproprietary TFC-8 technology found in Augustinus Bader's other famous creams (more on those later). It makes my skin look way smoother, even when I don't layer any makeup on top.

Elta MD UV Clear Broad-Spectrum SPF 46 ($28)

Say it with me: SPF, all the time, no matter what. UV protection is important for so many reasons, but for me, it's all about mitigating hyperpigmentation and making sure any scars or blemishes on my face aren't getting exposed to the sun. This sunscreen by Elta MD is a dermatologist favorite, and it's one of my favorites, too. It doesn't irritate my skin or leave an unsightly white cast.

Farmacy Green Clean Makeup Removing Cleansing Balm ($34)

I'm a makeup wearer, so my nighttime cleansing ritual has always been serious. I need every stitch ofgunk off of my face before I can relax for the evening. This cleansing balm melts even the most stubborn eye makeup with ease. I usually massage it into the rest of my face for about 30 seconds before concentrating on my eyes. After just a few seconds of gentle rubbing, any makeup is melted down to an inky oil that rinses away without leaving any residue behind.

Reflekt Daily Exfoliating Wash ($48)

This exfoliator is said to be gentle enough for daily use, and I've found that to be true for me. Although I've backed off from using it every single day, I still love how clean and soft my face feels after use. The multitasking jojoba beads are small and smooth, so they aren't at all harsh on the skin and also meltdown to impart moisture instead of stripping the skin.

IS Clinical Cleansing Complex ($44)

This slippery cleanser clings to every trace of grime to remove it while also retexturizing. When I want a flat wash at night instead of a gritty, exfoliating one, this is the cleanser for the job. I used to have a serious attitude about paying more than $20 for cleanser (come on, it's literally money down the drain), but this is the one that taught me the power of investing in a high-quality cleanser.

U Beauty Resurfacing Compound ($148)

I've been using the U Beauty Resurfacing Compound pretty consistently since it launched last winter, and I can honestly say that it's ascended to my skincare top five. It's so good. If smooth skin is your goal, you need to try this stuff. It's patent-pending siren capsules are designed to carry active ingredients wherever your skin needs them and bypass the healthy skin cells that don't. That's why you won't experience any redness, irritation, or peeling that typically arises when starting a retinoid. This has definitely been the hero product in my smooth-skin journey.

Moon Juice Beauty Shroom Plumping Jelly Serum ($58)

It was love at first pump with this magical, hyaluronic acid and mushroom-packed elixir. There aren't many products that make a big difference in your skin's texture after just one use, but this one does. Every time I use it, my skin instantly looks plumped and smoother.

IS Clinical Youth Eye Complex ($105)

This eye cream plumps and moisturizes my delicate under-eye skin before bed. It has a little retinol in it, which honestly freaked me out at first, but over time has resulted in major refinement of fine lines.

Augustinus Bader The Rich Cream ($170)

Are you sick of editors telling you how much they love this cream? Well, I'm sorry to tell you that I'm about to do it, too. When I'm running on fumes and can only manage to get my makeup off and slap one product on my face before bed, this is the indispensable one I can't ever skip. Maybe it's the stem cellstimulating TFC-8 technology, maybe it's some sort of sorcery, but all I know is my skin has legitimately changed in texture since I started using this cream. Real talk: It's worth every penny.

Dr. Dennis Gross Clinical Grade Resurfacing Liquid Peel ($95)

I love a good resurfacing peel, but I have to admit that I've calmed way down on the acids. I found my skin becoming more sensitized and reactive, and while I can't say for sure that my nightly resurfacing toners were to blame, I'm way better off since scaling back. Now, once a week, I'll do a pass of this two-step, clinical-grade lactic and glycolic acid peel, and it immediately makes my skin look smooth, bright, and alive. As with any super-potent acid compound, it's a good idea to patch test this one to make sure your skin doesn't have an adverse reaction.

Goldfaden MD Facial Detox ($65)

I love this clean detox mask because it's cooling and tingly on the skin but doesn't dry down so hard that it makes my face feel dry or depleted. Rinsing off the sulfur-infused paste feels like taking the biggest breath of fresh air.

Dr. Dennis Gross Hyaluronic Marine Hydrating Modeling Mask ($48)

If you know me at all, then you already know how obsessed I am with this modeling mask. I firmly believe that I could stay awake for three days straight, not drink any water the whole time, and still look fresh as a daisy after 20 minutes with this goop slopped on my face.

Klorane Smoothing and Relaxing Patches ($24)

Whether I'm prepping for a photo shoot, getting ready for a night out, or just looking to minimize puffy eyes after a couple of glasses of wine, these cornflower eye patches by Klorane get the job done like no other. The soothing hydrogeleye masks actually stay put so I can move around without them slipping off, which is a huge plus.

Pai Rosehip BioRegenerate Oil ($44)

Not only is this fatty acidrich rose-hip oil an ultra-luxe finishing touch to my nighttime routine, but it also helps to get rid of imperfections caused by an imbalance in my skin's pH. I know that using oil to treat breakouts sounds counterintuitive, but this oil does just as much to calm and soothe the skin as it does to moisturize it.

Osea Malibu Blemish Balm ($48)

Speaking of soothing salves, this coolingbalmfeels so good on top of congested skin. Whenever I notice a pimple or that my pores are looking rough, I'll spot-treat with this clean cream and let it penetrate into my skin tocalmany inflammation that's plaguing me. I'll work it in as the first step in my routine whenever I need it, and it really sets the tone for the entire day.

Up next, the 25 best products to keep your skin right and tight well past your 20s.

This article originally appeared on Who What Wear

Read More from Who What Wear

Read more:
My Skin Is Kind of Perfect Right Now Thanks to This Exact 30-Day Routine - Yahoo Lifestyle

Abstract

The complex molecular microenvironment of the wound bed regulates the duration and degree of inflammation in the wound repair process, while its dysregulation leads to impaired healing. Understanding factors controlling this response provides therapeutic targets for inflammatory disease. Esophageal cancerrelated gene 4 (ECRG4) is a candidate chemokine that is highly expressed on leukocytes. We used ECRG4 knockout (KO) mice to establish that the absence of ECRG4 leads to defective neutrophil recruitment with a delay in wound healing. An in vitro human promyelocyte model identified an ECRG4-mediated suppression of the hyaluronic acid receptor, CD44, a key receptor mediating inflammation resolution. In ECRG4 KO mouse leukocytes, there was an increase in CD44 expression, consistent with a model in which ECRG4 negatively regulates CD44 levels. Therefore, we propose a previously unidentified mechanism in which ECRG4 regulates early neutrophil recruitment and subsequent CD44-mediated resolution of inflammation.

Cutaneous wound repair is a model of tightly controlled inflammation. Early inflammatory responses mediate hemostasis, recruitment of proreparative myeloid cells, and wound debridement to support the revascularization and proliferative phase of wound healing (1). Disruption of this inflammation response is associated with delayed wound closure, infection, and scarring (13). Therefore, understanding the mechanisms that regulate the degree and duration of the inflammatory response is critical for understanding and treating disease.

Injured tissues rapidly recruit leukocytes to clear pathogens and prepare the wound bed for tissue repair. This process involves some well-described chemokines, such as CXCL1 (4), CXCL2 (4), CXCL5 (5), and CXCL8 (6), and is further regulated by factors generated in the complex molecular environment of the wound. For example, proteases activate latent chemokines, such as chemoattractants generated in the complement cascade, and degradation of extracellular matrix components produces biologically active molecules, such as hyaluronan fragments (7, 8). These products mediate the recruitment and activation of leukocytes and stromal cells. Some receptors, such as the Toll-like receptor (TLR) family, amplify inflammation in response to damage-associated molecular patterns and pathogen-associated molecular patterns present in the wound, while others respond by tempering the inflammatory response. For example, activation of CD44 by hyaluronic acid (HA) fragments released from injured tissue modulates TLR signaling and can decrease inflammatory responses and prevent septic shock (911). CD44 is also important for resolving inflammation at sites of injury, a requirement for wound healing to progress to the proliferative phase. In injury models, such as cutaneous wounds (2), pneumonia (12), noninfectious lung injury (13), and myocardial infarction (14), loss of CD44 expression leads to increased and prolonged inflammation, exuberant leukocyte recruitment, failure to clear apoptotic neutrophils, and increased scarring and fibrosis (2, 7, 9, 1215). Understanding the complex interaction of wound products and cellular receptors that govern the choreography of wound healing phase transitions is important for addressing poorly healing wounds and informs treatment of other inflammatory disorders.

