Abstract

Hepatitis C virus (HCV) remains a major human pathogen that requires better understanding of virus-host interactions. In this study, we performed a genome-wide CRISPR-Cas9 screening and identified TRIM26, an E3 ligase, as a critical HCV host factor. Deficiency of TRIM26 specifically impairs HCV genome replication. Mechanistic studies showed that TRIM26 interacts with HCV-encoded NS5B protein and mediates its K27-linked ubiquitination at residue K51, and thus promotes the NS5B-NS5A interaction. Moreover, mouse TRIM26 does not support HCV replication because of its unique sixamino acid insert that prevents its interaction with NS5B. Ectopic expression of human TRIM26 in a mouse hepatoma cell line that has been reconstituted with other essential HCV host factors promotes HCV infection. In conclusion, we identified TRIM26 as a host factor for HCV replication and a new determinant of host tropism. These results shed light on HCV-host interactions and may facilitate the development of an HCV animal model.

Hepatitis C virus (HCV) is an enveloped, single-stranded RNA virus belonging to the family Flaviviridae. The HCV RNA genome is 9.6 kb in length and consists of a single open reading frame (ORF) flanked by highly conserved 5 and 3 untranslated regions (UTRs). The ORF encodes a single polyprotein of over 3000 amino acids, which is cleaved by cellular and viral proteases into structural proteins (core, E1, and E2) and nonstructural proteins (p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B). NS5B, an RNA-dependent RNA polymerase (RdRp), together with other nonstructural proteins NS3, NS4A, NS4B, and NS5A, forms intracellular membraneassociated replication complex and catalyzes viral genomic RNA replication. HCV infects over 71 million people worldwide (1). Among this infected population, about 80% develop persistent infection, leading to severe liver diseases, such as liver cirrhosis and hepatocellular carcinoma (HCC). Recently developed direct-acting antiviral agents (DAAs) targeting viral NS3 protease, NS5A and NS5B polymerases are highly effective in curing patients with HCV. However, global eradication of HCV remains challenging due to lack of an HCV vaccine, potential drug-resistant mutations, severe liver disease progression in DAA-cured patients, and other newly emerging problems (2). Better understanding of viral life cycle and virus-host interactions is still imperative for the prevention and control of HCV infection.

The tripartite motif (TRIM) family that consists of more than 70 members in human plays roles in multiple cellular processes including intracellular signaling, development, apoptosis, protein quality control, innate immunity, autophagy, and carcinogenesis (3). An increasing number of studies have focused on the roles of TRIM family proteins in host responses to virus infection. TRIM5 recognizes retroviral capsids to induce premature core disassembly and inhibits reverse transcription of the viral genome (4, 5). TRIM69 restricts dengue virus (DENV) replication by ubiquitinating viral NS3 (6). TRIM22 and TRIM41 inhibit influenza A virus infection by targeting nucleoprotein for degradation (7, 8). TRIM56 suppresses Zika virus (ZIKV) replication through sequestration of its genomic RNA (9).

As an E3 ligase, TRIM26 contains an N-terminal RING domain, B-box domain, coiled-coil domain, and a C-terminal SPRY domain. One study showed that TRIM26 promotes interferon regulatory factor 3 (IRF3) degradation and thus suppresses interferon- (IFN-) signaling (10), while another showed that TRIM26 promotes the interaction between the kinases TBK1 and NEMO, leading to activation of IFN signaling (11). In this study, we identified TRIM26 as a critical host factor of HCV by genome-wide CRISPR screening. A mechanistic study demonstrated that TRIM26 mediates NS5B ubiquitination and enhances its interaction with NS5A, which is crucial for HCV genome replication. Furthermore, we showed that mouse TRIM26 does not support HCV replication because of its unique sixamino acid insert that prevents its interaction with NS5B, providing new evidence for understanding the genetic basis underlying the exceptionally narrow host tropism of HCV infection. Ectopic expression of human TRIM26 in a mouse hepatoma cell line that has been reconstituted with other essential HCV host factors promotes HCV infection, providing clues for the development of an HCV animal model.

Taking advantage of the NIrD (NS3-4A inducible rtTA-mediated dual-reporter) reporter system to monitor HCV infection in real-time and live-cell fashion (12), we performed a genome-wide CRISPR-Cas9 screening to identify host factors essential for HCV infection (13) (Fig. 1A). Huh7.5 cells harboring the NIrD reporter showed red fluorescence (mCherry) upon cell culture-derived HCV (HCVcc) infection in the presence of doxycycline. The reporter cells transduced with a CRISPR single guide RNA (sgRNA) library targeting human proteincoding genes were infected with HCVcc at multiplicity of infection (MOI) of 0.1, and mCherry-negative cells were enriched by cell sorting. The abundance of each sgRNA in the enriched mCherry-negative cells was measured through deep sequencing and analyzed with the RIGER (RNAi Gene Enrichment Ranking) algorithm (tables S1 and S2). Many host factors were identified from this screening (Fig. 1B). Among the top candidates, CD81, occludin (OCLN), and claudin 1 (CLDN1) are the well-defined HCV entry factors (1416). Peptidylproly isomerase A (PPIA), also known as cyclophilin A (CypA), has been shown critical for HCV replication (17). ELAV-like RNA binding protein 1 (ELAVL1) interacted with HCV 3UTR and enhanced HCV replication (18). These positive results validated our CRISPR screening. Except for these previously described hits, TRIM26 is a top hit from our screening and was also identified in a previous screening (19). To investigate the role of TRIM26 in HCV infection, we silenced TRIM26 expression in Huh7 cells through CRISPR interference (CRISPRi) (20). Two TRIM26 sgRNAs (sg1 and sg2) that efficiently reduced the TRIM26 expression (Fig. 1C), which had no effect on cell viability (Fig. 1D), were selected for the following experiments. TRIM26 knockdown cells were infected with HCVcc at MOI of 0.1, and the intracellular HCV RNA, NS3 protein levels, and extracellular HCV titer were measured at the indicated time points after HCVcc infection. As shown in Fig. 1 (E to G), TRIM26 knockdown reduced the HCV RNA level, NS3 protein expression, and extracellular HCV titer. We further reconstituted wild-type TRIM26 and the RING domaindeleted mutant (TRIM26R) in the TRIM26 knockdown and control cells. The expression of TRIM26 and TRIM26R in these cells was verified by Western blot (fig. S1A). As shown in fig. S1 (B to D), exogenous expression of wild-type TRIM26, but not TRIM26R, restored HCV infection in the TRIM26 knockdown cells.

(A) Schematic of whole-genome scale CRISPR screening. (B) The hits identified in CRISPR screening were shown after RIGER analysis. Top hits in the screening were marked by the gene symbols with different colors. (C) Western blot analysis of TRIM26 expression in three TRIM26 knockdown Huh7 cells. (D) Effect of TRIM26 knockdown on cell viability. (E to G) Control and TRIM26 knockdown Huh7 cells were infected with HCVcc at MOI of 0.1 for the indicated time points, and intracellular HCV RNA (E), extracellular HCV titer (F), and NS3 protein (G) were determined. HCV RNA was expressed as values relative to the actin mRNA level. The error bars represent SDs from two independent experiments. FFU, focus-forming units. One-way ANOVA was used for statistical analysis. Not significant (ns), P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. The protein levels were quantified by ImageJ, normalized against internal actin, and expressed as values relative to control cells.

To further confirm the role of TRIM26 in HCV infection, we generated Huh7.5.1 TRIM26 knockout cells (fig. S2, A and B). We then infected Huh7.5.1 TRIM26 knockout and control cells with HCVcc at MOI of 0.1. Consistently, TRIM26 knockout reduced the HCV RNA level, NS3 expression, and extracellular HCV titer (fig. S2, C to E). Together, these results demonstrated that TRIM26 plays an important role in HCV infection.

Previous studies showed that TRIM26 is involved in IFN signaling (10, 11). To examine the potential effect of IFN signaling in TRIM26 knockdown cells on HCV infection, Huh7-TRIM26 knockdown and control cells were infected with HCVcc at MOI of 0.1. IFN- and IFN-stimulated gene (ISG) mRNA levels were determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR). As shown in fig. S3, no difference was observed between the TRIM26 knockdown and control cells after HCV infection, suggesting that involvement of TRIM26 in HCV infection is not mediated by its potential action on host IFN signaling.

To investigate in which step of the HCV life cycle TRIM26 is involved, we used HCVE1 that lacks the E1 region in viral genome and only undergoes single-round infection in Huh7 cells (21). Huh7-TRIM26 knockdown and control cells were infected with the HCVE1 virus at MOI of 0.1, and HCV RNA level was determined. As shown in Fig. 2A, TRIM26 knockdown reduced HCVE1 RNA level for about sevenfold at 72 hours after infection, suggesting that TRIM26 may contribute to HCV entry or genome replication. Next, we used the pseudotyped HCV particles (HCVpp) that harbor HCV envelope glycoproteins and serve as a surrogate model for HCV entry (22). Huh7-TRIM26 knockdown cells and control cells were infected with HCVpp. As shown in Fig. 2B, no substantial difference was observed between the TRIM26 knockdown and control cells, suggesting that TRIM26 has no effect on HCV entry. To assess the potential effect of TRIM26 on HCV polyprotein cleavage and translation, the TRIM26 knockdown and control cells were transfected with plasmids expressing nonstructural proteins NS3-5B or an RdRp-deficient HCV genome (JFH1-GND-Rz) that recapitulates internal ribosomal entry site (IRES)dependent viral protein translation and polyprotein cleavage. As shown in fig. S4, TRIM26 knockdown had no effect on HCV polyprotein cleavage and translation. Last, we examined the impact of TRIM26 on HCV genome replication using HCV subgenomic replicon that serves as a surrogate model for viral genome replication (23). The JFH1 subgenomic replicon cells were transduced with lentiviruses expressing TRIM26-sgRNA or control EGFP-sgRNA. HCV RNA and NS3 protein levels were analyzed by RT-qPCR and Western blot, respectively. As shown in Fig. 2 (C and D), TRIM26 knockdown reduced both HCV RNA and NS3 protein levels. Together, these results demonstrated that TRIM26 is likely involved in HCV genome replication.

(A) Control and TRIM26 knockdown Huh7 cells were infected with the single-round infectious HCVE1 for the indicated time points. The HCV RNA level was detected by RT-qPCR. (B) Control and TRIM26 knockdown Huh7 cells were infected with HCVpp. The infectivity was quantified by luciferase assay. (C and D) JFH1-SGR cells were transduced with sgEGFP or sgTRIM26 for the indicated time points. HCV RNA (C) and NS3 protein levels (D) were determined by RT-qPCR and Western blot, respectively. The error bars represent SDs from two independent experiments. One-way ANOVA (A and B) and t test (C) were used for statistical analysis. ns, P > 0.05; *P < 0.05; **P < 0.01; ****P < 0.0001. The protein levels were quantified by ImageJ, normalized against internal actin, and expressed as values relative to control.

Next, we determined whether TRIM26 is required for the replication of other HCV genotypes. Con1 (genotype 1b) (23) and PR87 (genotype 3a) (24) subgenomic replicon-harboring cells were transduced with lentiviruses expressing TRIM26-sgRNA or control EGFP-sgRNA. As shown in fig. S5 (A to D), TRIM26 knockdown reduced Con1 and PR87 viral RNA and NS5A protein expression. Furthermore, we showed that TRIM26 knockdown inhibited the infection of PR63cc, another genotype 2a HCVcc strain (fig. S5E) (25). Collectively, these results demonstrated that TRIM26 contributes to replication of HCV from multiple genotypes.

Next, we examined whether TRIM26 functions in infection of other flaviviruses, such as DENV and ZIKV. Huh7-TRIM26 knockdown and control cells were infected with DENV or ZIKV at MOI of 0.1. Intracellular viral RNA (fig. S6, A and D), extracellular viral titer (fig. S6, B and E), and DENV E protein level (fig. S6C) were measured. The results showed that TRIM26 knockdown had no effect on DENV and ZIKV infection.

To elucidate the underlying mechanism by which TRIM26 promotes HCV replication, we determined the interactions of TRIM26 with HCV-encoded proteins. Plasmids expressing TRIM26 and FLAG-tagged HCV proteins were cotransfected into human embryonic kidney (HEK) 293T cells to perform coimmunoprecipitation (co-IP) assays. As shown in fig. S7 (A to H), TRIM26 was coimmunoprecipitated with NS5B, but not with core, E1, E2, NS2, NS3, NS4B, or NS5A. Conversely, NS5B was coimmunoprecipitated with hemagglutinin (HA)tagged TRIM26 (Fig. 3A). We further confirmed the colocalization of NS5B and TRIM26 by confocal microscopy (fig. S7I). To verify the TRIM26-NS5B interaction in the context of HCV infection, Huh7 cells ectopically expressing FLAG-tagged TRIM26 were infected with HCVcc at MOI of 1 for 48 hours, and co-IP assay was performed. Consistently, NS5B, but not NS3, was coimmunoprecipitated with TRIM26 (Fig. 3B). This interaction was also confirmed in JFH1 subgenomic replicon cells (Fig. 3C).

(A) HEK293T cells were transfected with plasmids expressing HA-tagged TRIM26 and FLAG-tagged NS5B. The co-IP assay was performed with an anti-HA antibody. IB, immunoblot; IP: immunoprecipitation. (B) Huh7 cells transfected with FLAG-tagged TRIM26 for 24 hours were infected with HCVcc for another 48 hours, and the cell lysates were immunoprecipitated with anti-FLAG antibody. (C) JFH1 subgenomic replicon cells were transfected with FLAG-tagged TRIM26 for 48 hours, and the cell lysates were immunoprecipitated with anti-FLAG antibody. (D) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B, TRIM26, or TRIM26R together with HA-tagged ubiquitin for 48 hours. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (E) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B and TRIM26 along with HA-tagged ubiquitin or ubiquitin mutants. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (F) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B or NS5B K51R and TRIM26 along with HA-tagged ubiquitin. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (G) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B or NS5B K51R and TRIM26. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (H) Control and TRIM26 knockdown Huh7 cells were electroporated with in vitro transcribed JFH1 or JFH1-K51R subgenomic RNA. After G418 selection, the subgenomic replicon cells were harvested for detecting HCV RNA level by RT-qPCR. The error bars represent SDs from two independent experiments. t test was used for statistical analysis. ns, P > 0.05; **P > 0.01. The protein levels were quantified by ImageJ, normalized against TRIM26 input protein level, and expressed as values relative to FLAG IP protein level.

Next, we sought to map the key domains that are indispensable for TRIM26-NS5B interaction. We constructed TRIM26 mutants with a deletion in the N-terminal RING domain (TRIM26R) or the C-terminal SPRY domain (TRIM26SPRY) (fig. S8A), as well as NS5B mutants with a deletion in the N-terminal finger domain (NS5BN), the central palm domain (NS5B188-371), or the C-terminal thumb domain (NS5BC) (fig. S8B). The co-IP assays showed that the SPRY domain of TRIM26 and the C-terminal region of NS5B were required for the interaction (fig. S8, A and B).

As the function of TRIM26 in HCV replication requires its RING domain that is known to be responsible for ubiquitinating its substrates (fig. S1, B to D), we next examined whether TRIM26 mediates NS5B ubiquitination. HEK293T cells were cotransfected with plasmids expressing wild-type or RING-deleted TRIM26, FLAG-tagged NS5B, and HA-tagged ubiquitin, and then, NS5B was immunoprecipitated and its ubiquitination was analyzed by Western blot. As shown in Fig. 3D, wild-type, but not the RING-deleted TRIM26, promoted the ubiquitination of NS5B. Ubiquitin is known to link to substrate protein through its internal lysine residues at position 6, 11, 27, 29, 33, 48, or 63 (26); therefore, we constructed a series of ubiquitin mutants with the lysine (K)toarginine (R) change at each of these positions. We found that ubiquitin with the K27R mutation significantly reduced the TRIM26-mediated NS5B ubiquitination (Fig. 3E), suggesting that K27 is likely the ubiquitin lysine residue linked to NS5B.

Next, we sought to identify critical lysine residues of NS5B targeted by TRIM26. There are 30 lysine residues in NS5B of JFH1. We analyzed the conservation for these individual lysine residues among different HCV genotypes and their positions in the three-dimensional structure of NS5B (Protein Data Bank ID: 2XYM) (fig. S9A) (27). Given that TRIM26 is involved in the replication of HCV genotypes 1, 2, and 3, we selected 11 lysine residues that are highly conserved among the three genotypes (conservation, >90%) and located on the surface of NS5B structure (highlighted red in fig. S9A). As shown in Fig. 3F and fig. S9C, the K51R mutation in NS5B significantly reduced TRIM26-mediated NS5B ubiquitination, suggesting that TRIM26 promotes K27-linked ubiquitination of NS5B at the residue of K51.

Next, we investigated whether the K51R mutation in NS5B affects its interaction with TRIM26. Plasmids expressing TRIM26 and either wild-type or K51R-mutated NS5B were cotransfected into HEK293T cells to perform a co-IP experiment. As shown in Fig. 3G, the K51R mutation did not impair the interaction between NS5B and TRIM26.

Last, we assessed the effect of K51R mutation on HCV replication. The wild-type or NS5B-K51R mutant JFH1 subgenomic replicon was established in wild-type and TRIM26 knockdown Huh7 cells. As shown in Fig. 3H, NS5B K51R mutation reduced HCV replication in wild-type cells but not in the TRIM26 knockdown cells. Together, these results demonstrated that the TRIM26-mediated ubiquitination of NS5B at the K51 residue is critical for HCV replication.

To investigate how TRIM26-mediated NS5B ubiquitination enhances HCV replication, we examined the interaction of NS5B with other nonstructural proteins involved in the viral replication complex. Huh7-TRIM26 knockdown and control cells were transfected with the plasmid expressing the NS3-5B polyprotein. As shown in Fig. 4A, TRIM26 knockdown reduced the interaction between NS5B and NS5A but had little effect on the interaction between NS5B and NS3. Consistently, TRIM26 overexpression specifically enhanced the interaction between NS5B and NS5A (Fig. 4, B and C).

(A) Control and TRIM26- knockdown Huh7 cells were transfected with plasmids expressing NS3-5B-3 FLAG. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (B and C) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B, TRIM26, and NS3 (B) or NS5A (C). The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (D) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B and NS5A together with TRIM26 or TRIM26R. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (E) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B or NS5B K51R and NS5A together with TRIM26. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. The NS3 and NS5A protein levels were quantified by ImageJ, normalized against their input protein levels, respectively, and expressed as values relative to FLAG IP protein levels.

To assess whether TRIM26-mediated NS5B ubiquitination affects NS5B-NS5A interaction, FLAG-tagged NS5B, NS5A, and TRIM26 or TRIM26R expression plasmids were cotransfected into HEK293T cells to perform a co-IP assay. As shown in Fig. 4D, deletion of RING domain in TRIM26 reduced the interaction of NS5B and NS5A. To further confirm it, HEK293T cells were cotransfected with plasmids expressing wild-type or K51R-mutated NS5B, together with NS5A and TRIM26. As shown in Fig. 4E, NS5B K51R mutation reduced the NS5B-NS5A interaction. Together, these results demonstrated that TRIM26 mediates ubiquitination of NS5B and promotes its interaction with NS5A.

TRIM26 is expressed in a wide range of animals and highly conserved among different species (fig. S10 and Fig. 5A). Next, we determined whether TRIM26 from different species supports HCV replication. We cloned TRIM26 from mouse that does not efficiently support HCV replication and from tupaia (tree shrew) that has been reported to moderately support HCV replication (28). Human, mouse, and tupaia TRIM26, designated hTRIM26, mTRIM26, and tTRIM26, respectively, were stably expressed in control and TRIM26 knockdown Huh7 cells (Fig. 5B). The resulting cells were infected with HCVcc at MOI of 0.1, and HCV RNA level and NS3 protein expression at 48 hours after infection were measured. As shown in Fig. 5 (C and D), ectopic expression of hTRIM26 and tTRIM26 in the TRIM26 knockdown cells restored HCV replication, whereas ectopic expression of mTRIM26 did not restore HCV replication in the TRIM26 knockdown cells or exert a dominant-negative effect on HCV infection in Huh7 cells.

(A) Alignment of TRIM26 protein of different species. (B) Western blot analysis of reconstituted TRIM26 of different species in control and Huh7-TRIM26 knockdown cells. (C and D) The reconstituted TRIM26 cells were infected with HCVcc at MOI of 0.1 for the indicated time points. HCV NS3 protein expression (C) and RNA level (D) were analyzed at 48 hours after infection. (E) Huh7-TRIM26 knockdown cells reconstituted with hTRIM26, mTRIM26, and tTRIM26 were transfected with plasmids expressing FLAG-tagged NS5B. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (F) Western blot analysis of reconstituted mTRIM26-del expression in control cells and Huh7-TRIM26 knockdown cells. (G and H) The reconstituted TRIM26 cells were infected with HCVcc at MOI of 0.1 for the indicated time points. HCV RNA level (G) and NS3 protein expression (H) at 48 hours after infection were analyzed. (I) Huh7-TRIM26 knockdown cells reconstituted with hTRIM26, mTRIM26, or mTRIM26-del were transfected with plasmids expressing FLAG-tagged NS5B. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. The error bars represent SDs from two independent experiments. One-way ANOVA was used for statistical analysis. ns, P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. The protein levels were quantified by ImageJ, normalized against internal actin, and expressed as relative to control (C and H) or normalized against TRIM26 input protein level and expressed as values relative to immunoprecipitated FLAG-tagged protein level (E and I).

Next, we performed a co-IP assay to determine the interaction of NS5B and TRIM26 of different species. Huh7-TRIM26 knockdown cells reconstituted with hTRIM26, mTRIM26, and tTRIM26 were transfected with FLAG-tagged NS5B. As shown in Fig. 5E, NS5B interacted with hTRIM26 and tTRIM26, while it had very weak interaction with mTRIM26. The amino acid sequence alignment showed that there is a unique insert of six amino acids in mTRIM26 (located at 257262) but not in TRIM26 of human, chimpanzees, rhesus monkey, or tupaia (Fig. 5A and fig. S10). To determine whether this sixamino acid insert within mTRIM26 influences its function in HCV infection, we deleted it in mTRIM26 (designated mTRIM26-del) and stably expressed it in control and TRIM26 knockdown Huh7 cells (Fig. 5F). The resulting cells were infected with HCVcc at MOI of 0.1, and HCV RNA level and NS3 protein expression at 48 hours after infection were measured. As shown in Fig. 5 (G to H), in contrast to the full-length mTRIM26, mTRIM26-del reconstitution in TRIM26 knockdown cells partially restored HCV replication. Consistently, mTRIM26-del acquired the ability to interact with NS5B (Fig. 5I). Collectively, these results demonstrated that TRIM26 not only plays a role in HCV replication but also contributes to viral host tropism.

Last, we examined whether human TRIM26 can enhance HCV replication in murine hepatocytes that normally do not support HCV infection. For this purpose, we used a previously reported murine hepatoma cell line Hep561D7A7 that had been reconstituted with CD81, SRBI, CLDN1, OCLN, SEC14L2, and miR122, which are host factors essential for HCV infection (29). Hep561D7A7 and its parental control Hep561D cells were first transfected with hTRIM26 or mTRIM26 for 24 hours and then infected with Gluc-labeled HCVcc (JC1-Gluc) that can secret Gluc into culture supernatants upon infection. The expression of hTRIM26 and mTRIM26 was verified by Western blot (Fig. 6A). The culture supernatants at days 0, 1, 2, 3 after infection were harvested for the luciferase assay. As shown in Fig. 6B, hTRIM26 expression enhanced about eightfold HCV infection in Hep561D7A7 cells but not in Hep561D cells, while mTRIM26 had no effect in the both cells. To confirm this, we established Hep561D7A7 cells that stably express hTRIM26 by lentiviral transduction (designated Hep561D7A7-hTRIM26). The expression of hTRIM26 was identified by Western blot (Fig. 6C). Next, Hep561D7A7 and Hep561D7A7-hTRIM26 cells were infected with HCV and then analyzed by NS5A immunofluorescence staining. As shown in Fig. 6D, although the infection in the both cells was not very efficient, there were more HCV-positive cells in Hep561D7A7-hTRIM26 cells. Consistently, flow cytometry analysis showed that HCV infection was more efficient in hTRIM26-transduced Hep561D7A7 cells, and this increased HCV infection was more evident in the hTRIM26high expressing Hep561D7A7 cells (Fig. 6E). Together, these data suggested that hTRIM26 reconstitution enhances HCV infection in murine hepatocytes.

(A) Western blot analysis of hTRIM26 and mTRIM26 expression in Hep561D and Hep561D7A7 cells. (B) Hep561D and Hep561D7A7 cells transfected with hTRIM26 or mTRIM26 as well as Huh7 cells were infected with JC1-Gluc for the indicated time points. The culture supernatants were harvested for the luciferase assay. The error bars represent SDs from two independent experiments. RLU, relative light units. (C) Western blot analysis of hTRIM26 expression in Hep561D7A7 and Hep561D7A7-hTRIM26 cells. (D) Parental and hTRIM26-transuced Hep561D7A7 cells were infected with HCVcc for 72 hours and then stained with anti-NS5A antibody (red) for immunofluorescence microscopy. ZsGreen coexpressed in the same lentiviral vector with hTRIM26 was labeled green. The error bars represent SDs from the number of NS5A-positive cells in three wells from one representative experiment. t test was used for statistical analysis. ns, P > 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. (E) Parental, hTRIM26-transuced Hep561D7A7 cells, or Huh7 cells were infected with HCVcc for 72 hours and then stained with anti-NS5A antibody for flow cytometry analysis of HCV-positive cells. Meanwhile, ZsGreen-positive hTRIM26-transuced Hep561D7A7 cells (2.8% of total) were also analyzed.

Host factors participate in each step of the HCV life cycle. In this study, we performed a genome-wide CRISPR-Cas9 screen to uncover host factors crucial for HCV replication. A variety of host factors were identified from this screen, including the well-defined HCV entry factors CD81, OCLN, and CLDN1 (1416). PPIA has been shown to be critical for HCV replication and as a druggable target for HCV (17). ELAVL1 binds the 3 ends of the HCV RNAs and protects viral RNAs from degradation (18). The aforementioned candidates were also identified from a previous CRISPR-based screen, which was also performed in a hepatoma cell line (19). Besides, CSNK1A1 is responsible for NS5A hyperphosphorylation and crucial for viral production (30). DNA methyltransferase 1 (DNMT1), a key factor involved in establishing and maintaining DNA methylation, is also required for HCV propagation (31). Collectively, our CRISPR screening results are highly consistent with previous findings.

We found that TRIM26 is a critical host factor for efficient HCV replication. This conclusion is supported by multiple lines of evidence. First, deficiency of TRIM26 reduces replication of HCV from multiple genotypes (Fig. 2 and fig. S5). Second, TRIM26 specifically interacts with viral polymerase NS5B (Fig. 3 and fig. S7). Third, TRIM26 promotes K27-linked ubiquitination of NS5B at residue K51, which enhances its binding to NS5A, a critical interaction for assembly of viral replication complex (Figs. 3 and 4). The role of TRIM26 in HCV replication seems virus specific, as it is not involved in the life cycle of other closely related flaviviruses such as DENV and ZIKV (fig. S6). It is important to point out that TRIM26 knockout greatly diminishes HCV replication but does not completely abolish it. This implies that a possible redundant host function may compensate the TRIM26 deficiency.

Previous studies showed that TRIM26 plays a role in the regulation of antiviral IFN response (10, 11). Our results showed that neither IFNs nor ISGs were induced significantly in HCV-infected Huh7 cells (fig. S3). This observation was consistent with many previous studies demonstrating that HCV has multiple strategies to antagonize host innate immune responses (3234). There was no difference in the levels of IFNs or ISGs between the TRIM26 knockdown and control cells upon HCV infection, which further rules out the possibility that TRIM26 contributes to HCV replication via regulation of IFN signaling. In addition, TRIM26 was reported to function as a tumor suppressor of HCC, as TRIM26 knockdown promotes cell proliferation and metastasis (35). We found that TRIM26 knockdown had no effect on the cell viability of Huh7, a human HCC cell line (Fig. 1D).

Together with host factors, HCV nonstructural proteins form a membrane-associated replication complex, which is required for HCV genome replication. In this study, we found that TRIM26 binds NS5B, which requires both the SPRY domain of TRIM26 and the C-terminal region of NS5B (fig. S8). TRIM26-mediated ubiquitination of NS5B at residue K51 enhances the interaction between NS5B and NS5A and, in turn, enhances HCV genome replication (Figs. 3 and 4). As shown in fig. S9A, K51 is highly conserved among all HCV genotypes. In addition, we found K51 is 99.8% conserved among 2045 HCV sequences in the ViPR-HCV database, highlighting a critical role of this residue in the biological function of NS5B. NS5B functions as an RdRp, which that contains finger, palm, and thumb subdomains (3638). While the C-terminal thumb domain is required for the NS5B-TRIM26 interaction, residue K51 is located at the base of a finger loop, which is not essential for the interaction. However, there is an extensive interaction between the finger and thumb subdomains, leading to an encircled catalytic active site located in the central palm subdomain (3638). Therefore, we speculate that the finger and thumb interaction also serves as a platform for TRIM26-mediated ubiquitination of NS5B at residue K51. A cocrystal structure of NS5B and uridine 5-triphosphate (UTP) showed that K51 is adjacent to the triphosphate moiety of UTP and makes an electrostatic interaction with UTP (39). In addition, NS5B K51 has been shown to be a contacting residue with nascent RNA during RNA synthesis (40). Our result demonstrated that ubiquitination of NS5B at residue K51 is required for its interaction with NS5A (Fig. 4E). Future studies will be needed to investigate whether the NS5B K51 ubiquitination affects its contact with RNA substrates.

Humans are the sole known natural host for HCV infection. Although chimpanzees can be experimentally infected by HCV, it has become ethically difficult to use it as an in vivo model to study the virus and evaluate HCV vaccine candidates. In recent years, much progress has been made to develop small-animal models supporting HCV infection. Tupaia (also called tree shrew), a nonrodent small mammal, moderately supports HCV infection. However, its application for HCV animal model has been impeded by its outbred genetic background. Mice are excellent animal model for its inbred genetic background and related research tools but are not naturally permissive for HCV infection because of lack of critical HCV host factors (41). Reconstitution of human HCV entry factors in mice renders limited HCV infection (16, 42), raising a possibility that mice may still lack other HCV host factors. In our study, we found that human and tupaia TRIM26 are capable of supporting HCV replication, while mouse TRIM26 is not (Fig. 5B). Consistently, NS5B interacts with human and tupaia TRIM26, but not with mouse TRIM26 that contains a mouse specific sixamino acid insert. Deletion of this insert restores at least partially the ability of mouse TRIM26 to bind NS5B and to support HCV replication (Fig. 5, G and H). Although this sixamino acid insert (257262) is not located within the SPRY domain (294539) of TRIM26 that is required for its interaction with NS5B, its relative close proximity to the SPRY domain suggests that this extra insert may interfere with access of NS5B to the binding site of TRIM26. A more detailed structural analysis of the NS5B-TRIM26 complex is needed.

Expression of hTRIM26 can further boost HCV infection in Hep561D7A7 cells that have already been reconstituted with six critical human factors for HCV entry and replication (Fig. 6). This raises a possibility that introduction of hTRIM26 into a previously developed transgenic mouse model that expresses human HCV entry factors CD81, SR-B1, CLDN1, and OCLN (42) may further increase its permissiveness to HCV infection, an important step to develop a fully permissive small-animal model for HCV infection.

This study aimed to identify host factors essential for HCV infection by genome-wide CRISPR-Cas9 screening. Among the top candidates, TRIM26 was identified as a novel host factor for HCV infection. We then analyzed at which step of the HCV life cycle TRIM26 is involved and deciphered the underlying mechanism by which TRIM26 promotes HCV replication. Last, we compared the role of TRIM26 from different species in HCV infection and explored its potential roles in contribution to host tropism.

HEK293T and Huh7 cells were obtained from the Cell Bank of Shanghai Institute of Biological Sciences, Chinese Academy of Sciences. Huh7.5.1 cells were obtained from F. Chisari at Scripps Research Institute. Hep561D and Hep561D7A7 cells were obtained from A. Ploss at Princeton University. The cells were maintained in complete Dulbeccos modified Eagles medium (DMEM) (Invitrogen) supplemented with 10% fetal bovine serum, 10 mM Hepes, 2 mM l-glutamine, 100 U of penicillin/ml, and 100 mg of streptomycin/ml. All cells were cultured in humidified air containing 5% CO2 at 37C.

The coding sequences of human, mouse, and tupaia TRIM26 were amplified by PCR/RT-PCR from an hTRIM26-containing plasmid (provided by J. Han at Xiamen University), murine L929 cells, and tupaia liver tissue, respectively, using the following primers: hTRIM26 (forward: CGAAAATATCGAACGCCTCAAGGTGGACAAGGGCAGGC; reverse: GAGGCGTTCGATATTTTCGACCAGGCTGGCCAGTTGC), mTRIM26 (forward: GCGCTCGAGATGGCAGTGTCAGCCCCCTTGAGGAG; reverse: GCGTCTAGATCAGGGTCTCAGCAGAAGGCGTGCTC), and tTRIM26 (forward: GCGCTCGAGATGGCCACGTCAGCCCCTCTGCG; reverse: GCGTCTAGATCAGGGTCTCAGCAGGAGGCGTG). The amplified PCR products were cloned into pLVX-IRES-Puro vector or pLVX-IRES-zsGreen vector (Fig. 6, C to E). The plasmids expressing core, NS2, NS3, NS4B, NS5A, and NS5B contain a FLAG tag at the N terminus. The E1- and E2-expressing plasmids contain a signal peptide at the N terminus and a FLAG tag at the C terminus. The mutant TRIM26 and NS5B plasmids were made by homologous recombination using a Gibson assembly cloning kit [New England Biolabs (NEB), USA]. All the constructs were verified by DNA sequencing.

The amino acids of NS5B of different HCV genotypes were downloaded from the HCV database site map, and the number of the sequences from each genotype is listed in fig. S9. The conservation and location of NS5B lysine residues among different HCV genotypes were analyzed by Vector NTI and PyMOL, respectively.