Esophageal cancerrelated gene 4 (ECRG4) is a membrane-tethered protein that is widely expressed in normal tissues and highly expressed on the surface of quiescent human granulocytes (1618). ECRG4 was first described as an epigenetically regulated gene whose expression is suppressed in several cancer types (1921), including esophageal cancer. Recent studies indicate that it may promote leukocyte recruitment, with its down-regulation in cancer contributing to escape from immunosurveillance (17, 22). ECRG4 physically associates with TLR4 (23), while proteolytic processing releases it from the cell surface (17, 24). Soluble ECRG4 binds various scavenger receptors, including LOX-1 (25), and regulates phosphorylation of the nuclear factor B (NF-B) transcription factor (16, 23). In murine tumor models, the ability of soluble ECRG4 to increase the recruitment of inflammatory cells is dependent on thrombin cleavage (17). In humans with severe burn injury, ECRG4 is shed from circulating neutrophils, while restoration of cell surface ECRG4 expression correlates with recovery (24). These observations suggest that ECRG4 has a role in regulating specific inflammatory responses, although its function in injury has not been determined in ECRG4 knockout (KO) mice. Here, we propose a previously unidentified mechanism in which the amplification of early neutrophil recruitment and CD44 expression in the wound bed can be regulated by proteolytic processing of the leukocyte chemokine ECRG4.

To determine whether ECRG4 is a functional mediator of the wound healing response, ECRG4 KO and wild-type (WT) mice were subjected to splinted full-thickness excisional wounds. The wound area was measured daily to assess wound closure kinetics. ECRG4 KO mice had a notable, and statistically significant, delay in early wound closure compared to WT mice, which began at post-wound day 1 (WT 22.5 2.4 mm2 versus KO 30.2 0.7 mm2) and persisted until day 9 (WT 6.8 4.7 mm2 versus KO 15.6 4.2 mm2) (Fig. 1, A and B). To visualize changes in the rate of wound closure, we plotted these data as the change in wound area over time (fig. S1A). This highlighted a slower initial rate of wound closure in ECRG4 KO mice after injury that subsequently recovered to the rate of WT mice by day 3. This represents the inflammatory phase of wound healing, suggesting a role for ECRG4 in regulating the initial inflammatory response. We examined the recruitment of Gr1+ granulocytes at the margin of 24-hour wounds and observed decreased Gr1+ staining in the ECRG4 KO mice compared to WT controls (Fig. 1C). To quantify the ECRG4-mediated defect in granulocyte recruitment, we used flow cytometry to immunophenotype single-cell suspensions of dissociated skin from the margins of ECRG4 KO versus WT wounds (26). Flow cytometric analyses of CD45+ cells from the wound margins of post-injury day 1 animals demonstrated a ~14-fold increase in CD45+CD11b+Ly6G+ neutrophils in WT mice compared to uninjured skin, which was not seen in ECRG4 KO mice at the same time point (Fig. 1D, top). In contrast, there was no significant difference between the ECRG4 KO and WT wound neutrophil numbers at day 3 (Fig. 1D, bottom). This is the time at which the ECRG4 KO wound closure rate approaches that of WT mice (fig. S1A). There was also no difference in neutrophil populations between uninjured ECRG4 KO and WT skin. These findings are the first to use an ECRG4 KO mouse to establish the functional significance of ECRG4 in mediating neutrophil recruitment in the inflammatory phase of injury response.

To assess the role of ECRG4 in the cutaneous inflammatory response to injury, we examined wound healing as a model of tightly regulated inflammatory responses. (A) Splinted excisional wounds were created on the dorsal skin of ECRG4 KO and WT littermates. Wound area was measured daily [representative data from three separate experiments, n = 6 mice per group, two-way analysis of variance (ANOVA), P < 0.0001; Bonferroni posttest, *P < 0.05, **P < 0.01, and ***P < 0.001]. (B) Representative images of wounds at various time points. Photo credit: Robert A. Dorschner, UCSD. (C) Excisional wounds in ECRG4 WT (top row) or KO mice (bottom row) were harvested for immunohistochemistry at 24 hours, and infiltration of Gr1+ granulocytes (arrows) was assessed. Two representative images from ECRG4 WT and KO wound margins are shown; scale bars, 500 m (n = 3 per group). (D) Neutrophil recruitment to the full-thickness cutaneous wound was quantified using a protocol for preparing single-cell suspensions via partial enzymatic digestion followed by flow cytometry. Neutrophils were identified as CD45+CD11b+Ly6G+ cells in day 1 (top) and day 3 (bottom) excisional wounds (n = 3 to 4 mice per group; **P < 0.01 and *P < 0.05). ns, not significant.

To define the role of ECRG4 in mediating leukocyte recruitment in the inflammatory phase of tissue response, we used subcutaneous implantation of polyvinyl alcohol (PVA) sponge, a well-characterized in vivo model of sterile inflammation and foreign body reaction (2729). Because infiltrating leukocytes can be harvested from PVA sponges without the need for enzymatic preparation, the cellular infiltrate was directly immunophenotyped by flow cytometry. The 24-hour inflammatory infiltrate included subsets of CD11b+ leukocytes that could be differentiated by their expression of Ly6C, including CD11b+Ly6Cint neutrophils and CD11b+Ly6Chigh inflammatory macrophages (Fig. 2, A to C), as demonstrated by Daley, Dunay, and Gutierrez (27, 30, 31) and confirmed in Fig. 2F. ECRG4 KO mice recruited half the number of total CD11b+Ly6C+ cells to the site of injury at 24 hours compared to their WT littermates (Fig. 2A). Further analysis of this population revealed a threefold decrease in the infiltration of CD11b+Ly6Cint neutrophils in the ECRG4 KO mice (Fig. 2B), whereas no significant changes in the recruitment of CD11b+Ly6Chigh macrophages were observed (Fig. 2C). We further investigated the immunophenotype of the infiltrate at days 3 and 7 to identify any changes at these later time points. Similar to the wound (Fig. 1D), there was no difference in neutrophil recruitment between the WT and ECRG4 KO mice at day 3 (fig. S1B) or day 7 (fig. S1C). Because the early wound environment is rich in thrombin and thrombin acts upon ECRG4 to release a biochemically active C-terminal peptide, CT16 (Fig. 2D) (16), that recruits leukocytes in a tumor model (17), we examined whether CT16 could increase leukocyte recruitment to a 24-hour injury. PVA sponges were loaded with 2 g of sterile synthetic CT16 peptide or vehicle before implantation. We found that CT16 specifically increased CD11b+Ly6Cint neutrophil recruitment by 35% at 24 hours (Fig. 2E). There was no difference in Ly6Clow macrophages or Ly6Chigh inflammatory macrophages at this time point. These results demonstrate that ECRG4 is important for early neutrophil recruitment and support the role of ECRG4 as a novel protease-activated mediator of neutrophil recruitment in cutaneous injury.

The PVA aseptic injury model was used to model inflammatory responses at 24 hours. CD11b+ subpopulations were defined on the basis of their differential expression of Ly6C: CD11b+Ly6Clow patrolling macrophages, CD11b+Ly6Cint neutrophils, and CD11b+Ly6Chigh inflammatory monocytes and macrophages. Quantification of (A) CD11b+Ly6C+ total, (B) CD11b+Ly6Cint, and (C) CD11b+Ly6Chigh cells recruited at day 1 is shown (n = 9 to 12 mice per group; *P < 0.05). (D) The ECRG4 protein contains several domains, including a well-characterized thrombin cleavage domain, which releases the CT16 (ECRG4133148) peptide from the C terminus. (E) The addition of CT16 to the PVA sponge (2 g per sponge) increased recruitment of CD11b+Ly6Cint neutrophils at 24 hours, while CD11b+Ly6Clow and CD11b+Ly6Chigh populations were not significantly different at this time point (n = 4; *P < 0.05). (F) Comparison of the CD11b+Ly6C gating strategy to the CD45+CD11b+Ly6G+ strategy for identifying neutrophils demonstrated equivalency in 24-hour PVA infiltrates and confirmed the decrease in ECRG4 KO neutrophil recruitment (n = 3).