The human whole-genome sgRNA library that consists of approximately 180,000 sgRNAs that target 19,271 genes was designed. sgRNA oligos were synthesized (CustomArray), and the sgRNA-coding DNA fragments were amplified with PCR from the synthesized oligos with primers flanking the sgRNA target sequences. The amplified sgRNA-coding DNA fragments were purified (DNA Clean & Concentrator TM-5 Kit, Zymo Research) and ligated into the lentiviral vector expressing green fluorescent protein (GFP) by Golden Gate Assembly. The plasmids were transformed into trans1-T1 competent cells. The plasmid library was packaged into pseudotyped lentiviral particles by cotransfection with pCMVR8.74 and VSV-G (glycoprotein of vesicular stomatitis virus) plasmids. Huh7.5-NIrD, a reporter cell line described in (12), was transduced with lentiviral vectors at MOI of 0.3, and GFP-expressing cells were enriched by fluorescence-activated cell sorting (FACS) (BD FACSAria III), which were ready for the following screening experiments after cell culture for 2 weeks.

The cell library was equally divided into two parts: the reference and experimental groups. The genomic DNA from the reference group was extracted, and the sgRNA-coding sequences integrated into chromosomes were amplified by PCR, followed by next-generation sequencing (Illumina HiSeq 2500). The cells of the experimental group were infected with HCVcc at MOI of 0.1 for 30 days, during which most cells died due to HCV replication. After that, mCherry-negative cells were enriched again by FACS in the presence of doxycycline (1 g/ml). The sgRNA sequences from the mCherry-negative cells were decoded by deep sequencing. Comparison of sgRNA abundance between the experimental group and the reference group was analyzed by the RIGER algorithm. The low count reads (less than 10) were filtered out.

The following three sgRNA sequences were used for the TRIM26 knockdown via CRISPRi (43) (sg1: GCGGCACCCCTCCTCTCTCA; sg2: GGAATAGCCGGGAGATTACG; sg3: GCTCGTGCAGGAGCGGGACC). The sgRNA targeting AAVS1 transcription start site (TSS) region was used as control (AAVS1 sg: CGGAACCTGAAGGAGGCGGC). The sgRNAs were cloned into a lentiviral vector expressing GFP and later packaged into VSV-G pseudotyped lentiviral particles by cotransfection with pCMVR8.74 and pVSV-G plasmids into HEK293T cells. Meanwhile, the KRAB-dCas9-P2A-mCherry (Addgene, #60954) vector was also packaged by cotransfection with pCMVR8.74 and pVSV-G plasmids. Huh7 cells were then transduced with both pseudotyped lentiviral vectors that express sgRNA and KRAB-dCas9-P2A-mCherry. Three days after transduction, the GFP and mCherry double-positive cells were sorted by FACS and further cultured. The knockdown efficiency of TRIM26 was measured by Western blot.

Oligonucleotides (TRIM26 oligo F: ACCGTGTGGCAACTGGCCAGCCTGG and TRIM26 oligo R: AAACCCAGGCTGGCCAGTTGCCACA) of TRIM26 sgRNA were synthesized (Ruibiotech) and annealed in 50 l of TransTaq HiFi Buffer II at a final concentration of 9 M. The annealed oligos were ligated into a lentiviral vector bearing a puromycin selection marker with Golden Gate Assembly (NEB). The ligation products were then transformed into Trans1-T1 competent cells (Transgen, CD501). Pseudotyped lentiviral vectors expressing sgRNA were generated by cotransfection of a vector expressing the VSV-G, pCMVR8.74 (containing lentiviral gal/pol), and the lentiviral vector expressing sgRNAs. Huh7.5.1 cells were transduced with the pseudotyped lentiviral vectors expressing sgRNA and selected with puromycin (1 g/ml). The single-cell clones resistant to puromycin were selected. Genomic DNA were extracted from the single-cell clones, and the insertions and deletions (indels) caused by sgRNA/Cas9 in each cell clone were confirmed by Sanger sequencing after PCR amplification.

The protocols and sequences of primers for quantifying HCV RNA, human IFN-, MxA, ISG56, and actin were described previously (34). The cells were lysed in TRIzol (Tiangen), and RNA was isolated according to the manufacturers protocol. The cDNA was synthesized using the ReverTra Ace qPCR RT kit (Toyobo). RT-qPCR was performed using quantitative PCR SYBR green RT-PCR master mix (Toyobo). The sequences of the primers targeting DENV and ZIKV were as follows: ZIKV, CAACTACTGCAAGTGGAAGGGT (forward) and AAGTGGTCCATATGATCGGTTGA (reverse); DENV, ACAAGTCGAACAA CCTGGTCCAT (forward) and GCCGCACCATTGGTCTTCTC (reverse). The expression of target genes was normalized to actin.

The JC1-GLuc virus was constructed as previously described (44). The GLuc gene and an autocleaving peptide 2A were inserted between p7 and NS2 of the JC1 cDNA clone. HCVcc, ZIKV, and DENV preparation and titration were as previously described. Briefly, 1 105 Vero cells were seeded in a 24-well plate for 24 hours, then washed with phosphate-buffered saline (PBS), and infected with the serially diluted ZIKV for 1 hour. Viral inoculations were replaced with 1.2 ml of DMEM containing 1.5% fetal bovine serum and 1% carboxymethyl cellulose sodium salt. Viral plaques were developed at day 4 after infection. Huh7.5.1 (1 104) cells were seeded in a 96-well plate and infected with serially diluted DENV for 72 hours. The cells were fixed with 4% paraformaldehyde and incubated with a monoclonal antibody against DENV envelope protein (clone D1-4G2-4-15; Millipore) followed by incubation with Alexa Fluor 488conjugated secondary antibody and Hoechst 33258. The stained cells were analyzed by fluorescence microscopy.

HCVpp were generated as previously described (22). HEK293T cells were cotransfected with plasmids expressing HCV envelope glycoproteins, retroviral core packaging component, and luciferase. Supernatants were collected 72 hours later and filtered through 0.45-M pore size membranes. For infection, targeted cells were seeded in 96-well plates and infected with HCVpp. At 72 hours after infection, the firefly luciferase activity was measured by luciferase assay according to the manufacturers instructions (Promega).

HEK293T cells were cotransfected with indicated plasmids and lysed in NP-40 buffer containing 50 mM tris-HCl (pH 7.5), 150 mM NaCl, and 0.5% NP-40, with protease inhibitor (Sigma-Aldrich) at 48 hours after transfection. The cell lysates were centrifuged at 10,000g at 4C for 10 min, and supernatants were transferred to new tubes and incubated with normal immunoglobulin G (Santa Cruz Biotechnology) as well as protein A/G agarose beads at 4C for 30 min to eliminate nonspecific binding proteins. After centrifugation at 1000g at 4C for 5 min to remove the protein A/G agarose beads, the supernatants were incubated overnight with specific primary antibody at 4C and then with protein A/G agarose beads for an additional 2 hours. The samples were collected by centrifugation at 1000 g at 4C for 5 min, washed with NP-40 buffer for four times, and then resuspended in 40 l of loading buffer for Western blot.

The protocol was as described previously (34). The following antibodies were used: anti-FLAG (Sigma-Aldrich); anti-HA and anti-actin (Abmart); anti-TRIM26 antibody, goatanti-mouse horseradish peroxidase (HRP) antibody, and goatanti-rabbit HRP antibody (Santa Cruz Biotechnology); monoclonal antibodies against HCV NS3 and NS5A (generated by J. Zhongs laboratory); and anti-DENV E protein (D1-11, Abcam).

The protocol was as described previously (45). A BioLux Gaussia luciferase assay kit (NEB) was used to measure the GLuc activity.

Hep561D7A7 cells (1 104) were seeded in a 96-well plate and infected with HCV for 72 hours. The cells were fixed with 4% paraformaldehyde and incubated with a monoclonal antibody against HCV NS5A followed by incubation with Alexa Fluor 555conjugated secondary antibody and Hoechst 33258. The stained cells were analyzed by fluorescence microscopy.

HEK293T cells transfected with the indicated plasmids were seeded on 14-mm-diameter glass coverslips for 48 hours. The cells were washed with PBS and fixed with paraformaldehyde for 1 hour. Then, the cells were incubated with the primary antibody for 1 hour followed by incubation with the secondary antibody conjugated with Alexa Fluor 488 (Invitrogen) or Alexa Fluor 555 (Invitrogen). Images were acquired with an Olympus FV1200 laser scanning confocal microscope (Olympus, Tokyo, Japan) and analyzed using ImageJ software. Pearsons coefficiency functioned as the indicator of colocalization.

Huh7 and Huh7-TRIM26 knockdown cells were seeded in a 96-well plate for 72 hours. Then, luminescent signal was acquired for cell viability analysis using the CellTiter-Glo 2.0 assay.

Hep561D7A7, Hep561D7A7-hTRIM26, and Huh7 cells were infected with HCV for 72 hours. The cells were fixed with 4% paraformaldehyde and incubated with permeabilization buffer. Next, the cells were incubated with a monoclonal antibody against HCV NS5A followed by incubation with Alexa Fluor 555conjugated secondary antibody. The cells were analyzed by flow cytometry. For each staining, at least 5000 events were collected for analysis. The FlowJo software was used for HCV-positive cell analysis.

Statistical analysis was performed using GraphPad Prism 8 software. Students t test was used for analyzing the difference between two groups, and one-way analysis of variance (ANOVA) followed by Tukey post hoc test was used for analyzing the differences among groups of more than three. Not significant (ns), P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Acknowledgments: Funding: This study was supported by the grants from the Strategic Priority Research Program of the Chinese Academy of Sciences (XDB29010205, to J.Z.); the National Natural Science Foundation of China (31670172, to J.Z.; 31930016, to W.W.; 31670169, to Z.Z.; and 31770189, to Y.T.); the support from Beijing Municipal Science and Technology Commission (Z181100001318009), the Beijing Advanced Innovation Center for Genomics at Peking University, and the Peking-Tsinghua Center for Life Sciences to W.W.; the West Light Foundation of the Chinese Academy of Sciences (xbzg-zdsys-201909) to J.Z.; and the Natural Science Foundation of Guangdong Province (2019A1515110668) to G.Z. Author contributions: J.Z., W.W., and G.Z. conceived and designed the study. Y.L., G.Z., and Q.L. designed, performed, and analyzed the experiments. L.H. and Y.X. contributed to the DENV and ZIKV infection experiments. Y.G. and G.Z. performed the bioinformatics analysis. X.H., X.Z., and Q.D. contributed to the establishment of murine hepatoma cells. W.T., M.G., T.G., Y.T., and Z.Z. participated in data analysis. Y.L. and G.Z. drafted the manuscript. All authors contributed to and revised the final version of the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read the original post:
TRIM26 is a critical host factor for HCV replication and contributes to host tropism - Science Advances

Recommendation and review posted by Bethany Smith

It goes without saying that 2020 was a challenging year for the food industry. A worldwide pandemic that wreaked havoc on food supply chains, forced the permanent closure of thousands of restaurants worldwide, and pushed millions of people deeper into food insecurity showed us just how fragile the systems that keep us nourished and fed are.

But its also the recognition of this fragility thats led to an increasing sense of urgency to invest in the future of food. The good news is the timing couldnt be better. We are at a culmination point in the fields of bioengineering, chemistry and food science where decades of hard work and progress have allowed ideas that once seemed the domain of science fiction to leap into the labs and, now and in the not-to-distant future, onto our plates.

And while 2020 was a year of unprecedented progress across our food system, I expect 2021 to be even more impactful. Below are four predictions for some of what we could see this year.

Cultured Meat Milestones Will Accelerate

Throughout 2020, announcements of milestones for cultured meat flowed with increasing regularity. New prototypes of practically every type of meat ranging from chicken to beef to kangaroo debuted, heads of state and other famous folks got their first tastes of lab-grown meat, and at the end Eat Just announced the first regulatory approval and retail sale of cultured chicken in Singapore.

And well see even more milestones this year. Investment will grow and excitement will build as more companies move out of the labs and into early pilot production facilities for their cultured meat products. Other countries will follow Singapores lead and give regulatory green light for the sale of cultured meat. And finally, well see the debut of more cultured meat products in high-end cuisine as chefs look to achieve similar firsts for their restaurants. We may even see the rollout of cultured meat in some select experiential, high-end retail.

Fermentation Powers Growth in Exciting New Consumer-Facing Products

One of the of most exciting areas in the future of food is microbial fermentation. High-volume production of interesting new biomass proteins such as mycelium-based meat replacements and the arrival of animal-free proteins, fats and other compounds created using precision fermentation helped illustrate why the Good Food Institute called fermentation the third leg of the alternative protein market.

Looking forward, you can expect lots of new products to debut powered by precision fermentation in 2021. MeliBio, a maker of bee-free honey, expects to debut their first product in 2021, while Clara Foods plans to release its animal-free egg this year as well, and I expect to see more companies like Brave Robot rise up and offer new products built around precision fermented food platforms created by companies like Perfect Day.

CRISPR and Gene-Edited Food See Accelerated Product Pipelines

There was big news in the CRISPR and gene-edited food realm in December when the USDA proposed a change in the regulatory oversight of gene-edited animals for human consumption. The organization proposed that they take over oversight responsibility for approving gene-edited animal products from the FDA which, in 2018, famously declared that gene-edited animals should be regulated in the same manner as drugs.

Under a new USDA regulatory framework, the organization is proposing a fairly light regulatory approach to animals compared to the previous oversight of the FDA, which in turn could speed up time to market for new products. While there has been lots of focus on CRISPR-derived future food innovation, I expect changes to US regulatory oversight of gene-edited animal products to create a wave of new interest in developing CRISPR-based product lines from both startups and established food product companies.

Finally, the US may not be the only market to see a change in oversight for gene-edited food. The UK is looking to extract itself from the heavier-handed oversight of the EU post-Brexit, and some in Europe are suggesting that the EUs classification of all gene-edited food as GMO might be overbroad and need adjusting.

3D Food Printing Moves Beyond the Cake

While 3D food printing has largely been relegated to the world of confections and cake decorating, a world with food replicators from the pages of science fiction novels seems to be inching closer to reality.

Companies like Redefine Meat are making high-volume plant-based meat printers and plan to have meat in supermarkets in a year, while others like Meat-Tech are showing off prototypes of cultured meat printers. One of the challenges for food printing will be scaling the technology to make it quicker, something Novameat is working on as it begins to enter commercial rollout phase of its plant-based meat printing technology. On the consumer front, while I dont expect the food printers to start printing out Jamie Oliver recipes this year, companies like Savoreat are working on commercializing products for the professional space with the end-goal of eventually creating a home consumer food printer like the one you might see in a show like Upload.

Finally, these advances and technologies do not happen in a vacuum. The future of food is reliant on a multitude of new innovations and technologies. CRISPR, precision fermentation and 3D food printing are just some of the tools being interwoven and utilized together to help bring innovative new products to cultured, plant-based and other emerging food markets.

While we dont know what 2021 will hold for us with any certainty, what we can be certain of is that progress in these important building blocks for the future of food will continue to march forward.

Related

Read more:
Four Predictions for the Future of Food in 2021 - The Spoon

Recommendation and review posted by Bethany Smith

This report outlines the investigative study that was conducted by a team of world renowned scientists, doctors including Hyuck Hoon KWON, Steven Hoseong YANG, Joon LEE, Byung Chul PARK, Kui Young PARK, Jae Yoon JUNG, Youin BAE,and Gyeong-Hun at Oaro Dermatology Institute (Seoul, South Korea), Guam Dermatology Institute (Guam, USA), Department of Dermatology, Dankook University, College of Medicine (Cheonan, South Korea), Department of Dermatology, Chung-Ang University, College of Medicine (Seoul, South Korea), and Department of Dermatology, Dongtan Sacred Heart Hospital, Hallym University College of Medicine (Hwaseong, South Korea). Researchers involved in this study evaluated the clinical efficacy and safety of adipose tissue stem cell-derived exosomes as an adjuvant therapy after application of fractional CO2laser for acne scars. 25 patients consisting of 18 men and 7 women, between ages 19 and 54, 12 with Fitzpatrick Skin Type 3 and 13 with Fitzpatrick skin type 4 and atrophic acne scars, underwent the 12-week prospective, double-blind, randomized, split-face trial. Each received three consecutive treatment sessions of fractional CO2laser to the whole face, with a follow-up evaluation, and a post- laser split face regimen, where one side of each patient's face was treated with an adipose tissue stem cell-derived exosome gel. Exosomes in this study were acquired from human ASC-CM by ExoSCRT technology developed by ExoCoBio Inc., and the other side of the face was treated with control gel. Findings revealed that the adipose tissue stem cell-derived exosome-treated sides of the face had achieved a significantly greater improvement than the control sides at the final follow-up visit (percentage reduction in echelle d'evaluation clinique des cicatrices d'acne scores: 32.5 vs 19.9%, p<0.01). Treatment-related erythema was milder, and post-treatment downtime was shorter on the applications of human adipose tissue stem cell-derived exosome-treated side.

The investigative study proved that a variety of applications of human adipose tissue stem cell-derived exosomes can serve as a novel cell-free therapeutic strategy in the regenerative and aesthetic medical fields and demonstrated the suitability of adipose tissue stem cell derived exosomes as an adjuvant treatment modality in combination with fractional carbon dioxide laser for the treatment of acne scars.