We examined the leukocyte populations in blood and bone marrow to assess whether ECRG4 deficiency affected leukocyte production as a contributor to the decreased neutrophil numbers at the site of injury. Hemograms performed on the peripheral blood from uninjured mice demonstrated no differences between the circulating leukocyte populations of WT and ECRG4 KO mice (Fig. 3A). Similarly, flow cytometric analysis of bone marrow from uninjured mice demonstrated no difference in the composition or numbers of mature CD11b+Ly6C+ cell subsets (Fig. 3B). The composition of the ECRG4 KO mouse hematopoietic system was further analyzed by flow cytometry to assess populations of LSK stem cells and various progenitors of mature myeloid cells (Fig. 3, C and D). There were no differences in LSK hematopoietic stem cells (HSCs), long-term (LT)HSCs, short-term (ST)HSCs, multipotent progenitors (MPP), or LK myeloid progenitor cells (Fig. 3, E and F). Together, these data indicate that the lack of neutrophils seen at the site of injury in ECRG4 KO mice is not due to an impaired hematopoietic system, but a defect in local neutrophil recruitment. When we assessed the ability of ECRG4 KO mice to kill the pathogen, Staphylococcus aureus, in blood, no functional defect in leukocyte antimicrobial activity was observed (Fig. 3G). There was no difference in the capacity for whole blood from either ECRG4 KO mice or their WT littermates to kill methicillin-resistant S. aureus (MRSA) as assessed ex vivo. This indicates that there is no defect in the antimicrobial function of ECRG4-deficient leukocytes.

(A) Leukocyte populations in uninjured ECRG4 KO and WT mice were assessed for underlying deficits. Hemograms of blood showed no significant difference in populations between uninjured ECRG4 KO (white bars) and WT (black bars) mice (n = 8 mice per group). (B) Flow cytometric analysis of bone marrow from uninjured ECRG4 KO (white bars) and WT (black bars) mice showed no significant difference between populations of CD11b+Ly6Clow, CD11b+Ly6Cint, and CD11b+Ly6Chigh cells (n = 9). HSC compositions were compared between the WT and ECRG4 KO bone marrow using flow cytometry. (C) Schematic of the lineage distinctions for HSCs and hematopoietic progenitor cells evaluated. (D) Lin cells from healthy ECRG4 KO or WT bone marrow (left) were gating on the c-Kit+Sca1+ LSK population (middle), which was then differentiated by CD48 and CD150 expression (right) to identify long-tem (LT) HSC, short term (ST) HSC, and multipotent progenitor (MPP) populations. (E) There was no detectable difference in LSK HSCs (Linc-Kit+Sca1+), including no difference in LT HSC, ST HSC, or MPP subpopulations. (F) In addition, there was no difference in numbers of LK HPCs (Linc-Kit+Sca1), which include common myeloid progenitor (CMP), megakaryocyte/erythrocyte progenitor (MEP), and granulocyte/macrophage progenitor (GMP) populations that give rise to all nonlymphoid myeloid cells (n = 8 mice per group). (G) The antimicrobial function of ECRG4 KO leukocytes was compared to WT mice in whole blood for their ability to kill MRSA. USA300 LAC [106 colony-forming units (CFU)/ml] was inoculated into fresh whole blood and incubated at 37C for 3 hours, and the remaining colonies were enumerated, revealing no difference in antimicrobial function (n = 3 mice per group).

To assess the effect of ECRG4 on gene expression in an in vitro model of leukocytes, we performed an RNA sequencing (RNA-seq) analysis on HL60 human promyelocyte cells engineered to constitutively express ECRG4. In a comparison with vector control HL60 cells, 1638 genes were up-regulated and 1632 were down-regulated in cells constitutively expressing ECRG4 (data file S1). Both Gene Ontology analysis of biochemical processes and a KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway visualization analysis demonstrated a number of biochemical pathways affected by the constitutive expression of ECRG4 that are important for inflammation and injury response (Fig. 4A and table S1).

RNA-seq was performed on HL60 promyelocytes constitutively expressing ECRG4. (A) The top differentially expressed pathways, as determined by KEGG pathway visualization, included pathways central to inflammatory responses. (B) The top differentially expressed category was proteoglycan signaling, with the CD44 pathway having the most genes altered, as demonstrated in the heat map (N.D., not detected). (C) CD44 cell surface protein was evaluated on these cells via flow cytometry, gating on green fluorescent proteinpositive (GFP+) cells and measuring CD44 mean fluorescence intensity (data are representative of five separate experiments with three replicates each; ***P < 0.001). (D) Confirmation of CD44 gene expression in the H60 cells constitutively expressing ECRG4 demonstrated loss of CD44 transcription via quantitative PCR (data are representative of five separate experiments with three replicates each). The ability of a soluble factor from the cells constitutively expressing ECRG4 to suppress CD44 was demonstrated by the addition of conditioned media (CM) to nave parental HL60 cells. (E) Decreased CD44 cell surface protein expression was determined by flow cytometry (data are representative of five separate experiments with three replicates each). MFI, mean fluorescence intensity.

The pathway most affected by the expression of ECRG4 in the KEGG analysis was the category of proteoglycans in cancer (Fig. 4A), which included changes in the expression of the HA receptor, CD44, and its signaling pathways (Fig. 4B and fig. S2). We validated a number of targets with potential relevance to the ECRG4-dependent inflammatory response defect in ECRG4 KO mice by flow cytometry (fig. S3), and cell surface CD44 was the most markedly altered. Given the deficit in neutrophil recruitment and wound healing seen in the ECRG4 KO mouse and the importance of CD44 in regulating leukocyte migration, inflammation, and TLR signaling (2, 911, 13, 14, 32), we hypothesized that ECRG4 may regulate the expression of CD44. Using these HL60 cells in vitro, we verified the RNA-seq data with quantitative polymerase chain reaction (PCR) to measure mRNA and flow cytometry to measure surface protein (Fig. 4, C and D). Delivery of ECRG4 leads to a decrease of cell surface CD44 protein in HL60 cells (Fig. 4C) and CD44 gene expression (Fig. 4D) compared to control cells. On the basis of the observation that shed ECRG4 peptide increases neutrophil recruitment in vivo (Fig. 2E), we determined whether soluble ECRG4 affected CD44 expression. Incubation of nave HL60 cells with the conditioned media of ECRG4-expressing cells, but not control cells, decreased CD44 surface protein expression (Fig. 4E). These results suggest that soluble ECRG4 can negatively regulate CD44 expression in vitro.

On the basis of the observation that increased expression of ECRG4 down-regulated CD44 on myelocytes in vitro, we sought to determine whether the loss of ECRG4 in KO mice affected CD44 on leukocytes in vivo. Using a flow cytometric analysis of uninjured mice, ECRG4 KO mice demonstrated a 57% increase in the expression of CD44 on blood neutrophils compared to WT controls (Fig. 5, A and C), with no difference in the overall number of CD44+ neutrophils (Fig. 5B). In bone marrow from uninjured mice, we observed an increase in CD44 surface expression on ECRG4 KO neutrophils (22.7% increase; Fig. 5, D and F) compared to WT mice, with no significant difference in the number of CD45+ cells or CD11b+Ly6G+ neutrophils (Fig. 5E and fig. S4). This increased CD44 expression on ECRG4 KO leukocytes, particularly neutrophils, correlates inversely with the loss of CD44 seen on myeloid cells overexpressing ECRG4 in vitro and supports a role for ECRG4 in the negative regulation of CD44 expression on neutrophils.