This reportis an open access article under the CC BY-NC license Society for Publication of Acta Dermato-Venereologica.

"The science is clearly demonstrating that exosomes are the wave of the future not just for aesthetics but for many other areas of medicine, and the richest source of this material, by far, is adipose tissue," says Dr. Randy Miller, M.D., F.A.C.S.

Facial atrophic acne scarring is a psychologically damaging condition that can cause emotional, mental, and social disability. "With a huge percentage of the world population struggling with this condition, the need for widening of therapeutic options was astoundingly clear," says Dr. Diane Duncan, M.D., F.A.C.S. who added, "While ablative fractional carbon dioxide laser resurfacing has demonstrated clinical efficacy in acne scar treatments, patients have sustained side-effects during post-procedural wound healing and had demanded improvement. The adjuvant application of adipose-derived stem cell conditioned medium with synergistic effects in augmenting treatment responses and reducing adverse effects through its potential to accelerate tissue rejuvenation is a victory for those suffering."

The sentiments have been echoed by so many other medical professionals, including, Dr. JD McCoy, NMP, whose patient roster includes professional athletes who do not have time for extended downtime and need to recover fast. "Since implementing the addition of Exosome Regenerative Complex powered by ExoSCRT into my protocol, I've observed a significant improvement in the speed of healing, skin quality and comfort during recovery," said Dr. Richard Jin, M.D., PhD. "Patients suffering from acne scarring range in all ages, and the pain that they feel is very real. Ensuring that my patients receive the best treatment results with the least amount of downtime and discomfort is non-negotiable, and that's why I choose to integrate Exosome Regenerative Complex powered by ExoSCRT, into all of my treatments."

Exosomes are lipid bilayer-enclosed extracellular vesicles, 30200 nm in diameter, produced by almost all cells and present in all body fluids (810). They are regarded as an essential mediator of intercellular communication by transferring proteins and genetic material between cells. Several studies have shown that mesenchymal stem cell-derived exosomes carry the essential properties of mesenchymal stem cells suggesting that exosomes may be a compelling alternative in regenerative and aesthetic medicine, as they would avoid most of the problems associated with live mesenchymal stem cell-based therapy. Interestingly, recent studies have shown that human adipose tissue stem cell-derived exosomes possess the critical properties of stem cells and are as potent as mesenchymal stem cells in the repair of various organ injuries.

BENEV's Exosome Regenerative Complex powered by ExoSCRT was developed and designed in tandem with the 4th largest exosome research company in the world, ExoCoBio. The intensive dual action complex is quickly absorbed into the skin, delivering the concentrated power of over 2.5 billion lyophilized exosomes, potent growth factors, peptides, co-enzymes, minerals, amino acids and vitamins. The paraben-free, steroid-free, and hypoallergenic patented technologies and ingredients are clinically proven to rejuvenate and regenerate the skin. "Lyophilizing exosomes maximize topical therapeutic potential. Making them ideal for treatments," says Dr. Richard Goldfarb, M.D., F.A.C.S.

ExoCoBio's ExoSCRT, is an innovative patented purification method of separating and refining 0.1 pure exosomes from stem cell conditioned media. The concentration of materials is significantly greater than what can be achieved with a product such as PRP. Studies have shown that this product increases fibroblast production by 180% and collagen production by 300%.

BENEV Company Inc. Medical Advisory Board Members:

Richard Jin, MD, PhD, BENEV's Chief Medical Director, studied at the Boston University School of Medicine, Harvard Medical School and the University of California Irvine. He completed research in the areas of cardiovascular disease, pulmonary hypertension, antioxidant enzyme properties, cell signaling, cellular redox mechanisms, free radical-induced oxidant stress, platelet biology, growth factors, and wound healing. For more information visitwww.rjclinicalinstitute.com

Richard M. Goldfarb, M.D, F.A.C.S., graduated from the University of Health Sciences /Finch University, The Chicago Medical School with top honors in Surgery. He completed his surgical training atNortheastern Ohio College of Medicine. He did additional training in cosmetic surgery at theUniversity of Pennsylvania, Department of Plastic Surgery andYale University. Dr. Goldfarb's 30 years of combined experience in General, Vascular, and Cosmetic Surgery provides his patients with the surgical expertise they are seeking. Dr. Goldfarb established the Center for SmartLipo & Plastic Surgery in 2007. For more information visitwww.centerforsmartlipo.com

Diane I. Duncan, M.D., F.A.C.S., obtained her medical degree from the Tulane University School of Medicine. She is certified by the American Board of Plastic Surgery and is a member of several plastic surgery professional societies, including the American Society of Plastic Surgeons (ASPS), the American Society of Aesthetic Plastic Surgeons (ASAPS) and the International Society of Aesthetic Plastic Surgeons (ISAPS). In addition to these affiliations, Dr. Duncan is a fellow of the American College of Surgeons (ACS). Dr. Duncan joined our Medical Advisory Board with over 30 years of experience in private practice as a plastic surgeon. She is an internationally recognized speaker and educator in plastic surgery and has delivered presentations at industry conferences around the world. She has also authored medical journal articles on a variety of subjects in plastic surgery and currently serves as a member of the editorial review board for theAesthetic Surgery Journal. For more information visit http://www.drdianeduncan.com

Randy B. Miller, M.D., is a board certified cosmetic and reconstructive plastic surgeon practicing in Miami, Florida. Dr. Miller earned his Bachelor of Arts in psychology and a Master's degree in clinical immunology and completed medical school at Jefferson Medical College where he graduated at the top of his class. He completed his training in general surgery and otolaryngology - head and neck surgery at Thomas Jefferson University Hospital in Philadelphia. Dr. Miller performed his plastic surgery training at Baylor College of Medicine located within the Texas Medical Center in Houston, which is the largest medical center in the world. Dr. Miller is a former president of the Miami Society of Plastic Surgeons, the Florida Society of Plastic Surgeons, and the Plastic Surgeons Patient Safety Foundation. Having served five consecutive terms on the Board of Directors of the Dade County Medical Association and as a delegate to the Florida Medical Association, Dr. Miller is a member of, and has received presidential appointments from, the American Society of Plastic Surgeons. In addition to his role as a clinical professor in the Division of Plastic Surgery at the University of Miami, Dr. Miller serves as a plastic surgery resident mentor. For many years he has served as the liaison between the University of Miami, Division of Plastic Surgery, and the Miami Society of Plastic Surgeons. Based on his research, publications and 25 years of clinical experience, Dr. Miller has become an internationally recognized expert in the fields of stem cell research and therapy, including human and veterinary tissue regeneration. Dr. Miller provides a uniquely comprehensive approach to aesthetics and age management. For more information visit http://www.millerplasticsurgery.com

Dr. J.D. McCoy, NMP, received his doctorate in Naturopathic Medicine at the Canadian College of Naturopathic Medicine. He is one of the most accomplished naturopathic physicians practicing aesthetic medicine in the country. He completed an internship in internal medicine in Hawaii, and began specialized training, certification, and externship in cosmetic medicine and light-based therapies. Dr. McCoy has devoted his specialization, passion and his entire practice to the art of less-invasive cosmetic rejuvenation, weight-management, and natural bio-identical hormone therapy since 2003. Dr. McCoy's principles in the practice of aesthetic medicine include prevention, the use of natural substances (light/energy, nutrients and other natural substances), and the use of the least invasive treatments possible. Dr. McCoy finds innovative solutions that reduce or eliminate the need for more invasive surgery- beautiful results naturally. He is recognized as an innovator and physician trainer for multiple technologies and techniques in cosmetic medicine including but most certainly not limited to a Physician Member: American Academy of Cosmetic Surgery, American Academy of Aesthetic Medicine, American Society of Aesthetic Mesotherapy, International Federation for Adipose Therapeutics and Science. For more information visitwww.contourmedical.com

BENEV Company Inc.1-949-457-2222 http://www.BENEV.com

SOURCE BENEV

http://benev.com/

Read more from the original source:
BENEV Announces Investigative Report on Combination Treatment with Human Adipose Tissue Stem Cell- derived Exosomes and Fractional CO2 Laser for Acne...

Recommendation and review posted by Bethany Smith

The quest for CAR-T 2.0 is gaining an mRNA player, as Cambridge, Massachusetts-based Factor Bioscience sends a spinoff racing toward the clinic.

Factor drew the curtains on Exacis Biotherapeutics on Wednesday morning, with Sollis Therapeutics co-founder Gregory Fiore at the helm of a small immuno-oncology focused team built around Factors technology. The spinoff has the rights to 51 patents and just a bit of seed money from friends and family to get it going but Fiore says an IND submission is on the horizon.

We are 18 to 24 months from an IND submission, and weve identified our first target, which will be CD19, Fiore told Endpoints News.

The company will be unveiling a CD19-targeted CAR-T and CAR-NK, Fiore said, with ROR1 as its next target.

The CEO says Exacis approach is what differentiates it from others in the crowded cell therapy field, beginning with mRNA technology in-licensed from Factor. The process starts with induced pluripotent stem cells (iPSC), which are blood or skin cells that have been engineered back into an embryonic-like stem cell state. Theyre created with mRNA reprogramming, and then edited to avoid host immune surveillance, add a CAR and enhance the cells for potency against tumors.

That iPSC is quite a robust cell. It can handle a lot of editing and the cells are able to recover from a lot of editing and manipulation, Fiore said. And the fact that no viruses or DNA are used significantly decreases the resource requirement for manufacturing, he added later.

The idea of an off-the-shelf CAR-T or CAR-NK therapy as opposed to harvesting a patients cells, engineering them into a cancer attack vehicle and reinjecting them isnt a new one. Allogene released a positive snapshot of their off-the-shelf CAR-T program at ASCO 2020, and CRISPR Therapeutics offered a glimpse at their own CAR-T success in October although it was clouded by the death of a patient given a high dose of the treatment.

Exacis team of four including co-founder James Pan and former MaxiVAX CEO Dimitrios Goundis as CBO is shooting for a Series A in the coming months to bolster its team and pipeline. The company also says its in talks with several potential development partners.

We are working towards a Series A funding to be completed in Q1 of 2021, and well use those funds to build out our internal team and lab, as well as further the development along the lines of differentiation into T and NK, obtaining CARs, really putting together these target cell types, Fiore said.

While Fiore stayed mum about the the specific terms of Exacis licensing deal with Factor, he said that Factor has a majority ownership in exchange for the execution of the license.

The CEO, who was inspired to get into the field by his fathers battle with cancer, said Factor and Exacis incentives were aligned. Theres plenty of opportunity to improve the patient experience as well as outcomes, he said.

See more here:
Factor Bioscience spins out a new cell therapy player with eyes on the clinic within 2 years - Endpoints News

Recommendation and review posted by Bethany Smith

Oxygen therapy is available at many ski lodges situated at high altitudes. Many athletes, skiers and mountain climbers swear by the treatment they get at oxygen bars, and insist it improves workout performance, reduces fatigue and helps overcome jetlag. Skin care formulators can, apparently, take advantage of oxygen therapy, too, and according to Dr. Norman Edelman, scientific advisor at the American Lung Association, for the most part, these treatments are safe and harmless.

Oxygen has been found to be an important component in skin rejuvenation, treatment of photoaging skin and improvement in skin complexion. Oxygen is the safest drug when administered by trained professionals. The interest in the use of hyperbaric oxygen therapy (HBOT) for this purpose is growing and becoming widespread. Applying the simple laws of physics, HBOT is safe and non-invasive therapy and is the most trusted to increase oxygen levels to all organs of the body. It is a therapy trusted by both health professionals and alternative specialists. It is a non-pharmaceutical, natural therapy with amazing healing and regenerative properties. This is the reason why some superstar athletes, celebrities and health innovators use it and many of them have hyperbaric chambers installed in their homes. Because HBOT heals from within, it is an ideal therapy for healing wounds after injury or surgery.

An average HBOT session is mostly safe and painless. The typical treatment lasts 60 to 90 minutes, during which time you relax in the pressurized chamber and you breathe normally. You may experience a feeling similar to flying in a plane or diving. Air pressure must be equalized in the ears during the 15-minute compression and decompression phases by either swallowing or yawning. Oxygen is used in skin care because it is thought that delivery of natural oxygen increases cell metabolism.

According to market research firm Grand View Research, the hyperbaric oxygen therapy equipment market size is expected to approach $4 billion by 2025. More skin care clinics rely on oxygen therapy to rejuvenate skin and reduce elasticity loss that leads to lines and wrinkles. The oxygen facial, on the other hand, is a high-pressure blast of oxygen with a few beauty actives in it, with the goal of plumping and smoothing skin. The treatment instantly firms and lifts using hyperbaric technology to saturate the skin with oxygen and infuse a rejuvenating hyaluronic acid serumbut it could potentially be achieved using normal compressed air. The term oxygen sounds scientific, pure and expensive. It is worth noting that, according to Dermatologist Leslie Baumann, many active ingredients that are used as buzzwords in skin care, including oxygen, stem cells and hyaluronic acid, cannot even penetrate the skin, which makes them useless.

This column examines skin rejuvenation and the aging process. Behnke and Shaw used hyperbaric oxygen in 1937 to treat decompression sickness, which began the modern era of hyperbaric oxygen therapy.1 This type of therapy uses oxygen and air pressure to treat many different sicknesses and injuries from open wounds and burns to certain types of poisonings and circulation issues. Pressure makes all the difference. Under pressure, oxygen is dissolved in larger quantities in the blood plasma itself, not just the red blood cells. That means a much higher amount of the gas is transported into tissues that need it for healing. You probably would need a few treatments to see the benefit. This environment allows for oxygen to dissolve and saturate circulation system delivering a high concentration of oxygen to all cells and tissues. The powerful oxygenation boosts microscopic blood vessel growth. Hypoxic tissue or low oxygen levels can lead to aging and eventual cell death. This feature is a common component in most major health conditions.

A clinical study evaluated whether HBOT affects telomere length (TL) and senescent cell concentrations in normal, non-pathological aging adult population, or the research targeted specific cells and DNA linked to shorter lifespans. This first-of-its-kind study was conducted by Professor Shai Efrati of the Sackler School of Medicine and Sagol School of Neuroscience at Tel Aviv University, Israel,2 as part of a comprehensive Israeli Research Program that targets aging as a reversible condition. With this pioneering study, Efrati opened a door for further research on the cellular impact of HBOT and its potential for reversing the aging process of elderly people through oxygen therapy. Researchers around the world are trying to develop pharmacological and environmental interventions that could enable telomere elongation, as shorter telomeres are linked to diseases like dementia and cancer. Until now, interventions such as lifestyle modifications and intense physical exercise have shown very little inhibiting effect on telomere shortening.

According to Efrati, telomere shortening is considered the Holy Grail of biology of aging. Aging is characterized by the progressive loss of physiological capacity. There are two major processes that contribute to human aging. First, the telomeres which are protective regions at the end of every chromosome, start to shorten. Second, old and malfunctioning cells accumulate in the body. These are called senescent cells whose lifecycle has come to an end. In the normal scheme of things, such cells are eliminated from the body by the immune system. But in some cases, this fails to happen and they accumulate in tissues while remaining metabolically active, with potentially serious consequences for health, though scientists are not sure why. Importantly, senolytics, which are anti-aging drugs that remove these harmful cells from our bodies, could treat a range of diseases that plague the elderly. This class of small molecules can selectively induce death of senescent cells and improve health in humans. These agents delay, prevent, alleviate or reverse age-related diseases. A related concept is senostatic, which means to suppress senescence. Senescence is naturally initiated in cells as they age.

When cells are damaged beyond repair, they enter a protective state known as senescence, in which they cease dividing. It is triggered by the shortening of telomeres, which become shorter with each successive DNA replication. After a certain point, this replication of DNA ceases, and the cell stops dividing before dying a natural death. Scientists have recently shown that stress leads to an acceleration in cellular aging by intensifying this telomere shortening. At the cellular level, two key hallmarks of the aging process include telomere length shortening and cellular senescence.

Repeated intermittent hypoxic exposures using certain hyperbaric oxygen therapy (HBOT) protocols, can induce regenerative effects which normally occur during hypoxia. Efratis HBOT protocol was able to achieve this, proving that the aging process can, in fact, be reversed at the basic cellular-molecular level. In this clinical study, only three months of HBOT was able to elongate telomeres at rates far beyond any currently available interventions or lifestyle modifications. In this study, 35 healthy independently living adults, aged 64 and older, received 60 daily HBOT exposures. Whole blood samples were collected at base line, at the 30th and 60th session, and 1-2 weeks following the last HBOT session. This intermittent increasing of oxygen concentration induces many of the mediators and cellular mechanisms needed for regeneration.

Efrati maintains that this fluctuation of oxygen induces a regenerative mechanism that is usually induced during hypoxia, a lack of oxygen, but this therapy protocol fools the body into a state of hypoxia without it being hazardous. This protocol was tried on healthy adults because, as people age, blood vessels carry less oxygen and according to him, hyperbaric treatment compensates for this lack of oxygen. Telomere lengths and senescence were assessed. In conclusion, the study indicates that HBOT may induce significant senolytic effects including significantly increasing telomere length and clearance of senescent cells in the aging populations. Researchers found that the pressurized sessions reduced senescent cells, which cause tissue and organ deterioration, by up to 37%.