Flow cytometric analysis of blood (A to C) and bone marrow (D to F) from healthy ECRG4 KO mice and littermate controls assessed CD44 expression. (A and D) Representative histograms of CD44 expression on ECRG4 KO (unshaded plot) and WT (shaded plot) neutrophils. (B and E) Middle: Number of CD44+ cells within the CD45+CD11b+Ly6G+ neutrophil population, which were not significantly different between the ECRG4 KO and WT mice (n = 6 mice per group, representative of two independent experiments). (C and F) Right: CD44 MFI on CD45+CD11b+Ly6G+ neutrophils, which show a significant increase in the amount of CD44 expressed per cell in the ECRG4 KO mice compared to their WT controls [**P < 0.01 for (C) and *P < 0.05 for (D); n = 6 mice per group, representative of two independent experiments]. The expression of ECRG4 and CD44 was correlated in vivo in a wound time course. Gene expression was analyzed from an Affymetrix microarray performed on murine cutaneous wounds at multiple times through the wound healing process [Gene Expression Omnibus accession GSE23006; (34)]. Relative expression of CD44 (G) and ECRG4 (H) was plotted against time. (I) To visualize changes in expression of CD44 and ECRG4 together, the data were normalized to their expression at time 0 (uninjured skin). n = 3 mice for each of the eight time points.

On the basis of the in vitro and in vivo data demonstrating that ECRG4 negatively regulates CD44 expression on leukocytes, we evaluated the expression of these genes over the entire course of wound healing in mouse skin. Previous studies by our group demonstrated that ECRG4 expression remains low for the first 3 days after cutaneous injury and then increases with a peak of gene expression at day 7, when the wound is transitioning from the proliferative to the remodeling phases of repair (33). We reanalyzed the same gene expression database of cutaneous wound repair (34) and found that, as predicted, CD44 gene expression rapidly increased after injury and peaked at 24 hours before gradually returning to its baseline expression (Fig. 5G). As reported by Shaterian et al., ECRG4 expression remained low until day 3, when it increased until day 7, and then gradually decreased toward baseline (Fig. 5H). To compare these changes, expression was normalized to their relative expression at time 0 before injury and assessed together (Fig. 5I). The inverse relationship between ECRG4 and CD44 expression in the murine cutaneous wound supports a model wherein ECRG4 negatively regulates CD44 to mediate the inflammatory response to cutaneous injury.

This study demonstrates a role for leukocyte ECRG4 as a factor that amplifies neutrophil recruitment to site of injury and regulates their expression of CD44. Coordination of inflammation is an essential component of injury response and effective wound healing. The recruitment of neutrophils is a hallmark of the early wound response during hemostasis and the initial inflammatory phase, which prepares the wound bed for subsequent proreparative leukocytes to mediate revascularization, reepithelialization, and tissue repair. The regulation of CD44 by ECRG4 in this process is consistent with the role of CD44 in resolving inflammatory processes, including limiting neutrophil accumulation at sites of injury (2, 14), tempering TLR-mediated inflammatory responses (911), and enhancing phagocytosis (15) and efferocytosis (13), all of which are central to coordinated wound healing.

This study uses a novel genetic KO mouse model to identify ECRG4 as a previously unrecognized regulator of inflammation in cutaneous injury. Analysis of these wounds demonstrated defective recruitment of neutrophils in the ECRG4 KO wound at 24 hours after injury, which was confirmed in an aseptic injury model. We evaluated whether a thrombin-mediated ECRG4 peptide could contribute to this effect, because it has been shown to enhance leukocyte recruitment in tumor models. The CT16 peptide of ECRG4 was able to increase early in vivo neutrophil recruitment to an aseptic injury, demonstrating that an ECRG4 peptide generated in the thrombin-rich inflammatory microenvironment of the wound bed amplifies neutrophil responses. These data define ECRG4 as a regulator of the inflammatory response to injury, including early neutrophil recruitment and wound healing.

To further define the effects of ECRG4 seen in leukocytes in vivo, we used HL60 cells as an in vitro myeloid cell model. We identified the alteration of a number of key inflammatory processes in cells constitutively expressing ECRG4, including innate immune signaling (TLR signaling, NF-B cascade, and cytokine signaling), apoptosis, and cell cycle. Among these, CD44 expression was completely abrogated at the transcriptional and protein expression levels in the HL60 cells expressing ECRG4. This effect is mediated, at least in part, by a soluble factor from the ECRG4-expressing cells, as their conditioned media decreased CD44 expression on nave cells. These results indicate that ECRG4 can function in an autocrine or paracrine fashion to affect transcriptional programming of cells in the local inflammatory milieu. While it has been shown that various ECRG4 peptides are released into the media of cells constitutively expressing ECRG4 (16), the precise mechanism for its suppression of CD44 expression is unknown. We show that the capacity for ECRG4 to regulate CD44 expression occurs in vivo based on the increased CD44 expression observed on neutrophils from ECRG4 KO mice compared to WT mice and the inverse expression of these genes in the murine wound. These changes were due to an increase in CD44 expression per cell and not a change in the overall number of CD44+ cells in blood or bone marrow, supporting the role of ECRG4 as a negative regulator of CD44.

These findings define ECRG4 as a mediator of CD44 expression and support a model where loss of ECRG4 at the site of injury increases CD44 expression, suggesting a novel mechanism for the regulation of the inflammatory response in cutaneous injury. In these studies, we demonstrate a role for ECRG4 in both cutaneous wounds and the subcutaneous PVA implant, which represent two distinct models of inflammation. This also appears to be a previously unrecognized regulatory pathway of inflammation, as CD44 itself is known to play an important role in regulating the inflammatory response to a variety of injuries, including cutaneous wounds (2), pneumonia (12), noninfectious lung injury (13), and myocardial infarction (14). Neutrophil recruitment and TLR responses are central to the cutaneous host defense against infection. Several investigators have found that activation of CD44 by fragments of HA released from injured tissue modulates TLR signaling, decreases inflammatory responses, and prevents excessive systemic inflammation, such as septic shock (911). Others have shown that decreased CD44 enhances neutrophil accumulation at the site of injury (2, 14). Together, these data infer that an ECRG4-CD44 pathway may be important for host defense.

Our findings demonstrate that ECRG4 mediates the early inflammatory response and regulates CD44 expression. In addition to this ability, previous studies have shown that cell surface ECRG4 can be processed by proteases, like thrombin, at the site of inflammation or tumor to release peptides with proinflammatory activity. While intact ECRG4 associates with TLR4 (16, 23), its various peptide fragments increase phosphorylation of p65 (16, 17), bind scavenger receptors, and activate NF-B in a MyD88-dependent manner in cultured cells (25). Despite these reports, the function of ECRG4 in regulating inflammation was previously unknown, in vivo.

On the basis of our current findings, we propose a model (Fig. 6) where ECRG4 acts as a sentinel and maintains homeostasis on quiescent leukocytes, including restraining expression of CD44. In this model, ECRG4 expression levels determine the amount of CD44 on the leukocyte surface (Figs. 5I and 6A) to precondition its responsiveness to proinflammatory signals, such as TLR agonists. Higher levels of ECRG4 expression would result in decreased CD44 and thus less anti-inflammatory signaling, such as TLR signal suppression. After injury, rapid processing of cell surface ECRG4 protein in the protease-rich inflammatory milieu releases ECRG4 peptides that activate NF-B signaling and amplify local inflammatory responses and neutrophil recruitment (Fig. 2E). This proteolytic processing depletes cell surface ECRG4 (Fig. 6B), while ECRG4 transcription remains low immediately after injury, preventing its replacement (Figs. 5H and 6) (3335). Loss of ECRG4 releases its inhibition of CD44. This leads to subsequent increases in CD44 expression at the site of injury (Figs. 6C and 5, G and I) (14, 34), which can temper proinflammatory responses (911) and contribute to the resolution of inflammation (2, 1214). Return of ECRG4 expression at the end of the inflammatory phase (Figs. 6D and 5, H and I) decreases CD44 expression (Figs. 6E and 5, G and I) and restores homeostatic expression levels. This model is further supported by studies of human burn patients, where it has been observed that cell surface ECRG4 on circulating leukocytes diminishes after injury but returns to housekeeping levels as patients recover (24). These findings support a role for ECRG4 as a sentinel factor, which can both precondition the responsiveness of leukocytes through its regulation of CD44 expression and respond to environmental cues to mediate the kinetics of the cutaneous inflammatory response.

(A) On quiescent leukocytes, ECRG4 expression maintains CD44 at homeostatic levels. Following injury, leukocytes present in the wound are exposed to proteases during the hemostasis and early inflammatory phases. These proteases cleave leukocyte cell surface ECRG4 to release active peptides into the wound milieu, which enhance the early local inflammatory response. (B) Black tracing represents decreasing cell surface ECRG4 as it is cleaved by wound proteases to release peptides. During this phase, ECRG4 transcription remains low (green tracing), so ECRG4 protein is not replenished on the cell surface. (C) This loss of ECRG4 removes its inhibition of CD44 expression (red tracing), which results in an increase in cell surface CD44 receptor (purple tracing). Increased CD44 functions to resolve the inflammatory phase; it is activated by HA fragments in the wound to decrease proinflammatory signaling. As the wound transitions to the proliferative phase, ECRG4 expression resumes (D) and mediates a decrease in CD44 expression (E), returning both ECRG4 and CD44 cell surface protein to homeostatic levels as wound closure completes and the wound transitions to the remodeling phase. Gene expression data from Fig. 5 (G to I) [Gene Expression Omnibus accession GSE23006; (34)] are shown. Protein expression inferred from published reports (14, 35).

While deficient neutrophil mobilization has been shown to inhibit wound healing (36, 37), which we observed in the ECRG4 KO mouse wound, many studies have demonstrated that prolonged neutrophil recruitment also results in delayed wound closure (38, 39). Earlier studies examined the effect of adenovirus-driven ECRG4 overexpression in cutaneous excisional wounds and observed delayed wound healing, possibly through decreased migration of fibroblasts (33). On the basis of our current studies, we hypothesize that ECRG4 overexpression in the wound bed decreases CD44 expression, which has been shown to decrease fibroblast migration (2). This is supported by the wound closure (Fig. 1A) and healing rate (fig. S1A) plots. Initially, rapid wound closure occurs through contraction and migration of keratinocytes over residual basement membrane at the wound margin. The rate then slows, as further reepithelialization requires keratinocyte proliferation and replacement of the basement membrane by fibroblasts. In our model, ECRG4 KO mice have increased CD44 expression, which may contribute to the equalization of the healing rate seen in the KO mouse after an initial delay that occurs in the first 3 days after injury. The potential role of ECRG4 in regulating the function of stromal cells is outside the scope of this study but will be an important area for further investigation. Our current results also suggest that an ECRG4-mediated decrease in CD44 expression could support excessive neutrophil recruitment and prolonged inflammation (2, 14, 32), which also contribute to delayed wound closure. Neutrophils are essential for the onset of inflammation, but the termination of neutrophil influx is equally critical for timely resolution of inflammation and prompt restoration of tissue homeostasis (40).

In our study, we demonstrated that ECRG4 is a negative regulator of CD44 expression and a mediator of early inflammatory responses. It is interesting to note that the gene encoding ECRG4 is epigenetically regulated. Its expression and transcriptional responsiveness are down-regulated by hypermethylation of its promoter (41), accounting for its diminished expression in multiple human cancers (1921). Many of these same cancers are marked by increased expression of CD44 (42), which is implicated in their proliferation and metastasis and correlates with our findings that ECRG4 is a negative regulator of CD44. On the basis of our experimental observations demonstrating a role for ECRG4 in recruiting neutrophils to the site of injury and regulating CD44 expression levels, it is interesting to speculate that the epigenetic inhibition of ECRG4 expression may alter CD44 expression to precondition the inflammatory response, thus driving phenotypic differences in individuals based on environmental exposures and aging, which affect promoter methylation.

Here, we report that ECRG4 modulates CD44 expression and mediates the early neutrophil response to injury, with impaired wound repair in its absence. The precise timing of inflammation and its resolution in the wound healing response is essential to proper wound closure, with unresolved inflammation driving most of the chronic wounds. Our current study demonstrates that ECRG4 is a factor that helps orchestrate the proper timing of the inflammatory response: First, it facilitates and amplifies early inflammation but then subsequently supports the expression of factors that are essential to injury resolution. A better understanding of its contribution to inflammation preconditioning, susceptibility, and resilience will help identify new and sorely needed diagnostic and therapeutic strategies to treat cutaneous diseases that are associated with dysfunctional inflammation, including chronic wounds.

Heterozygous ECRG4 KO mice were purchased from the Mutant Mouse Regional Resource Center supported by the National Institutes of Health and distributed by the University of California, Davis. Briefly, RIKEN complementary DNA 1500015O10 gene coding exon 1 was targeted by homologous recombination in B6/129S5 mixed-background mice. Heterozygous ECRG4 KO mice were then backcrossed to C57/BL6 mice (the Jackson Laboratory, no. 000664) for five generations and subsequently interbred to generate homozygous ECRG4 KO mice on the C57/BL6 background. Ten- to 12-week-old littermate mice were used for experiments involving ECRG4 KOs, and 10- to 12-week-old C57/BL6 mice purchased from the Jackson Laboratory were used as WT mice in experiments without ECRG4 KO mice. The University of California, San Diego (UCSD) Institutional Animal Care and Use Committee approved all animal procedures.

Excisional wound studies were modified from the protocol of Galiano et al. (43). Briefly, mice were anesthetized, and dorsal hair was clipped and depilated with Nair (Church & Dwight). Full-thickness excisional skin wounds were created with a 4-mm biopsy punch. A donut-shaped splint with an outer diameter of 10 mm and an inner diameter of 6 mm was prepared from a 0.5-mm-thick silicone sheet (Grace Bio-Labs, Bend, OR) and sutured on top of the wound using 4-0 nylon monofilament sterile suture (CP Medical, no. CP-B662B-05). Digital photography was used to image each wound daily with a ruler included for scale. Wound area was assessed by planimetry using the National Institutes of Health ImageJ software. Wounds were excised at various time points in some experiments and either fixed in 10% buffered formalin for histological analysis or digested with a Whole Skin Dissociation Kit (Miltenyi Biotec, no. 130-101-540) per manufacturers instructions to isolate cells for flow cytometry. All experiments were repeated three times, unless otherwise stated, with data pooled and total n noted in the figure legends of each experiment.

ECRG4 KO mice and WT littermates, or C57/BL6 mice, were used for PVA sponge implantation assays (28). PVA sponges (7 mm by 3 mm; PVA Unlimited Inc.) were sterilized and hydrated with saline. Anesthetized mice were shaved, an incision was made on the back, and sponges were implanted subcutaneously (28, 29). Incisions were closed with a single 4-0 monofilament nylon suture (CP Medical, no. CP-B662B-05). In one set of assays, 2 g of sterile synthetic CT16 peptide (Phoenix Pharmaceuticals, no. 012-24) in phosphate-buffered saline (PBS), or vehicle control, was instilled into the PVA sponges before implantation. Infiltrates were isolated from the sponge in PBS and analyzed by flow cytometry at indicated time points. All experiments were repeated three times, unless otherwise stated, with data pooled and total n noted in the figure legends of each experiment.

Live cells were collected from mouse bone marrow, blood, spleen, PVA sponges, or digests of mouse wounds and skin, as described above. Cells were incubated with a cocktail of primary antibodies that included specified antibodies: antiCD11bAPC (allophycocyanin)Cy7 (BD Pharmingen, 561039; 1:200) and antiLy6CPE (phycoerythrin) (BD, eBioscience, 12-5932-80; 1:200) or antiCD45-VioGreen (Miltenyi Biotec, 130-110-803), antiCD11b-APC-Vio770 (Miltenyi Biotec, 130-109-288), antiLy6C-APC (Miltenyi Biotec, 130-102-341), antiCD44-PE-Vio770 (Miltenyi Biotec, 130-110-085), and antiLy6GFITC (fluorescein isothiocyanate) (Miltenyi Biotec, 130-107-912) or Lineage-Biotin cocktail (Miltenyi Biotec, 130-092-613) + antibiotin-FITC (Miltenyi Biotec, 130-113-852), antiCD48-VioBlue (Miltenyi Biotec, 130-102-447), antiSca1-PE (Miltenyi Biotec, 130-116-489), antiCD150-PE-Vio770 (SLAM) (Miltenyi Biotec, 130-104-682), and antiCD117-APC (Miltenyi Biotec, 130-102-492). Propidium iodide (Miltenyi Biotec, 130-093-233) exclusion was used to determine viable cells. HL60 cells were stained with antiCD44-APC (Miltenyi Biotec, 130-113-338). Flow cytometric and data analyses were performed on a BD Accuri or Miltenyi Biotec MACSQuant10 Flow Cytometer. Data were analyzed with FlowJo software (FlowJo LLC), and statistical analysis was performed as below. All experiments were repeated three times, unless otherwise stated.