Reflecting on this study, a professor of psychology who was not involved in the study, Dr. Hillel Aviezer of Hebrew University of Jerusalem, noted that it was an interesting study with some promising preliminary outcomes. However, there is still room for caution in interpreting the results. Specifically, the control group did not undergo any intervention while hyperbaric oxygen therapy (HBOT) group experienced a highly intense protocol of meetings for multiple days a week, across several months. The HBOT groups weekly structured meetings, social interactions with testers and natural placebo effects may have all contributed to the improved attention and processing speed found in the results. Still, the study provides a nice step forward, and will hopefully trigger future work with more tightly controlled, double-blind experimental designs.

HBOT is an FDA-approved medical treatment that enhances tissue levels of life-saving oxygen. Hyperbaric chambers are found around the world to treat conditions including decompression sickness, air embolisms and thermal burns. The FDA has cleared the therapy for these three conditions and 10 others, but urges people to consider other claims with caution, and warns that use of the chambers can carry risks of joint pain and even paralysis. It raised concerns that hyperbaric therapy has been touted as a universal treatment.

This life changing revolutionary research has successfully treated two significant hallmarks of aging. In the future, hopefully, this promising innovation will prove to be effective in a double-blind clinical trial. This research could potentially keep seniors vital and healthy as long as they live.

References:1. Power of pure oxygen, Dr. Hirschenbein, Healthy Aging 5/9/2007.2. Hyperbaric Oxygen Therapy, Prospective Trial, Dr. Sai Efrati et al. Tel Aviv University, Israel. News Release.

Originally posted here:
Breakthrough Oxygen Therapy Reverses The Aging Process - happi.com

Recommendation and review posted by Bethany Smith

I'm not the biggest fan of New Year's resolutions, but I like to think that as we enter the top of January there is no better time to try something new. If you haven't thought about what that something might be maybe I can inspire you. I look at every year as an opportunity to test out new products, specifically skin care because I'm always looking for ways to maintain a clear complexion.

While this task can seem like an easy one, it can also be pricey. Lucky for us, Ulta Beauty is starting 2021 with a sale that's all about treating our skin meet the Love Your Skin Event.

The epic skin-care sale has started and runs through January 23. The best part is that Ulta Beauty is sharing all the deals for each day early and, folks, this sale is so good. Products from brands like Zitsticka, Clinique, Philosophy, and more will be up to 50 percent off on certain days of the month. To make it easy for you, we organized every deal by day. Here's what's on sale this week, plus a peek at the rest of the month. Happy shopping!

ZitSticka's Killa Kit is a one-way ticket to clear skin. The bundle includes four Killa Spot Clarifying Microdart Patches, which have niacinamide to fade darkness and salicylic acid to diminish the zit, and four Cleana Cleansing Swabs that are soaked salicylic acid that can be dabbed on a pimple to help shrink it.

For brighter skin, check out the Clinique Endless Glow Moisture Surge Set. It holds the entire collection that includes a Moisture Surge 72-Hour Auto-Replenishing Hydrator, a Moisture Surge Hydrating Supercharged Concentrate, a Moisture Surge Eye 96-Hour Hydro-Filler Concentrate, and a Moisture Surge Hydrating Lotion. All of which have hyaluronic acid to ensure your skin is never dry.

Loaded with hyaluronic acid and ceramides, the It Cosmetics Confidence in A Neck Cream Anti-Aging Moisturizer works to smooth out any fine lines. And to soothe dry lips, try Becca Cosmetics' Hydra-Light Smoothing Lip Scrub. Its formula has moisturizing mango butter and coconut oil and natural sugars to exfoliate any dryness or flakiness.

The Juice Beauty Stem Cellular Anti-Wrinkle Overnight Cream & Eye Treatment is made with primrose oil, which reduces dark circles, and vitamin C to hydrate the eye area. If you're more of a mask person, the Este Lauder Perfectly Clean Multi-Action Foam Cleanser and Purifying Mask may be for you. It's a two-in-one cleanser and mask that unclogs pores using salicylic acid. Either wash it off right away like a face wash or let it sit for three minutes like a mask to prevent and calm any acne.

Continued here:
Ulta Beautys Love Your Skin Event Is Here | January 2021 - Allure

Recommendation and review posted by Bethany Smith

DBMR has added a new report titled Exosome Therapeutic Market with analysis provides the insights which bring marketplace clearly into the focus and thus help organizations make better decisions. This Exosome Therapeutic Market research report understands the current and future of the market in both developed and emerging markets. The report assists in realigning the business strategies by highlighting the business priorities. It throws light on the segment expected to dominate the industry and market. It forecast the regions expected to witness the fastest growth. This report is a collection of pragmatic information, quantitative and qualitative estimation by industry experts, the contribution from industry across the value chain. Furthermore, the report also provides the qualitative results of diverse market factors on its geographies and Segments.

Exosome therapeutic market is expected to gain market growth in the forecast period of 2019 to 2026. Data Bridge Market Research analyses that the market is growing with a CAGR of 21.9% in the forecast period of 2019 to 2026 and expected to reach USD 31,691.52 million by 2026 from USD 6,500.00 million in 2018. Increasing prevalence of lyme disease, chronic inflammation, autoimmune disease and other chronic degenerative diseases are the factors for the market growth.

Get Sample Report + All Related Graphs & Charts (with COVID 19 Analysis) @https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-exosome-therapeutic-market&pm

Exosomes are used to transfer RNA, DNA, and proteins to other cells in the body by making alteration in the function of the target cells. Increasing research activities in exosome therapeutic is augmenting the market growth as demand for exosome therapeutic has increased among healthcare professionals.

Increased number of exosome therapeutics as compared to the past few years will accelerate the market growth. Companies are receiving funding for exosome therapeutic research and clinical trials. For instance, In September 2018, EXOCOBIO has raised USD 27 million in its series B funding. The company has raised USD 46 million as series a funding in April 2017. The series B funding will help the company to set up GMP-compliant exosome industrial facilities to enhance production of exosomes to commercialize in cosmetics and pharmaceutical industry.

Increasing demand for anti-aging therapies will also drive the market. Unmet medical needs such as very few therapeutic are approved by the regulatory authority for the treatment in comparison to the demand in global exosome therapeutics market will hamper the market growth market. Availability of various exosome isolation and purification techniques is further creates new opportunities for exosome therapeutics as they will help company in isolation and purification of exosomes from dendritic cells, mesenchymal stem cells, blood, milk, body fluids, saliva, and urine and from others sources. Such policies support exosome therapeutic market growth in the forecast period to 2019-2026.

This exosome therapeutic market report provides details of market share, new developments, and product pipeline analysis, impact of domestic and localised market players, analyses opportunities in terms of emerging revenue pockets, changes in market regulations, product approvals, strategic decisions, product launches, geographic expansions, and technological innovations in the market. To understand the analysis and the market scenario contact us for anAnalyst Brief, our team will help you create a revenue impact solution to achieve your desired goal.

Grab Your Report at an Impressive 30% Discount! Please click Here @https://www.databridgemarketresearch.com/inquire-before-buying/?dbmr=global-exosome-therapeutic-market&pm

Competitive Landscape and Exosome Therapeutic Market Share Analysis

Global exosome therapeutic market competitive landscape provides details by competitor. Details included are company overview, company financials, revenue generated, market potential, investment in research and development, new market initiatives, global presence, production sites and facilities, company strengths and weaknesses, product launch, product trials pipelines, concept cars, product approvals, patents, product width and breadth, application dominance, technology lifeline curve. The above data points provided are only related to the companys focus related to global exosome therapeutic market.

The major players covered in the report are evox THERAPEUTICS, EXOCOBIO, Exopharm, AEGLE Therapeutics, United Therapeutics Corporation, Codiak BioSciences, Jazz Pharmaceuticals, Inc., Boehringer Ingelheim International GmbH, ReNeuron Group plc, Capricor Therapeutics, Avalon Globocare Corp., CREATIVE MEDICAL TECHNOLOGY HOLDINGS INC., Stem Cells Group among other players domestic and global. Exosome therapeutic market share data is available for Global, North America, Europe, Asia-Pacific, and Latin America separately. DBMR analysts understand competitive strengths and provide competitive analysis for each competitor separately.

Many joint ventures and developments are also initiated by the companies worldwide which are also accelerating the global exosome therapeutic market.

For instance,

Partnership, joint ventures and other strategies enhances the company market share with increased coverage and presence. It also provides the benefit for organisation to improve their offering for exosome therapeutics through expanded model range.

Global Exosome Therapeutic Market Scope and Market Size

Global exosome therapeutic market is segmented of the basis of type, source, therapy, transporting capacity, application, route of administration and end user. The growth among segments helps you analyse niche pockets of growth and strategies to approach the market and determine your core application areas and the difference in your target markets.

Based on type, the market is segmented into natural exosomes and hybrid exosomes. Natural exosomes are dominating in the market because natural exosomes are used in various biological and pathological processes as well as natural exosomes has many advantages such as good biocompatibility and reduced clearance rate compare than hybrid exosomes.

Exosome is an extracellular vesicle which is released from cells, particularly from stem cells. Exosome functions as vehicle for particular proteins and genetic information and other cells. Exosome plays a vital role in the rejuvenation and communication of all the cells in our body while not themselves being cells at all. Research has projected that communication between cells is significant in maintenance of healthy cellular terrain. Chronic disease, age, genetic disorders and environmental factors can affect stem cells communication with other cells and can lead to distribution in the healing process. The growth of the global exosome therapeutic market reflects global and country-wide increase in prevalence of autoimmune disease, chronic inflammation, Lyme disease and chronic degenerative diseases, along with increasing demand for anti-aging therapies. Additionally major factors expected to contribute in growth of the global exosome therapeutic market in future are emerging therapeutic value of exosome, availability of various exosome isolation and purification techniques, technological advancements in exosome and rising healthcare infrastructure.

Rising demand of exosome therapeutic across the globe as exosome therapeutic is expected to be one of the most prominent therapies for autoimmune disease, chronic inflammation, Lyme disease and chronic degenerative diseases treatment, according to clinical researches exosomes help to processes regulation within the body during treatment of autoimmune disease, chronic inflammation, Lyme disease and chronic degenerative diseases. This factor has increased the research activities in exosome therapeutic development around the world for exosome therapeutic. Hence, this factor is leading the clinician and researches to shift towards exosome therapeutic. In the current scenario the exosome therapeutic are highly used in treatment of autoimmune disease, chronic inflammation, Lyme disease and chronic degenerative diseases and as anti-aging therapy as it Exosomes has proliferation of fibroblast cells which is significant in maintenance of skin elasticity and strength.

For More Insights Get FREE Detailed TOC @https://www.databridgemarketresearch.com/toc/?dbmr=global-exosome-therapeutic-market&pm

Exosome therapeutic Market Country Level Analysis

The global exosome therapeutic market is analysed and market size information is provided by country by type, source, therapy, transporting capacity, application, route of administration and end user as referenced above.

The countries covered in the exosome therapeutic market report are U.S. and Mexico in North America, Turkey in Europe, South Korea, Australia, Hong Kong in the Asia-Pacific, Argentina, Colombia, Peru, Chile, Ecuador, Venezuela, Panama, Dominican Republic, El Salvador, Paraguay, Costa Rica, Puerto Rico, Nicaragua, Uruguay as part of Latin America.

Country Level Analysis, By Type

North America dominates the exosome therapeutic market as the U.S. is leader in exosome therapeutic manufacturing as well as research activities required for exosome therapeutics. At present time Stem Cells Group holding shares around 60.00%. In addition global exosomes therapeutics manufacturers like EXOCOBIO, evox THERAPEUTICS and others are intensifying their efforts in China. The Europe region is expected to grow with the highest growth rate in the forecast period of 2019 to 2026 because of increasing research activities in exosome therapeutic by population.

The country section of the report also provides individual market impacting factors and changes in regulation in the market domestically that impacts the current and future trends of the market. Data points such as new sales, replacement sales, country demographics, regulatory acts and import-export tariffs are some of the major pointers used to forecast the market scenario for individual countries. Also, presence and availability of global brands and their challenges faced due to large or scarce competition from local and domestic brands, impact of sales channels are considered while providing forecast analysis of the country data.

Huge Investment by Automakers for Exosome Therapeutics and New Technology Penetration

Global exosome therapeutic market also provides you with detailed market analysis for every country growth in pharma industry with exosome therapeutic sales, impact of technological development in exosome therapeutic and changes in regulatory scenarios with their support for the exosome therapeutic market. The data is available for historic period 2010 to 2017.

About Data Bridge Market Research:

An absolute way to forecast what future holds is to comprehend the trend today!Data Bridge set forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge endeavors to provide appropriate solutions to the complex business challenges and initiates an effortless decision-making process.

Contact:

Data Bridge Market Research

US: +1 888 387 2818

UK: +44 208 089 1725

Hong Kong: +852 8192 7475

Email @ Corporatesales@databridgemarketresearch.com

Read the original here:
Exosome Therapeutic Market Overview By Size, Share, Trends, Growth Factors and Leading Players With Detailed Analysis of Industry Structure - KSU |...

Recommendation and review posted by Bethany Smith

Author : Roy Phillips, MD, CryoCoax

05 January 2021

Its early origins were in the late nineteenth century when Faraday et al experimented with the liquefaction of various gases and has developed tremendously over the subsequent 140 years or so. (Note: it not to be confused with cryonics, the science of freezing dead bodies!).

Today Cryogenics has become a key part of our scientific and engineering present and is set to become an even bigger part of our future.

A key emerging market for cryogenics in the electronics industry is being created by the immense interest in quantum computing, while other applications include medical, space, defence, aerospace, education, test and measurement, biological research, chemistry and more.

The use of electronics, particularly RF, within cryogenic applications is especially interesting and involves a phenomenon called superconductivity.

Superconductivity occurs within certain materials at ultra-low temperatures when a charge or signal moves through the material without resistance. The obvious benefits of this are a massive increase in capacity, efficiency and the signal integrity of an RF system.

One of the biggest challenges in this market is the very the narrow supply chain for the exotic materials required to manufacture cryogenic products and the new technology required to combine components into a working system or sub-assembly. While not insurmountable, this remains the biggest challenge to successfully create manufacturable products with reliable and repeatable performance.

As conventional soldering is not possible with some cryogenic cable materials Intelliconnect has designed a solderless connector and other low temperature hardware to create assemblies which work to below 2 K (-271.15C) at bandwidths up to 40GHz.

Technical specifications, both electrical and mechanical are significantly different in the cryogenics world and product design engineers will be working with scientists outside of the customary world of electronics, rather than their traditional customer base of RF and electronics engineers, which presents a new set of challenges.

The enormous investment in equipment and stock required was the first major hurdle. Specialised test equipment, self-designed manufacturing equipment, hugely expensive materials and even additional manufacturing space has had to be procured.

Relationships with many seats of learning in UK, USA and elsewhere were essential and Intelliconnect has developed a large network of University partnerships which has helped immeasurably with product development and elevating technical expertise.

In such a specialised vertical market brand recognition becomes extremely important. In an industry where physical and electrical tolerances are very low, quality expectations are incredibly high, and product and supply reliability are paramount, it has been essential to create a new brand which was synonymous with all of these customer requirements. Intelliconnect has created a specialised subsidiary business CryoCoax dedicated to the cryogenics industry.

CryoCoax are members of the British Cryogenics Council, the Cryogenics Society of Europe and the Cryogenics Society of America. An ISO9001 manufacturer CryoCoax is also SC21 accredited to a Silver standard. SC21 is a business quality and improvement qualification designed to provide a continuous improvement programme and assure supply chain performance. Silver Award proves >96% on time delivery and 99.5% quality.

View original post here:
Intelliconnect (Europe) Ltd. - Cryogenics and connecting the cold bits - Design Products & Applications

Recommendation and review posted by Bethany Smith

As we enter 2021, it goes without saying that Covid-19 has changed how we live our lives. On top of pushing multiple industries to adopt digital processes like never before, the pandemic has accelerated the advancements in the field of biotechnology, with one of the most recent successes being the development of Covid-19 vaccines with a 95 per cent success rate.

Prior to that, however, the world has already seen several leaps forward in the world of biotechnology over the past decades, especially in the field of medicine. Before Covid-19, diseases like H1N1 and SARS ravaged the world. Through a significant amount of research in the field of biotechnology, we have made sure that those diseases no longer pose a great threat.

Beyond creating more robust defences against diseases, one of the most well-known biotechnological breakthroughs is the in-vitro fertilization (IVF) method. This breakthrough gave birth to Dolly the sheep in 1996, which opened a floodgate for future exploration and development in the field of biotechnology.

In recent years, some of the most exciting news in biotechnology came from stem cell research. For instance, CRISPR, a powerful gene-editing technology is now being used to treat sickle-cell anemia and can potentially cure cancer and HIV in the future.

As stem cell research continues to progress, it is important for patients to be aware of the kinds of stem cells which can be collected and stored, along with their unlimited potential for curing a variety of diseases.

Biotechnological Breakthroughs Over The Years In A Continuous Bid for Medical Advancement

In the 1980s, stem cells could only be collected right before the transplant, which posed a few problems. They included not having enough stem cells if the patient develops a complication and the risk that the quality and validity of stem cells might be compromised.

Since then, many discoveries have been made and developed in the biotechnology industry. These include isolation, cryopreservation, and long-term storage technology which paved the way for stem cell storage and cord blood banking.

Through this technology, we are able to collect and store stem cells for future use. This allows for more stem cells to be well-preserved ahead of time, giving patients the assurance and peace of mind needed.

With stem cells being increasingly used in a variety of medical cases, cord blood banking a simple and harmless procedure in which cord blood, also known as umbilical cord blood (UCB), is collected and cryopreserved for future use.

In recent years, UCB has gained more prominence among medical experts. This is because cord blood is loaded with stem cells that can be used to treat diseases such as anemia and immune system disorders.

One thing to note is that UCB can only be collected at the time of delivery. However, among patients and their loved ones, cord blood banking remains something that doesnt quite come to mind when considering health insurance plans for their children. Many parents are under the notion that because they are healthy, their babies are also healthy.

Because of this, they do not see the importance of collecting and storing UCB at birth. Aside from that, they also fail to realise that no one can truly predict when a loved one might need this particular form of treatment in the future. Hence, storing UCB is a form of biological insurance, to ensure that if something were to befall a family member one day, there are means to treat it.

With that said, there are many different types of stem cells. Each of them functions differently to carry out a specific task.

Examples Of Stem Cells In Action

Hematopoietic Stem Cells (HSC) are stem cells that produce red blood cells, white blood cells, and platelets to treat blood disorders.

One of the most effective uses of HSC is in the treatment of childhood Acute Lymphoblastic Leukemia (ALL). With stem cells transplant, more than 90% of cases have been successfully treated. A typical treatment method of ALL is through chemotherapy drugs and radiation.

However, there are times when a higher dosage of drugs and radiation is required to treat certain patients and this can be severely damaging to the patients bone marrow. In these cases, HSC transplants after using higher doses of drugs to kill the cancer cells help the patients to produce normal blood-forming cells to restore the bone marrow functions.

Aside from that, HSC can potentially be very effective in treating blood disorders such as cancer, thalassemia (a blood disorder when the body doesnt make enough of a protein called hemoglobin), and aplastic anemia (a condition that leaves one fatigued and more prone to infections and uncontrolled bleeding).

Another type of stem cells is Mesenchymal Stem Cells (MSC). These can be obtained from Umbilical Cord Lining and Wharton Jelly. These are very versatile and important types of stem cells.

In recent times, doctors have been using MSC to treat patients with severe respiratory syndrome as a result of Covid-19 infection. The results were very promising and the patients showed improvements after their treatment. Because the immune system is now functioning better, we have seen a decrease in the inflammatory response and an improvement in theimmune response.

More than that, MSCs have shown a great deal of promise in addressing autism, a disease that did not have a viable cure previously. Currently, many clinical trials are being conducted around the world in universities with stem cell departments, like Duke Universitys Autism trial.

Aside from that, MSCs are also used in clinical trials to study potential cures for neurodegenerative disorders such as Parkinsons and Alzheimers Disease. Another exciting area of research is using MSCs to treat heart conditions, Type 1 Diabetes Mellitus, and cancer.

Stem cell research has definitely come a long way, from the discovery of embryonic stem cells in mice in 1981 by Martin Evans of Cardiff University, to being able to treat an increasing number of diseases over the years.

While there is no guarantee that stem cell transplants will completely cure any particular disease, the potential of stem cells is undeniable. Doctors across the world are working relentlessly to discover more and more of the seemingly endless potential of stem cells.

Dr Menaka Hariharan is the Medical Director of StemLife.

See the original post:
Unlocking The Unlimited Potential Of Stem Cells - CodeBlue

Recommendation and review posted by Bethany Smith

With a new management team spearheading Hemostemix Inc. (TSXV: HEM | OTC: HMTXF), the Company started 2021 with its critical clinical study data in hand. Raising over $4 million in 2020 and then in December adding an additional $4 million to the coffers ($2.75 million at a 50% premium), Hemostemix completed a 1-for-20 share consolidation as it charges into the New Year.

Receiving a copy of its entire clinical trial database relating to the clinical trial for Critical Limb Ischaemia (CLI) using its ACP-01 therapy (Angiogenic Cell Precursors) in November 2020 was a key event for Hemostemixs management team and it garnered real interest from the market.

Hemostemix Platform for Stem Cell Therapies

Based in Calgary and founded in 2006, Hemostemix is a clinical-stage biotechnology company specializing in blood-derived stem cell therapeutics with its lead product (ACP-01) in Stage 2 clinical trials for the treatment of CLI.

CLI is a disease caused by the narrowing of arteries in the limbs, particularly the legs, hands, and feet, causing chronic pain and soreness. Untreated CLI can sometimes require the amputation of the specific limb.

Stem cell treatments have been used for over 30 years to treat people with cancer conditions such as leukemia and lymphoma.

There are two main types of stem cell transplants: allogeneic and autologous. In an allogeneic stem cell transplant procedure, the patient receives stem cells from a donor. In an autologous stem cell transplant procedure, the patient provides themselves the stem cells for the procedure from various sources, including bone marrow or blood.

Hemostemixs autologous stem cell therapy platform uses the patients own blood to harvest the stem cells and the treatment helps to restore circulation in the damaged tissues.

Hemostemix has a strong intellectual property (IP) portfolio of 91 patents and has treated more than 500 patients with clinical results showing an improvement in 83% of the patients receiving its ACP-01 stem cell therapy.

Advantages with Hemostemixs process include the use of blood, which is safer and less invasive than extracting bone marrow, and since you are using the patients own blood, there is no immune rejection.

The clinical trials have shown that ACP-01 is safe and effective in the treatment of CLI. Now that Hemostemix has received the entire clinical trial database, it has entered into a contract with a new Clinical Research Organization (CRO) to complete the midpoint statistical analyses of the efficacy of ACP-01 and expects to publish the results this quarter.

Hemostemix Not a 1-Trick Pony Company

ACP-01 has the potential to treat other conditions such as Angina, Ischemic & Dilated Cardiomyopathy, and Peripheral Artery Disease (PAD). Currently, Hemostemix is preparing for Phase 2 trials for the treatment of Angina and is seeking joint-venture partners to fund the other Phase 2 trials.

Hemostemix has also developed NCP-01 (Neural Cellular Precursor) from blood with the potential, through building new neuronal lineage cells in a patient, to treat Alzheimers disease, Amyotrophic Lateral Sclerosis (ALS), Parkinsons disease, spinal cord injuries, and stroke-related issues. NCP-01 is currently in the R&D phase and is pre-clinical.

Market Size

According to the American Heart Association, Cardiovascular disease (CVD) accounted for approximately 1 of every 3 deaths in the United States in 2019.

Factors that increase the risk of CLI include diabetes, high cholesterol levels, high blood pressure, obesity, or smoking, all risk factors also associated with CVD.

Unfortunately, most of these factors are increasing at an alarming rate a study by the Centers for Disease Control and Prevention (CDC) in the United States, showed the prevalence of diagnosed diabetes has more than doubled from 3.3% in 1995 to 7.40% in 2015, affecting 23.4 million Americans.

According to a market research report released in 2019, the value of just the global CLI treatment market is projected to reach US$5.39 billion by 2025, up from US$3.13 billion in 2018, at an annual growth rate of 8%.

Competitive Landscape and Market Cap Comparisons

Even with Hemostemixs recent market surge, its market cap is only C$32.5 million. Similar-sized biotech companies focusing on CLI trade much higher.

Cynata Therapeutics Limited (ASX: CYP) is an Australian biotechnology company with a Phase 2 clinical-stage trial for its stem cell therapy for CLI using bone marrow and has a market cap of C$93.6 million.

Pluristem Therapeutics Inc. (NASDAQ: PSTI) is a Phase 3 bio-therapeutics company, based in Israel, that also has an allogeneic cell therapy for the treatment of CLI using the placenta and has a market cap of C$231.9 million.

In November 2020, Bristol-Myers Squibb Company (NYSE: BMY) bought MyoKardia, Inc. for US$13.1 billion. MyoKardia was a clinical-stage biopharmaceutical company that developed therapies for the treatment of cardiovascular diseases and its lead product was a Phase III clinical trial drug used in the treatment of hypertrophic cardiomyopathy (HCM).

As a company shifts from Phase 2 to Phase 3 clinical trials, the market cap often has a step-function shift higher, making it an ideal time to look at Hemostemix.

SOURCE:

Go here to see the original:
Hemostemix steps into the new year with capital and its critical clinical study data in hand - InvestorIntel

Recommendation and review posted by Bethany Smith

Dublin, Jan. 06, 2021 (GLOBE NEWSWIRE) -- The "Organ and Tissue Transplantation and Alternatives" report has been added to ResearchAndMarkets.com's offering.

This report offers forecasts, by product segment, from 2018 through 2024, including supporting analyses for projections. Product segments covered consist of the solid organ (e.g., kidneys, liver, heart-lung, pancreas, intestines) and the tissue transplantation (e.g., bone, skin, cornea, heart valve) markets, along with the pharmaceuticals that accompany each market.

Also included are experimental xenografts and artificial organs; tissue transplants; and cell transplants (e.g., bone marrow, cord blood, peripheral blood, islet cell). The report touches on the use of fetal cells, stem cells, and altered cancer cells.

The arrangement of this report offers an overview of the key elements in the transplantation process: tissue typing, procurement and preservation, immunosuppressants for solid organ and tissue transplants, and postoperative monitoring. International markets are discussed, and information is provided on industry structure and the regulatory environment.

Within each section are discussions of commercialization opportunities for each segment of the market. New or emerging devices, techniques, and pharmaceuticals are highlighted.

Profiles of leading companies involved with solid organ transplantation, tissue transplantation, and alternative technologies are included. The report provides information on company placement within the market and strategic analyses of the companies' available and emerging products.

An appendix featuring various terms and processes used in transplantation is provided at the end of the report.

This report cites autologous products only in relation to their impact on the market for allografts. It does not include blood products, except for peripheral and umbilical cord blood as a source of stem cells.

By geography, the market has been segmented into North America, Europe, Asia-Pacific, and Rest of the World regions. Detailed analysis of the market in major countries such as the U.S., Germany, the U.K., Italy, France, Spain, Japan, China, India, Brazil, Mexico, GCC countries, and South Africa will be covered in the regional segment. For market estimates, data will be provided for 2019 as the base year, with estimates for 2020 and forecast value for 2024.

Story continues

Report Includes:

26 data tables and 37 additional tables

An overview of the global organ and tissue transplantation and alternatives market

Estimation of the market size and analyses of market trends, with data from 2018 to 2019, estimates for 2020, and projection of CAGR through 2024

Details about organ and tissue transplantation and alternatives, their pathophysiology and effects, and major advancement and latest trends

A look at the regulatory scenarios and initiatives by a government organization

Analysis of current and future market dynamics and identification of key drivers, restraints, and opportunities such as increasing incidence of organ donations, improved awareness about organ donations, side effects of organ and tissue transplantation, and antibiotic resistance infections

Coverage of emerging procedures and products in development and discussion on the prevalence of major chronic diseases which initiates organ damage or donation

Discussion on the role of the organ procurement organization and information on transplantation process and preparation and coverage of issues like black market donors

Impact analysis of COVID-19 on organ and tissue transplantation and alternatives market

Market share analysis of the key companies of the industry and coverage of events like mergers & acquisitions, joint ventures, collaborations or partnerships, and other key market strategies

Company profiles of major players of the industry, including Abiomed Inc., Bayer AG, F. Hoffmann-La Roche & Co., Johnson & Johnson, Novartis AG, Pfizer Inc., and XVIVO Perfusion

Growth of the global market is attributed to factors such as the growing prevalence of obesity, diabetes, cancer, and other chronic diseases which leads to organ damage, a strong product regulatory scenario, and strong investment in research and development activities by key market players including Abbott Laboratories, Cryolife Inc., Bristol-Myers Squibb, Novartis Ag, F. Hoffmann-La Roche Ltd., Medtronic, Arthrex Inc., Depuy Synthes (Johnson & Johnson), and Allosource.

Although various factors facilitate the global market for organ and tissue transplantation and alternatives, certain parameters such as challenges in HLA sequencing and gaps in supply and demand can constrain market growth. For instance, although there is an increasing need for organ transplants, the shortage of organs worldwide limits the number of transplant procedures performed, and in turn, creates an impact on transplant diagnostics procedures. An increasing number of candidates on the waiting list for organ transplant procedures worldwide further widens this gap of availability and requirement of organs for transplant purposes.

Successful organ and tissue transplantation began to arrive in the mid-1970s when tissue typing coupled with the use of cyclosporine provided more successful graft and patient survival. Today, patient and graft survival for kidney transplants is higher than 90% for the first year post-transplant, and often the success rate is 80% to 90% for five years post-transplant, with some recipients living more than 20 years after their transplant.

Continuing developments in organ procurement, organ preservation, tissue typing, and immunosuppressant use have bolstered successful transplantation surgical techniques. Evolving posttransplant drug and testing regimens have added to the success rate with close post-transplant monitoring and immunosuppressant dosage review.

Key Topics Covered:

Chapter 1 Introduction

Chapter 2 Summary and Highlights

Chapter 3 Market and Technology Background

Organ and Tissue Transplantation and Alternatives

Cost of Care

Solid Organ Preservation

Immunosuppression

Organ Transplantation Alternatives

Trends in Organ and Tissue Transplantation Techniques and Their Alternatives

3D Tissue Assembly

Nanotechnology for Tissue Regeneration

Innovation by Small Firms

Chapter 4 Market Dynamics

Market Drivers

Increasing Epidemiology of Different Diseases Influencing Organ Transplantations

Rise in the Geriatric Population

Rising Awareness of Importance of Organ and Tissue Donation

New Therapeutic Pathways for Organ Transplantation and Their Alternatives

Market Restraints

Challenges in Human Leukocyte Antigen (HLA) Sequencing

Demand and Supply Gap

Market Opportunities

Growing Economic Benefits of Organ and Tissue Transplants

Improvement in Healthcare Infrastructure

Chapter 5 Market Breakdown by Product & Devices

Global Market for Organ and Tissue Transplantation and Alternatives

Alternative Technologies

Market Size and Forecast

Alternatives to Heart Transplantation

Surgical

Mechanical

Total Artificial Heart

Ventricular Assist Devices (VADs)

Generations of Designs

Orthopedic Alternatives

Tissue Products

Market Size and Forecast

Immunosuppressants

Market Size and Forecast

Solid Organ Preservation Solutions

Market Size and Forecast

Preservation Solutions in Development

Tissue Typing

Market Size and Forecast

Chapter 6 Market Breakdown by Region

Global Market for Organ and Tissue Transplantation and Alternatives by Region

North America

United States

Canada

Mexico

Europe

Germany

France

U.K.

Italy

Spain

Rest of Europe

Asia-Pacific

Japan

China

India

Australia and New Zealand

Rest of Asia-Pacific

Rest of the World

Market Analysis

Brazil

South Africa

Rest of the World Countries

Chapter 7 Impact of COVID-19

Introduction

Impact on Kidney Transplant Program

Impact on Pharmaceutical Companies

Donor Testing

Visit link:
Global Organ and Tissue Transplantation and Alternatives Market to 2024 - Impact Analysis of COVID-19 - Yahoo Finance

Recommendation and review posted by Bethany Smith

ALS News Today brought you daily coverage of key findings, treatment developments, clinical trials, and other important events related to amyotrophic lateral sclerosis (ALS) throughout 2020, a year marked by the COVID-19 pandemic.

As a reminder of what mattered most to you in 2020, here are the top 10 most-read articles of last year with a brief description of what made them interesting and relevant to the ALS community.

We look forward to reporting more relevant news to patients, family members, and caregivers dealing with ALS throughout 2021.

A team of researchers in Germany found that caffeine and nicotinamide adenine dinucleotide in its oxidized form (NAD+) two powerful antioxidants improved the health of lab-grown motor neurons derived from a mouse model of sporadic ALS.

These benefits, seen in cells derived from mice either in a progressive or a stable disease state, were likely associated with a reduction in oxidative stress, a known contributor to sporadic ALS.

Of note, motor neurons, the specialized nerve cells that control voluntary movement, are progressively lost in people with ALS. Oxidative stress is an imbalance between the natural production of potentially harmful reactive oxygen species and the ability of cells to detoxify them with antioxidant agents.

In an April story, we reported AB Sciences plans to launch a Phase 3 clinical trial (NCT03127267) testing its experimental oral therapy masitinib as an add-on treatment for people with ALS, after the U.S. Food and Drug Administration (FDA) cleared its request for this study.

Masitinib is designed to block the activity of multiple cell types involved in the inflammatory and neurodegenerative processes marking ALS.

The study aims to assess whether add-on treatment with masitinib is superior to placebo at slowing functional decline in up to 495 ALS patients diagnosed in the past two years. Participants functional abilities will be assessed through the ALS functional rating scale-revised (ALSFRS-R). Both masitinib and placebo will be given in combination with Sanofis Rilutek (riluzole), an approved ALS medication.

The trial is currently recruiting patients at a single U.S. clinical site(Johns Hopkins in Maryland), but another site in Ulm, Germany, is expected to open shortly. Should study findings be positive, they are expected to support future requests for regulatory approval of masitinib as an ALS treatment.