To measure infiltration of Gr1+ cells into the wound, tissues were harvested 1 day after injury and frozen in optimal cutting temperature compound. Standard immunohistochemistry was performed on frozen sections using biotinylated antiGr-1 (BD Pharmingen, clone RB6-8C5, no. 553125; 1:200) as the primary antibody and horseradish peroxidaseconjugated streptavidin (Jackson ImmunoResearch, no. 016-030-084; 1:500) as the secondary antibody. Nuclei were counterstained by Mayers hematoxylin, and slides that were incubated with 1% bovine serum albumin instead of primary antibody were used as negative controls. Immunostaining of tissue sections was imaged with an FSX100 microscope (Olympus). Identification of neutrophils was confirmed by cell and nuclear morphology. Paraffin embedding, sectioning, and hematoxylin and eosin (H&E) stains were performed by the UCSD Tissue Technology Shared Resource Histology Core.

The MRSA strain USA300 LAC was grown on Baird-Parker agar for selection, with individual colonies inoculated in tryptic soy broth and grown to mid-log phase. Bacteria were washed in sterile PBS. One hundred microliters of whole blood from ECRG4 KO or WT mice was inoculated with 105 colony-forming units (CFUs) (starting concentration of 1 106 CFU/ml), and samples were incubated at 37C for 3 hours. Serial dilutions of the samples and initial inoculum were prepared in PBS and plated on Baird-Parker agar for enumeration. n = 4 mice per group with three technical replicates per mouse.

The acute promyelocytic leukemia promyeloblast human cell line HL60 (ATCC CCL-240) was purchased from the American Type Culture Collection (ATCC) and maintained as recommended in Iscoves modified Dulbeccos medium with 20% fetal bovine serum in an atmosphere of air (95%) and carbon dioxide (5%) at 37C with replacement of medium and passaging at a cell density between 1 105 and 1 106 viable cells/ml every 2 to 3 days.

The full-length human ECRG4 open reading frame was amplified by PCR of a pCMV6-XL4-c2orf40 plasmid (OriGene, no. SC104814) encoding the human ECRG4 transcript (NM_032411) using primers 5-AGTCCTCGAGCCCCGCCGCCATGGCTG-3 (forward) and 5-ATTCGGATCCATGGTTAGTAGTCATCGTA-3 (reverse) and cloned into the Xho I and Bam HI cloning sites of pLVX-IRES-ZsGreen1 vector (Clontech, no. 632187) to generate a bicistronic expression vector (lv-ECRG4) that encodes and expresses ECRG4 and green fluorescent protein (GFP). Sequencing confirmed identity of the final plasmid, and the pLVX-IRES-ZsGreen1 plasmid without ECRG4 was used to prepare control GFP+ cells (lv-vector). Lentivirus was prepared using a lentivirus packaging system (Clontech) in Lenti-X 293 cells as described by the manufacturer. Viral titers obtained ranged from 2.3 107 to 4.0 107 used within 3 days on target cells.

HL60 cells were transfected using empty (lv-vector) or ECRG4 (lv-ECRG4) lentivirus using RetroNectin reagent (Takara Inc.) as described by the manufacturer. Five days later, GFP+ cells were sorted at the cell sorting facility of the Moores Cancer Center at UCSD and expanded. Two weeks later, GFP+ cells were selected a second time by cell sorting, expanded, and passaged, and aliquots of both sorts were frozen in serumdimethyl sulfoxide.

In two experiments, vector and ECRG4-expressing HL60 cells were cultured in 35-mm, six-well culture dishes at a concentration of 50,000 cells per well, and RNA was isolated, digested free of DNA, and submitted to genomics core laboratories of Cedars-Sinai (Los Angeles) for RNA-seq analyses. Bioinformatics analyses were performed from FASTQ files, and FPKM (fragments per kilobase of exon model per million reads mapped) was determined by AccuraScience (Iowa), by the UCSD genomics and Cedars-Sinai core, or with public domain resources including STRING (https://string-db.org), Cytoscape (https://cytoscape.org), and the iDEP.85 web-based tool for RNA-seq data analysis and visualization (http://bioinformatics.sdstate.edu/idep/) as indicated.

RNA was isolated from HL60 cells using an RNeasy mini kit with deoxyribonuclease treatment (Qiagen, no. 74704) according to the manufacturers recommended procedures, and yields and purity were assessed using a NanoDrop2000 Spectrophotometer (Thermo Fisher Scientific). Complementary DNA synthesis was accomplished with 1 g of total RNA using iScript (Bio-Rad #170-8891) according to the manufacturers procedures. CD44 gene expression was analyzed with CD44 primers purchased from OriGene (no. HP200577), and data were normalized to glyceraldehyde-3-phosphate dehydrogenase using forward (CATGAGAAGTATGACAACAGCCT) and reverse (AGTCCTTCCACGATACCAAAGT) primers purchased from Life Technologies.

All statistical analyses were performed using Mstat software (McArdle Laboratory for Cancer Research, University of Wisconsin) or GraphPad Prism (GraphPad Prism Software Inc.). Unpaired two-sample t test, Wilcoxon rank sum test, or two-way analysis of variance (ANOVA) with Bonferroni posttest were used. P < 0.05 was considered statistically significant. Data are presented as means SD of the mean. Sample size calculations were performed with = 0.05 and = 0.2. First derivative of the wound closure plot in Fig. 1A was performed with Prism with default 4 neighbor smoothing.

Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/11/eaay0518/DC1

Fig. S1. ECRG4 regulates the early response to injury.

Fig. S2. HA signaling pathway from KEGG pathway analysis of RNA-seq data.

Fig. S3. Flow cytometric validation of RNA-seq targets relevant to inflammation.

Fig. S4. ECRG4 KO mice have increased CD44 expression on CD45+ leukocytes in blood.

Table S1. Gene Ontology and KEGG pathway visualization of RNA-seq data.

Data file S1. RNA-seq data.

This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial license, which permits use, distribution, and reproduction in any medium, so long as the resultant use is not for commercial advantage and provided the original work is properly cited.

Acknowledgments: We thank A.-M. Hageny, E. Amburn, and K. Sail for their technical support. Funding: This project was supported by the National Institutes of Health, grant KL2TR001444 of CTSA funding through the UCSD CTRI, and a Sun Pharma-SID Innovation Research Fellowship to R.A.D. and NCI R01 CA170140, DoD/ABA W81XWH-10-1-0527, and UCSD Hammond Fund and Division of Trauma Research Re-Investment Fund to B.P.E., A.B., and T.C. The UCSD Tissue Technology Shared Resources Core, supported by the NCI Cancer Center Support grant P30CA23100, performed hemograms and tissue processing with H&E staining. Author contributions: R.A.D., J.L., T.C., A.B., and B.P.E. designed the studies. R.A.D., J.L., and O.C. performed the experiments. R.A.D. wrote the manuscript with editorial advice from A.B. and B.P.E. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are presented in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read more from the original source:
ECRG4 regulates neutrophil recruitment and CD44 expression during the inflammatory response to injury - Science Advances

Cosmetic Skin Care Market 2018: Global Industry Insights by Global Players, Regional Segmentation, Growth, Applications, Major Drivers, Value and Foreseen till 2024

The report provides both quantitative and qualitative information of global Cosmetic Skin Care market for period of 2018 to 2025. As per the analysis provided in the report, the global market of Cosmetic Skin Care is estimated to growth at a CAGR of _% during the forecast period 2018 to 2025 and is expected to rise to USD _ million/billion by the end of year 2025. In the year 2016, the global Cosmetic Skin Care market was valued at USD _ million/billion.

This research report based on Cosmetic Skin Care market and available with Market Study Report includes latest and upcoming industry trends in addition to the global spectrum of the Cosmetic Skin Care market that includes numerous regions. Likewise, the report also expands on intricate details pertaining to contributions by key players, demand and supply analysis as well as market share growth of the Cosmetic Skin Care industry.

Request Sample Report @https://www.mrrse.com/sample/6559?source=atm

Cosmetic Skin Care Market Overview:

The Research projects that the Cosmetic Skin Care market size will grow from in 2018 to by 2024, at an estimated CAGR of XX%. The base year considered for the study is 2018, and the market size is projected from 2018 to 2024.

Leading manufacturers of Cosmetic Skin Care Market:

below:

Global Cosmetic Skin Care Market, Product Analysis

Global Cosmetic Skin Care Market, Application Analysis

In addition the report provides cross-sectional analysis of all the above segments with respect to the following geographical markets:

Global Cosmetic Skin Care Market, by Geography

Request For Discount On This Report @ https://www.mrrse.com/checkdiscount/6559?source=atm

Some important highlights from the report include:

Buy This Report @ https://www.mrrse.com/checkout/6559?source=atm

The Questions Answered by Cosmetic Skin Care Market Report:

And Many More.

Read this article:
Cosmetic Skin Care Market Research Insights 2019 Global Industry Outlook Shared in Detailed Report, Forecast to 2027 - News Times

We are thrilled to share an excerpt form Dr. Q Schulte aufm Erley's article on Plant Stem Cells. Dr. Q is an entrepreneur, scientist and founder of one of our most loved partners: Shtrands. Shtrands is a beauty industry innovator. They provide a hair care concierge service that brings you curated products and expert advice to match your hair texture, scalp condition and styling needs.

The highly competitive cosmetics industry is always looking for the next best ingredient(s) that can fight the aging process and this led to a sizable increase in the number of anti-aging products on the market. With this is coming an increased number of active ingredients developed for this category; one of these ingredients is stem cell extract.This is an ingredient that must be assessed carefully, as marketing claims often push the limits of the available science.

The concept of stem cells originated at the end of the 19th century as a theoretical postulate to account for the ability of certain tissues (blood, skin, etc.) to renew themselves for the lifetime of organisms even though they are comprised of short-lived cells. Stem cells isolation and identification happened many years later though.

Stem cells have received a fair share of attention in the public debate mostly in connection with their potential for biomedical application and therapies. While the promise of organ regeneration have captured our imagination, it has gone almost unnoticed that plant stem cells represent the ultimate origin of much of the food we eat, the oxygen we breathe, as well the fuels we burn. Thus, plant stem cells may be ranked among the most important cells for human well-being.

A stem cell is a generic cell that can make exact copies of itself (daughters) indefinitely. These daughters can remain stem cells or further undergo differentiation (2). Such that a stem cell has the ability to make specialized cells for various tissues in the body, such as heart muscle, skin tissue, and liver tissue.

Because of their self-renewal functions, stem cells are the most important cells in the skin, as they are the source for continuous regeneration of the epidermis. Stem cell cosmetics are developed based on stem cell technology, which involves using extracts or culture media of stem cells. However, cosmetics containing human stem cells or their extracts have not been released into the market due to legal, ethical, and safety concerns. Meanwhile, plant stem cells, which circumvent these problems, are highly regarded in the cosmetics industry for improving culture technology.

The EUprohibits the use of cells, tissues, or products of human origin in cosmetics; stem cell therapy for anti-aging has not been approved or been deemed safe or effective in USA by the FDA. Furthermore, its use outside of a clinical research trial (which would be listed at http://www.clinicaltrials.gov) is prohibited. Whereas the Korea Food and Drug Association has allowed the use of sources originating from stem cell media in cosmetics since 2009 (3).

So, any cosmetics marketed as containing stem cells found on US market (should) contain stem cells extracted from plants.

A major difference between animal and plant stem cells is that plant stem cells provide cells for complete organs (branches, leaves, etc.), compared with the animal stem cells, which regenerate cells restricted to one tissue type.

Plants have nowhere to run when times get tough, so they must rely on an inner body plan to generate developmental responses to environmental changes.

Research by many labs in the last decades has uncovered a set of independent stem cell systems that fulfill the specialized needs of plant development and growth in four dimensions. In some long-lived plants, such as trees, plant stem cells remain active over hundreds or even thousands of years, revealing the exquisite precision in the underlying control of proliferation, self-renewal and differentiation.

There is some confusion around the term stem cell due to the marketing verbiage used by the cosmetic companies. In topical cosmetics the formulations dont contain stem cells straight out of the plants. They are actually a range ofplant stem cell extracts, which are manufactured using a cell culture technology.This technology consists of many and complicated methods that should ensure growth of plant cells, tissues or organs in the environment with a microbe-free nutrient. The plant cell technologyallows synthesis of the biologically active substances that exist in plants, but are not commonly available in natural environment or are difficult to obtain by chemical synthesis.

The extracts obtained through this technology from the plant stem cells are currently used for production of both common or professional care cosmetics (4).

The beneficial apple properties are known for centuries. Apples are cultivated today only for their taste, but earlier the main criterion of the type selection was the shelf life of the fruits.

One of such apple-tree types isUttwiler Spatlauberwhich is growing in Switzerland. This is a type cultivated solely due to a possible long-time storage of fruits, which remain fresh even for several months.Some trees come from the plant cutting sets planted during the 18th century!!!

The stem cell extracts are made in 2 main steps: first, the tissue material is obtained from apples (collected from a cut surfaces of the apples). Secondly, the material is going through a complicated biotechnological process to make the stem cell extracts that contains certain active ingredients. These are actually the ingredients used in formulations marketed as containing stem cells (5).

Swiss biotech company Mibelle Biochemistry created the product named PhytoCellTecTMMalus Domestica, that is a liposomal formulation (extract) derived from the stem cells of the Uttwiler Spatlauber apples. The company has published in vitro experiments done with hair follicles that showed the ability of theUttwiler Spatlauberstem cell extract to delaying of the tissue atrophy process (6); this ingredient delays hair aging.

At Teadora, we chose to includeMibelle'sPhytoCellTecTM Argan Plant Stem Cells in our ButterandBrazilian Glow Oiland here are the details from Mibelle that helped to convince us this ingredient was a must have companion to the huge list of active superfruits we crafted into our products, read on, it's pretty cool:

Deep-Seated Rejuvenation of the Skin:In order to maintain the skin in a healthy condition,cutaneous tissue is being continuously regenerated.This regenerative capacity relies on adult stem cells inthe skin. While considerable research has been done onepidermal stem cells, dermal stem cells were identifiedonly in 2009. The dermis is the middle layer of the skinand gives it tensile strength and elasticity, therefore it isalso the site where wrinkles originate.

PhytoCellTec Argan was developed to improvethe regenerative capacity of dermal stem cells therebyachieving deep-seated rejuvenation of the skin.

PhytoCellTec Argan is a powder based on stem cellsof the argan tree, one of the oldest tree species in theworld.In order to evaluate which active ingredient effectivelypromotes dermal stem cell activity, a stable humandermal papilla cell line was used as a new test system:stem cell activity is assessed based on the expression ofthe Sox2 gene, which is an established stem cell marker.Furthermore, the characteristic property of stem cells togrow in three-dimensional spherical colonies serves asa second observable indicator of stem cell viability inthis assay.

Clinical studies performed on healthy volunteers showedthat PhytoCellTec Argan:

effectively stimulates the regeneration of dermalconnective tissue, thereby increasing skin density

helps the skin to regain its firmness

significantly reduces wrinkle depth in crows feet area.