Using different mouse models of ALS, a team of researchers in the U.S. discovered a self-destructive mechanism in mitochondria the cells powerhouses that may be one of the first triggers of motor neuron degeneration in ALS.

This mitochondrial suicide was found only in the upper motor neurons those that send messages from the brain to the spinal cord, and whose degeneration is thought to be an early disease event of ALS mice, and before any signs or symptoms of the disease were evident.

These findings suggest that currently available therapies targeting mitochondrial degeneration may help to stop neurodegeneration in ALS, supporting further research in this area.

In July, BrainStorm Cell Therapeutics announced that all ALS patients enrolled in a pivotal Phase 3 clinical trial (NCT03280056) testing NurOwn, its investigational cell-based therapy, had completed dosing.

NurOwn involves expanding and maturing mesenchymal stem cells (MSCs) collected from a patients own bone marrow into cells that produce high levels of molecules promoting nerve cell growth and survival. MSCs are stem cells that can generate a variety of other cell types.

The mature cells called MSC-NTF cells are then injected into the patients spinal canal to promote and support nerve cell repair.

In the U.S.-based trial, 189 patients with rapidly progressing ALS were randomly assigned to either a total of three injections of either NurOwn, or a placebo, given directly into the spinal canal every other month.

The studys main goal was to assess the therapys safety, and whether treatment was superior to placebo at slowing disease progression as measured by the ALSFRS-R at seven months following the first dose.

A couple of months earlier, we reported the results of a preclinical study suggesting that NurOwn may not only boost nerve cell protection and repair, but also suppress the damaging immune responses that contribute to ALS progression by promoting a shift toward an anti-inflammatory state.

BrainStorm researchers found that growing healthy B-cells and T-cells immune cells known to be involved in ALS in the lab with NurOwn suppressed the growth of pro-inflammatory cell subsets, and lowered the levels of pro-inflammatory molecules. At the same time, the therapy increased the numbers of immunosuppressive cell subsets and the levels of a major anti-inflammatory molecule.

BrainStorm announced in June that patient dosing in its Phase 3 trial evaluating NurOwn in people with ALS remained on track, despite occasional treatment scheduling changes due to the COVID-19 pandemic.

The company attributed the trials successful advancement during the pandemic to coordination among its six U.S. clinical sites, support and guidance from the FDA, and the fact that its main goal based on the ALSFRS-R could be assessed by phone.

Top-line data were shared before the years end, as anticipated by BrainStorm, and are under review by the FDA.

In April, ALS News Today reported onSeneca Biopharmas plans to launch a Phase 3 clinical trial to assess the safety and effectiveness of NSI-566, its leading stem cell treatment candidate, in adults with ALS.

The decision was supported by previous positive data from a Phase 1 (NCT01348451) and Phase 2 (NCT01730716) clinical trial and a meeting with the FDA that provided guidance on how to best design and conduct the upcoming late-stage trial.

NSI-566 treatment involves the injection of fetal spinal cord stem cells into a patients spinal cord, where they mature into nerve cells that surround and support motor neurons. These mature cells also produce certain molecules that promote motor neuron growth and survival.

Results from the previous studies confirmed NSI-566s safety, and suggested that the therapy may help to prevent further functional decline in ALS patients, when compared with data from other ALS trials.

A small study in Italy suggested that creatinine kinase a marker of muscle damage could be used as a biomarker to predict the rate of disease progression in people with ALS.

By analyzing this enzyme in 126 ALS patients, the researchers found that creatinine kinase levels were significantly higher in people with slow progressing disease compared with those with fast progressing disease, and that these differences were sustained over time.

Further analyses in mouse models of ALS confirmed these findings, and suggested that the slow progression was associated with greater muscle mass and a better ability to counter disease mechanisms for longer periods.

Elevated creatinine kinase blood levels also seemed to be specific to ALS among neurodegenerative diseases, suggesting that the muscle may be a therapeutic target in ALS.

In January, we reported that a Phase 1/2a clinical trial (NCT03482050) testing AstroRx, Kadimastems investigational cell therapy, had completed dosing a second group ofALS patients.

AstroRx delivers healthy, mature astrocytes derived from human embryonic stem cells to a patients spinal cord to compensate for diseased astrocytes and to prevent motor neuron loss. Astrocytes are star-shaped cells that normally support and protect nerve cells, but are abnormal in ALS.

Data from the first group of patients given the lowest therapy dose showed that the treatment was safe and slowed the rate of disease progression over the first three to four months following dosing. Results from the second group (given a higher dose) went on toconfirm these promising three-month findings of a single treatment.

Our most-read article of 2020 concerned the discovery that an abnormal uptake of metals from chromium to zinc during childhood is associated with ALS in adults.

By analyzing teeth samples from 36 ALS patients and 31 unaffected people with a powerful technology, the researchers were able to establish and assess differences in temporal profiles of metal exposure. They found that ALS patients had greater exposure to several metals at various developmental stages, starting as early as birth.

These findings were confirmed in mouse models of ALS, both in their teeth and in their brains, suggesting that abnormal metal metabolism may contribute to several molecular changes that could increase the susceptibility of motor neurons to premature damage.

While deficiencies and excess of essential elements and toxic metals are known to contribute to ALS, researchers were now able to provide an idea of when these metabolic abnormalities start. The results also suggested that metal metabolism could be a viable therapeutic target to prevent or halt ALS.

***

At ALS News Today, we hope these stories and our reporting throughout 2021 help to better inform and improve the lives of everyone affected by ALS.

We wish all our readers a happy 2021.

Marta Figueiredo holds a BSc in Biology and a MSc in Evolutionary and Developmental Biology from the University of Lisbon, Portugal. She is currently finishing her PhD in Biomedical Sciences at the University of Lisbon, where she focused her research on the role of several signalling pathways in thymus and parathyroid glands embryonic development.

Total Posts: 45

Ins holds a PhD in Biomedical Sciences from the University of Lisbon, Portugal, where she specialized in blood vessel biology, blood stem cells, and cancer. Before that, she studied Cell and Molecular Biology at Universidade Nova de Lisboa and worked as a research fellow at Faculdade de Cincias e Tecnologias and Instituto Gulbenkian de Cincia. Ins currently works as a Managing Science Editor, striving to deliver the latest scientific advances to patient communities in a clear and accurate manner.

See more here:
Top 10 ALS Stories of 2020 - ALS News Today

Recommendation and review posted by Bethany Smith

A brave West Lothian mum was floored after doctors found her sciatica pain was actually a symptom of a deadly blood cancer which had hollowed out her bones.

Judith Green had suffered from back pain on several occasions over the last 10 years but was repeatedly told it was likely due to a trapped nerve and would resolve itself.

The 42-year-olds pain became too much in June 2019 when she woke screaming in the middle of the night before repeatedly vomiting blood over the next two days.

She took herself to St Johns Hospital in Livingston where doctors soon made the shock diagnosis of myeloma cancer which had left her kidneys functioning at only 15 per cent.

The mum-of-two was told that the condition - which normally affects men over the age of 60 - was incurable but doctors hoped to extend her life through various treatments.

She underwent a stem cell transplant with her own cells in January 2019 but was heartbroken when medics revealed the cancer had returned just seven months later.

The former waitress has vowed to keep fighting so she can meet her future grandchildren and is urging people to register as stem cell donors in a bid to save more lives.

She explained: I remember thinking but its just a sore back. I had never heard of myeloma before I got diagnosed with it.

I 100 per cent thought I was going to hospital that day because I had sciatica. With myeloma, it eats away at your bone marrow.

My ribs were sore but I brushed it off thinking it was my new bra digging in. When my back hurt, I thought it was the new car seat causing it.

But in reality, I had almost no bone marrow. It was 90 per cent cancerous cells. I just made excuse after excuse but looking back I now realise that it was all part of it.

My kidneys were only working at 15 per cent, which explained why I was so thirsty.

Doctors immediately started Judith on a course of chemotherapy and steroids before attempting to harvest some of her remaining bone marrow.

The first attempt was unsuccessful but the next managed to gather enough cells to provide at least three more transplants.

The cells were then deep frozen before being transplanted back into the mum-of-two in January this year - a move which they hoped would buy her at least 18 more months.

But a blood test in August revealed that the myeloma had returned a lot quicker than expected meaning she now has to undergo a second transplant from a mystery donor.

They then discovered Judith had sepsis and MRSA and having no immune system and blood cancer, Judith said she was the sickest she had ever been.

She continued: They were hoping I would make it 18 months post transplant but they discovered in August that the cancer had returned and it had only worked for seven months.

Thats when we found out that they wouldnt be able to use my own cells again because it wasnt worth putting me through all that again.

So now Ill be going back on chemo in January and getting a transplant from a worldwide donor. Thankfully the transplant team has already found a match for me on the system.

Judith continued: Im really lucky that theres a match out there for me. But there are so many others, who are a lot sicker than I am, that dont have theirs yet.

The reason I wanted to speak out is to raise awareness of myeloma and stem cell donation.

You really could be giving someone a second chance at life by spitting into a tube. Back in the day it was a bone marrow transplant but now its stem cells.

Its no different from giving blood. I would just ask everyone to go have a look into it and see if they want to or are able to register.

Judith, who lives with her two sons and partner Steven (46), added: I may not be able to do some of the things I did before like go to the cinema with the boys but Im still here.

And I hope to be here long enough to see my grandkids. I know Ill keep fighting after that to see them grow up then. But for now, its just taking each day as it comes.

To find out more about stem cell donation for those aged under 30 visit https://www.anthonynolan.org/.

Those over 30 can visit https://www.dkms.org.uk/en.

Read more:
Brave West Lothian women discovers back pain is actually deadly blood cancer - Daily Record

Recommendation and review posted by Bethany Smith

Global Bone Marrow Aspirate Concentrates Market was valued US$ XX Bn in 2018 and is expected to reach US$ XX Bn by 2026, at CAGR of 6.5 % during forecast period of 2019 to 2026

Bone marrow concentrate (BMC) uses stem cells that are harvested from your own bone marrow to help the body heal itself. These cells when injected directly into an injury site, prompt a rapid and efficient restoration of the tissue, returning it to a more healthy state by stimulating the bodys natural healing response. It is non-surgical treatment for various orthopedic injuries, including mild to moderate osteoarthritis, disc degeneration and soft tissue injuries.The report study has analyzed revenue impact of COVID -19 pandemic on the sales revenue of market leaders, market followers and market disrupters in the report and same is reflected in our analysis.

Global Bone Marrow Aspirate Concentrates Market Drivers and RestrainsBone marrow-derived stem cell treatment is considered a promising and advanced therapy. It reduces the injury healing time in orthopedic diseases to five to six weeks from four to six months in case of surgery. Reduction in the healing time is a factor likely to fuel the Bone Marrow Aspirate Concentrates market during the forecast period.

Pain associated with the treatment, lack of awareness, and use of alternative treatments are major restraints to the Global Bone Marrow Aspirate Concentrates Market. Furthermore, increased investments in R&D and clinical trials attributed to slow approval processes entailing sunken costs, and marginal returns on investment for manufacturers are factors hindering Global Bone Marrow Aspirate Concentrates Market.

Global Bone Marrow Aspirate Concentrates Market key segmentationBy end-use market is divided into hospitals & clinics, pharmaceutical & biotechnology companies, Contract Research Organizations (CROs) & Contract Manufacturing Organizations (CMOs), and academic & research institutes. The hospitals & clinics segment dominated the bone marrow aspirate concentrates market in 2018 and is expected to maintain its dominance during the forecast period. The hospitals & clinics segmental growth is boosted by the biotechnology & biopharmaceutical companies in terms of revenue during the forecast period. Growth of the segment is attributed to increasing number of biotechnology companies and rising partnerships among the market players to expand globally.

Global Bone Marrow Aspirate Concentrates Market regional analysisBy regional analysis, global bone marrow aspirate concentrates market is divided into major five geographical regions, including North America, Europe, Asia-Pacific, Latin America and Middle East and Africa. North America held largest share of the Global Bone Marrow Aspirate Concentrates market owing to technological advancements and regulatory approval for new devices, rising awareness about stem cell therapy, and number of cosmetic surgical procedures. Furthermore, Asia Pacific orthopedic market is key driver, which led to this massive and augmented growth. The orthopedic market in Asia including bone graft, spine, and bone substitute is anticipated to grow as fast as the overall orthopedic market which will further boost growth of BMAC market in the region during forecast period.

The objective of the report is to present comprehensive analysis of Global Bone Marrow Aspirate Concentrates Market including all the stakeholders of the industry. The past and current status of the industry with forecasted market size and trends are presented in the report with the analysis of complicated data in simple language. The report covers all the aspects of industry with dedicated study of key players that includes market leaders, followers and new entrants by region. PORTER, SVOR, PESTEL analysis with the potential impact of micro-economic factors by region on the market have been presented in the report. External as well as internal factors that are supposed to affect the business positively or negatively have been analyzed, which will give clear futuristic view of the industry to the decision makers.

Global Bone Marrow Aspirate Concentrates Market Request For View Sample Report Page @ : https://www.maximizemarketresearch.com/request-sample/37078

The report also helps in understanding Global Bone Marrow Aspirate Concentrates Market dynamics, structure by analyzing the market segments, and project the Global Bone Marrow Aspirate Concentrates Market size. Clear representation of competitive analysis of key players by Bone Marrow Aspirate Concentrates Type, price, financial position, product portfolio, growth strategies, and regional presence in the Global Bone Marrow Aspirate Concentrates Market make the report investors guide.Global Bone Marrow Aspirate Concentrates Market by product type

Bone Marrow Aspirate Concentrates Systems Bone Marrow Aspirate Concentrates AccessoriesGlobal Bone Marrow Aspirate Concentrates Market Application

Orthopaedic Surgery, Wound Healing, Chronic Pain, Peripheral Vascular Disease, Dermatology;Global Bone Marrow Aspirate Concentrates Market by region

Asia Pacific North America Europe Latin America Middle East AfricaGlobal Bone Marrow Aspirate Concentrates Market by end-user

Hospitals & Clinics Pharmaceutical & Biotechnology Companies Contract Research Organizations (CROs) and Contract Manufacturing Organizations (CMOs) Academic & Research InstitutesKey players operating on Global Bone Marrow Aspirate Concentrates Market

Terumo Corporation (Terumo BCT), Ranfac Corp., Arthrex, Inc., Globus Medical, Inc., Cesca Therapeutics Inc., MK Alliance Inc. (TotipotentSC), and Zimmer Biomet Holdings, Inc Cesca Therapeutics Inc. Stryker Paul Medical Systems LIFELINX SURGIMED PVT. LTD.

Global Bone Marrow Aspirate Concentrates Market Do Inquiry Before Purchasing Report Here @: https://www.maximizemarketresearch.com/inquiry-before-buying/37078

About Us:

Maximize Market Research provides B2B and B2C market research on 20,000 high growth emerging technologies & opportunities in Chemical, Healthcare, Pharmaceuticals, Electronics & Communications, Internet of Things, Food and Beverages, Aerospace and Defense and other manufacturing sectors.

Contact info:Name: Vikas GodageOrganization: Maximize Market Research Pvt.Ltd.PuneEmail: [emailprotected]Contact: +919607065656 / +919607195908Website:www.maximizemarketresearch.com

https://lionlowdown.com/

See the article here:
Global Bone Marrow Aspirate Concentrates (BMAC) Market : Industry Analysis and forecast (2019 to 2026): By product Type, Application, End Users, and...

Recommendation and review posted by Bethany Smith

Earlier this week, Biogen and ViGeneron signed a global collaboration and licensing agreement to develop gene therapies for inherited eye diseases. The companies will use Munich-based ViGenerons proprietary adeno-associated virus (AAV) technology platform to efficiently transduce target retinal cells via intravitreal injections.

Under the agreement, ViGeneron will develop in vitro therapeutic candidates for an undisclosed target. Biogen has the right to add an additional target within two years. The companies will jointly conduct a proof-of-concept study, but then Biogen will be responsible for all further development, human trials, and commercialization.

In exchange for use of its AAV gene therapy vector, ViGeneron will receive an undisclosed up-front payment as well as R&D funds from Biogen. ViGeneron is also entitled to development milestone payments and royalties on commercial sales of any products arising from the collaboration.

The joint research effort is part of Biogens overarching plan to diversify its drug pipeline by focusing on ophthalmology, which CEO Michel Vounatsos considers to be an emerging growth area for Biogen. In March 2019, Biogen entered the field of retinal gene therapy through the $800 million acquisition of Nightstar Therapeutics, and in July 2020, the company signed an agreement with Massachusetts Eye and Ear that focused on developing treatment for inherited retinal degeneration due to mutations in the PRPF31 gene.

Here are some reports relating to this deal for your reference: GlobeNewswire; S&P Global; EndPoints News

See the article here:
Biogen and ViGeneron to Collaborate on Ophthalmic Gene Therapy Development - JD Supra

Recommendation and review posted by Bethany Smith

Ronald Crystal began working in gene therapy in the 1980s, long before the first wave of approvals shook the industry. He took his ideas to Weill Cornell Medicine in 1993, where he helped build a large gene therapy program and spent more than a decade developing potential candidates.