PhytoCellTec Argan is the very first active ingredientthat is capable of both protecting and vitalizing humandermal stem cells. This will not only help to acceleratethe skins natural repair process but also fights skin agingright at the root. Here are some of the amazing benefits:

Vitalizes and protects dermal stem cells Reduces wrinkles Tightens and tones skin tissues Increases skin firmness and density Deep-seated rejuvenation of the skinFirst cosmetic active with proven results forprotecting and vitalizing dermal stem cells

Continued here:
Benefits of Plant Stem Cells for Skin & Hair | Teadora

Dublin, March 10, 2020 (GLOBE NEWSWIRE) -- The "Cell Therapy - Technologies, Markets and Companies" report from Jain PharmaBiotech has been added to ResearchAndMarkets.com's offering.

The cell-based markets was analyzed for 2018, and projected to 2028. The markets are analyzed according to therapeutic categories, technologies and geographical areas. The largest expansion will be in diseases of the central nervous system, cancer and cardiovascular disorders. Skin and soft tissue repair as well as diabetes mellitus will be other major markets.

The number of companies involved in cell therapy has increased remarkably during the past few years. More than 500 companies have been identified to be involved in cell therapy and 309 of these are profiled in part II of the report along with tabulation of 302 alliances. Of these companies, 170 are involved in stem cells.

Profiles of 72 academic institutions in the US involved in cell therapy are also included in part II along with their commercial collaborations. The text is supplemented with 67 Tables and 25 Figures. The bibliography contains 1,200 selected references, which are cited in the text.

This report contains information on the following:

The report describes and evaluates cell therapy technologies and methods, which have already started to play an important role in the practice of medicine. Hematopoietic stem cell transplantation is replacing the old fashioned bone marrow transplants. Role of cells in drug discovery is also described. Cell therapy is bound to become a part of medical practice.

Stem cells are discussed in detail in one chapter. Some light is thrown on the current controversy of embryonic sources of stem cells and comparison with adult sources. Other sources of stem cells such as the placenta, cord blood and fat removed by liposuction are also discussed. Stem cells can also be genetically modified prior to transplantation.

Cell therapy technologies overlap with those of gene therapy, cancer vaccines, drug delivery, tissue engineering and regenerative medicine. Pharmaceutical applications of stem cells including those in drug discovery are also described. Various types of cells used, methods of preparation and culture, encapsulation and genetic engineering of cells are discussed. Sources of cells, both human and animal (xenotransplantation) are discussed. Methods of delivery of cell therapy range from injections to surgical implantation using special devices.

Cell therapy has applications in a large number of disorders. The most important are diseases of the nervous system and cancer which are the topics for separate chapters. Other applications include cardiac disorders (myocardial infarction and heart failure), diabetes mellitus, diseases of bones and joints, genetic disorders, and wounds of the skin and soft tissues.

Regulatory and ethical issues involving cell therapy are important and are discussed. Current political debate on the use of stem cells from embryonic sources (hESCs) is also presented. Safety is an essential consideration of any new therapy and regulations for cell therapy are those for biological preparations.

Key Topics Covered

Part I: Technologies, Ethics & RegulationsExecutive Summary 1. Introduction to Cell Therapy2. Cell Therapy Technologies3. Stem Cells4. Clinical Applications of Cell Therapy5. Cell Therapy for Cardiovascular Disorders6. Cell Therapy for Cancer7. Cell Therapy for Neurological Disorders8. Ethical, Legal and Political Aspects of Cell therapy9. Safety and Regulatory Aspects of Cell Therapy

Part II: Markets, Companies & Academic Institutions10. Markets and Future Prospects for Cell Therapy11. Companies Involved in Cell Therapy12. Academic Institutions13. References

For more information about this report visit https://www.researchandmarkets.com/r/bzimne

Research and Markets also offers Custom Research services providing focused, comprehensive and tailored research.

Read more:
Cell Therapy Insights Report, 2018-2028: Markets, Technologies, Ethics, Regulations, Companies & Academic Institutions - Benzinga

I feel like a sacrificial lamb, or an acceptable casualty. When a politician or scientist or couch expert says, Its only the old and ill that die, they are talking about me. The coronavirus threat has changed my identity from that of a father, husband, son, friend, pastor, alcoholic with two years sobriety and a slew of chips to prove it, to that of a comforting statistic. My new identity may soon be summed up on the news when they say, Its OK. He had underlying health problems.

Im not complaining about those who are young and healthy. When I consider my children and my wife, I, like many of you, thank God for their health. Three months ago, I would have said the same thing about my health. Unfortunately, that changed in January when I finally decided to go to the doctor and have the little red spots that had formed all over my skin, along with the new bruises that showed up daily, looked at. I found out that the blood platelets that keep all of us from bleeding to death had decided to take a vacation from my body. Most people have anywhere from 150,000 to 450,000 platelets per microliter of blood. Mine were at 4,000, and there was a danger of blood seeping into my brain, ending my life.

The first time I was in the hospital, I was there for eight days. They ran tests and stuck me with needles, capping it all off with a bone-marrow biopsy. I was diagnosed with a rare blood disorder called aplastic anemia. To put it simply, my stem cells are under siege, making it difficult for my body to produce platelets, as well as red and white blood cells. I have been hospitalized around 45 days since that diagnosis. Im actually writing this article from a hospital room. Theres a truly stunning view of the hospital roof outside my window. With no white blood cells, my immune system is completely compromised, and every little infection that normal people fight off without even noticing brings me back to the hospital again.

The only cure for me is to have a bone-marrow transplant. The problem is, even though there are several matches for my transplant, in order for the transplant to go as well as possible I have to be free of infections, viruses and other diseases. Only then can I be admitted to the University of Minnesotas Blood and Bone Marrow Transplant Center. Last month this didnt bother me. Now, though, the coronavirus is coming up behind me, daring me to wait longer.

If all goes well, Ill be discharged from the hospital and self-quarantined to my house with a bag full of antibiotics and other drugs. Sadly, Ive been told that the other things I need to stay healthy and get to my transplant are gone. The hand sanitizer, the antibacterial wipes, the masks that my family should be wearing, and the N95 respirators that I need to wear are nowhere to be found someone actually stole a box of masks from outside my hospital room. Many of these items have been snatched up by the same folks who thank God they are not me.

Again, dont get me wrong. I am grateful for those who are young and healthy. They should be thankful, for they are blessed. I just pray that when they give that thanks, they remember those of us who are terrified by what is coming. We are not simply a means to calm peoples fears; we are people who deserve compassion, mercy and dignity. I ask simply that you pray for the old and sick that they might get through this, that you leave a little hand sanitizer on the shelves for us, and for goodness sake, dont take the N95 respirators from my hospital room. I need them because my family, who knows that I am more than a comforting statistic, needs me. They need the man who loves them dearly and desperately wants to continue to be their father and husband.

Howard Baird lives in Maple Grove.

Visit link:
OPINION EXCHANGE | Amid the coronavirus threat: A plea on behalf of the old and sick - Minneapolis Star Tribune

derma aesthetics are proud to announce the launch of the Australasian Academy of Corneotherapy in Australia and New Zealand. The academy has been established to provide cutting edge Corneotherapy and skin education to all skin therapists, with the aim of advancing the level of in-depth skin health knowledge amongst the local industry.

Simone Vescio, Founder of the Australasian Academy of Corneotherapy says, Over the past eight years we have pioneered the awareness and education of corneotherapy across Australia and New Zealand, and were thrilled to be opening up our education to the aesthetics industry in Australasia!

Throughout 2020, the AAC will be holding series of Skin Extension Education Classes with the first classes having already opened their doors and been held in Sydney and Auckland in February.

From 2020 we are opening up our educational classes, training and access to the latest information on corneotherapy to all therapists, no matter what their brand of choice may currently be. There was a lack of non-product aligned education in our local industries, and were proud to be filling this gap, said Simone.

AAC Skin Extension Education 2020 - Class Schedule:Tuesday, 17 March 2020 PerthMonday, 30 March 2020 MelbourneMonday, 18 May 2020 AlburyMonday, 27 July 2020 BrisbaneMonday, 2 November 2020 Christchurch

The AAC Skin Extension Education classes have been designed to deliver comprehensive education on some of the most important and complex subjects and skin conditions. Plus, there will also be time for Q&A and further learning from your peers and educator during the day, said Simone.

Topics covered in each class include:

See the article here:
Press Release: Introducing the Australasian Academy of Corneotherapy - PRWire