Now, the gene therapy long hauler is launching his own company, Lexeo Therapeutics, with an $85 million Series A to drive three of the companys AAV-administered candidates to market, it said Thursday. Crystal will take the role of chief scientific adviser with Pfizer veteran Nolan Townsend joining as CEO.

These three clinical programs are really the focus of the company and the Series A financing, Townsend told Endpoints News.However, Lexeo has even more candidates waiting in the wings.

Townsend, who hails from Pfizers rare disease program, was introduced to Crystal via a mutual contact. He served in a variety of roles in his 12 years at the pharma giant, including as president of rare disease in North America and other developed markets, country manager in several nations, and director of business operations for Asia-established products. But what attracted him to Lexeo was the opportunity to go after both rare and common diseases.

I saw the potential of this research platform to address a number of rare diseases that do not have adequate therapies today, but also the potential of this platform to address non-rare diseases, he said.

To lead the fledgling team, Crystal and Townsend assembled a seasoned brain trust, including chairman Steven Altschuler, who previously served as chairman of gene therapy pioneer Spark Therapeutics, and PTC Therapeutics vet Jay Barth as executive VP and CMO.

The New York City-based biotech, whose name is a nod to its Lexington Avenue roots, already has two candidates in the clinic: LX1004, which has completed a Phase I/II study and is headed for a pivotal trial in 2022, in CLN2 Batten disease, an autosomal recessive lysosomal storage disease; and LX100, currently in Phase I for APOE4-associated Alzheimers disease. Lexeos third highlighted candidate, an IV-administered treatment for Friedreichs ataxia (FA) dubbed LX2006 is expected to enter Phase I this year. FA is a rare, degenerative multi-system disorder caused by a gene mutation that disrupts the normal production of the protein frataxin, critical to the function of mitochondria in a cell.

The upstart has up to 15 more undisclosed gene therapy programs at different stages of development, according to Townsend and Crystal. Plus, they intend to maintain an ongoing research collaboration with Weill Cornell to bolster their preclinical pipeline.

Lexeos AAV mediated gene therapy programs have the potential for broad applicability across a range of therapeutic indications, and in a single company pipeline present an opportunity for the natural evolution of gene therapy from rare genetic conditions to more common diseases, Crystal said in a statement.

The founder still serves as chairman of Weills Department of Genetic Medicine and will look to continue building Lexeos team in the near future.

We have less than 10 people in the company today. I think were expanding rapidly, so that that number will increase significantly over the next 12 months, Townsend said.

The Series A was led by Longitude Capital and Omega Funds, and joined by Lundbeckfonden Ventures, PBM Capital, Janus Henderson Investors, Invus, Woodline Partners, the Alzheimers Drug Discovery Foundation and Alexandria Venture Investments.

See the original post:
With decades in gene therapy under his belt, Ronald Crystal launches new venture with up to 18 candidates in the pipe - Endpoints News

Recommendation and review posted by Bethany Smith

GeneOne Life Science Inc. said Friday it has signed a contract to supply plasmid DNA therapy worth $2 million to a U.S. biopharmaceutical company.

GeneOnes subsidiary VGXI, a leading plasmid DNA manufacturer located in Texas, will supply the drugs to the American market under the contract. The name of the U.S. firm is confidential due to contractual reasons, a GeneOne official told Korea Biomedical Review.

A plasmid is a small, extrachromosomal DNA molecule in a single cell, physically separated from chromosomal DNA, which replicates independently. It may be used for gene transferring as a potential treatment in gene therapy.

Due to the strikingly noticeable growth in gene therapy research and development worldwide, the demand for cGMP of Plasmid DNA, a raw material for producing gene therapy drugs, is increasing at a rapid pace, a GeneOne official said. These DNAs are used to manufacture adeno-specific virus gene therapy, CAR-T gene therapy, and genetic scissors therapy.

GeneOne is constructing new facilities at its production facility sites in Texas, such as quality assessment laboratories, refining and charging, packaging facilities, and working offices and convenient facilities to increase the quality of its products, according to the company.

We expect our partner, VGXI, to supply more of our high-quality plasmids in large quantity, as a leading manufacturer, GeneOne CEO Park Young-keun said.

Continued here:
GeneOne to supply plasmid DNA therapy worth $2 million to US - Korea Biomedical Review

Recommendation and review posted by Bethany Smith

The massive growth of gene therapy research and development over the last few years has boosted demand for viral vectors, the engineered virusesused to deliver therapeutic genes into patients bodies.

Tokyo-based Fujifilm Diosynth Biotechnologies is stepping up to meet that demand.

Fujifilm will invest 4 billion yen ($40 million) to build a new manufacturing facility for viral vectors in Watertown, Massachusetts, the company said Monday. It will be Fujifilms third viral-vector manufacturing site, joining similar facilities the company has opened in Texas and the U.K.

Virtual Clinical Trials Summit: The Premier Educational Event Focused on Decentralized Clinical Trials

In this virtual environment, we will look at current and future trends for ongoing virtual trials, diving into the many ways companies can improve patient engagement and trial behavior to enhance retention with a focus on emerging technology and harmonized data access across the clinical trial system.

We are strategically establishing this facility in the greater-Boston area where there is a high concentration of biopharmaceutical companies and academia innovating in the field of advanced therapies, Martin Meeson, CEO of Fujifilm Diosynth Biotechnologies, said in a statement.

RELATED: The top 10 manufacturers in the fight against COVID-19 Fujifilm Diosynth Biotechnologies

Fujifilm Diosynth Biotechnologies planted a flagin viral vectors back in 2014, when it established its Texas site in College Station. As the market started to grow, the company invested an additional 13 billion yen ($120 million) in the site. It announced in October that it would add viral-vector manufacturing capabilities to its U.K. site, expecting those services to be online this spring.

The growth of gene therapy R&D has boosted demand for advanced manufacturing capabilities to the point that investors from all facets of biopharma are stepping in to provide services. Last January, for example, Nationwide Childrens Hospitals Abigail Wexner Research Institute (AWRI) in Columbus, Ohio, revealed a planto builda commercial-scale gene therapy manufacturing site.

That news came just months after Harvard University said it would invest $50 million in a not-for-profit manufacturing and training facility focused on cell and viral vectors. Fujifilm Diosynth Biotechnologies has a seat on the board of that organization, called Advanced Biological Innovation and Manufacturing.

RELATED: $50M cell and viral vector manufacturing operation backed by Harvard

Fujifilm is far from the only contract manufacturer answering the demand for viral vectors, either. Novartis and Pfizer ramped up their investments in gene therapy manufacturing last year. Contract manufacturers such as Catalent and Thermo Fisher Scientific are also expanding operations aimed at supporting gene therapy R&D.

Fujifilms Watertown site will start process development this fall, the company said. It expects to start offering contract manufacturing for early-stage clinical trials of therapies that use viral vectors in the fall of 2023.

Read more here:
Fujifilm triples down on viral vector manufacturing with new $40M Boston site - FiercePharma

Recommendation and review posted by Bethany Smith

ROCKVILLE, Md., Jan. 5, 2021 /PRNewswire/ --REGENXBIO Inc. (Nasdaq: RGNX) today provided an update on the RGX-314 programs, including the announcement that the pivotal program for RGX-314 for the treatment of wet age-related macular degeneration (wet AMD) is now active. In addition, REGENXBIO announced a new program, RGX-202, a novel, potentially best-in-class, one-time gene therapy for the treatment of Duchenne Muscular Dystrophy (DMD).

"2020 was a very productive year at REGENXBIO, and we are excited to move into 2021, which we expect to be another year of clinical execution. The initiation of our first pivotal program for RGX-314 for the treatment of wet AMD is a great step forward for the field as we look to broaden the applicability of gene therapy to larger patient populations. In addition, we are excited to announce RGX-202, a potential one-time gene therapy for the treatment of DMD. RGX-202 is the first gene therapy program in the REGENXBIO pipeline to be developed under the leadership of our Chief Scientific Officer, Olivier Danos. We look forward to filing an IND for this program later this year," said Kenneth T. Mills, President and Chief Executive Officer of REGENXBIO. "We continue to advance our pipeline of innovative therapies in the clinic as well as our manufacturing capabilities. I would also like to express my deep gratitude to our employees and clinical partners as well as patients and their families for their ongoing commitment and support despite the challenges posed by the global COVID-19 pandemic."

Pivotal Program for RGX-314 for the Treatment of wet AMD

REGENXBIO today announced that ATMOSPHERE, the first of two planned pivotal trials to evaluate RGX-314, is active and patient screening is ongoing. RGX-314 is a potential best-in-class, one-time gene therapy for the treatment of wet AMD.

REGENXBIO completed an End of Phase 2 meeting with the FDA to discuss the details of a pivotal program to support a Biologics License Application (BLA). Based on discussions with the FDA, REGENXBIO plans to conduct two randomized, well-controlled clinical trials to evaluate the efficacy and safety of RGX-314 in patients with wet AMD, enrolling approximately 700 patients total. In addition, REGENXBIO and the FDA aligned on a clear path to support manufacturing plans in the pivotal program. REGENXBIO expects to submit a BLA based on these trials in 2024.

"We are pleased to have reached alignment with the FDA on key elements of our pivotal program for the treatment of wet AMD. Our plan allows us to further accelerate the clinical development of RGX-314 towards the goal of a BLA filing in 2024 and we have already begun site activation and patient screening for our first planned pivotal trial," said Steve Pakola, M.D., Chief Medical Officer of REGENXBIO. "We have strengthened the key design elements for the planned trials based on the long-term data from our dose-escalation Phase I/IIa trial of RGX-314 and believe that we are well-positioned to execute on this pivotal program."

Suprachoroidal Delivery of RGX-314 for the Treatment of Wet AMD and Diabetic Retinopathy (DR)

New Program for the Treatment of Duchenne Muscular Dystrophy

REGENXBIO also announced today the development of a potential one-time gene therapy for the treatment of DMD, which is based on a novel microdystrophin construct.

"DMD is a severe, degenerative disease affecting thousands of children worldwide. It is caused by mutations of the gene which encodes dystrophin, a protein necessary for muscle cell strength and function, and innovation and development of potential new treatment options for patients with DMD has been a goal for the gene therapy field for many years," said Olivier Danos, Ph.D., Chief Scientific Officer of REGENXBIO. "Since I joined REGENXBIO, we have been working to develop this gene therapy candidate using our proprietary AAV8 vector, with a focus on including the C-Terminal Domain of dystrophin, which may potentially bolster the key cell signaling pathways and muscle membrane integrity, leading to improved muscle strength and resistance. We look forward to completing the IND-enabling studies and bringing this program into the clinic."

The design of the new RGX-202 microdystrophin transgene is based on innovative vector engineering by REGENXBIO scientists and incorporates learnings from the laboratory of George Dickson, Emeritus Professor of Molecular Cell Biology at Royal Holloway, University of London, a pioneering figure in dystrophin research.

"The data from dystrophic laboratory trials suggest that a gene therapy delivering a microdystrophin gene incorporating an extended coding region from the C-Terminal Domain such as RGX-202 may provide substantial added muscle function for patients with DMD. A blend of the innovative science applied to microdystrophin gene design, and an AAV vector that is well-established, makes this new approach very promising," said Professor George Dickson from Royal Holloway. "I am pleased to see this important science developing from Royal Holloway's research is now being advanced under the leadership and gene therapy expertise of Olivier Danos and the team from REGENXBIO. I look forward to seeing this program enter the clinic."

Financial Guidance

REGENXBIO expects to report that as of December 31, 2020, it had between $515 million and $530 million in cash, cash equivalents and marketable securities, including the $200 million upfront payment from REGENXBIO's royalty monetization agreement with entities managed by Healthcare Royalty Management, LLC. REGENXBIO expects these resources to fund its operations, including the completion of its internal manufacturing capabilities and clinical advancement of its product candidates, until late 2022.

About REGENXBIO Inc.

REGENXBIO is a leading clinical-stage biotechnology company seeking to improve lives through the curative potential of gene therapy. REGENXBIO's NAV Technology Platform, a proprietary adeno-associated virus (AAV) gene delivery platform, consists of exclusive rights to more than 100 novel AAV vectors, including AAV7, AAV8, AAV9 and AAVrh10. REGENXBIO and its third-party NAV Technology Platform Licensees are applying the NAV Technology Platform in the development of a broad pipeline of candidates in multiple therapeutic areas.

About Wet AMD

Wet AMD is characterized by loss of vision due to new, leaky blood vessel formation in the retina. Wet AMD is a significant cause of vision loss in the United States, Europe and Japan, with up to 2 million people living with wet AMD in these geographies alone. Current anti-VEGF therapies have significantly changed the landscape for treatment of wet AMD, becoming the standard of care due to their ability to prevent progression of vision loss in the majority of patients. These therapies, however, require life-long intraocular injections, typically repeated every four to 12 weeks in frequency, to maintain efficacy. Due to the burden of treatment, patients often experience a decline in vision with reduced frequency of treatment over time.

About RGX-314

RGX-314 is being developed as a potential one-time treatment for wet AMD, diabetic retinopathy, and other chronic retinal conditions. RGX-314 consists of the NAV AAV8 vector, which encodes an antibody fragment designed to inhibit vascular endothelial growth factor (VEGF). RGX-314 is believed to inhibit the VEGF pathway by which new, leaky blood vessels grow and contribute to the accumulation of fluid in the retina.

REGENXBIO is advancing two separate routes of administration of RGX-314 to the eye, through a standardized subretinal delivery procedure as well as delivery to the suprachoroidal space. REGENXBIO has licensed certain exclusive rights to the SCS Microinjector from Clearside Biomedical, Inc. to deliver gene therapy treatments to the suprachoroidal space of the eye.

About ATMOSPHERE

ATMOSPHERE is a multi-center, randomized, active-controlled trial to evaluate the efficacy and safety of a single-administration of RGX-314 versus standard of care in patients with wet AMD. The trial is designed to enroll 300 patients at a 1:1:1 ratio across two RGX-314 dose arms (6.4x1010 genome copies (GC)/eye and 1.3x1011 GC/eye delivered subretinally) and an active control arm of monthly intravitreal injections of ranibizumab (0.5 mg/eye). The primary endpoint of the trial is non-inferiority to ranibizumab based on change from baseline in Best Corrected Visual Acuity (BCVA) at 54 weeks. Secondary endpoints of the trial include safety and tolerability, change in central retinal thickness (CRT) and need for supplemental anti-VEGF injections. Patient selection criteria will include patients with wet AMD who are responsive to anti-VEGF treatment and will be independent of preexisting neutralizing antibody status. Patients will not receive prophylactic immune suppressive corticosteroid therapy before or after administration of RGX-314. The trial will be conducted at approximately 60 clinical sites based in the United States, with over 100 retinal surgeons.

About AAVIATE

AAVIATE is a multi-center, open-label, randomized, active-controlled, dose-escalation trial that will evaluate the efficacy, safety and tolerability of suprachoroidal delivery of RGX-314 using the SCS Microinjector, a targeted, in-office route of administration. The trial is expected to enroll approximately 40 patients with severe wet AMD across two cohorts. Patients in each cohort will be randomized to receive RGX-314 versus monthly 0.5 mg ranibizumab intravitreal injection at a 3:1 ratio, and two dose levels of RGX-314 will be evaluated: 2.5x1011GC/eye and 5x1011GC/eye. Patients will not receive prophylactic immune suppressive corticosteroid therapy before or after administration of RGX-314. The primary endpoint of the trial is mean change in vision in patients dosed with RGX-314, as measured by best corrected visual acuity (BCVA), at Week 40 from baseline, compared to patients receiving monthly injections of ranibizumab. Other endpoints include mean change in central retinal thickness (CRT) and number of anti-VEGF intravitreal injections received following administration of RGX-314.

About ALTITUDE

ALTITUDE is a multi-center, open label, randomized, controlled dose-escalation trial that will evaluate the efficacy, safety and tolerability of suprachoroidal delivery of RGX-314. The trial is expected to enroll approximately 40 patients with DR across two cohorts. Patients will be randomized to receive RGX-314 versus observational control at a 3:1 ratio, and two dose levels of RGX-314 will be evaluated: 2.5x1011GC/eye and 5.0x1011GC/eye. Patients will not receive prophylactic immune suppressive corticosteroid therapy before or after administration of RGX-314. The primary endpoint of the trial is the proportion of patients that improve in DR severity based on the Early Treatment Diabetic Retinopathy Study-Diabetic Retinopathy Severity Scale (ETDRS-DRSS) at 48 weeks. Other endpoints include safety and development of DR-related ocular complications.

About Duchenne Muscular Dystrophy

DMD is a severe, progressive, degenerative muscle disease, affecting 1 in 3,500 to 5,000 boys born each year worldwide. DMD is caused by mutations in the DMD gene which encodes for dystrophin, a protein involved in muscle cell structure and signaling pathways. Without dystrophin, muscles throughout the body degenerate and become weak, eventually leading to loss of movement and independence, required support for breathing, cardiomyopathy and premature death.

About RGX-202

RGX-202 is designed to deliver a novel microdystrophin transgene which retains key elements of the dystrophin protein, including an extended coding region of the C-Terminal (CT) domain found in naturally-occurring dystrophin, as well as other fundamental improvements to the transgene. Presence of the CT domain has been shown to recruit several key proteins to the muscle cell membrane, leading to improved muscle resistance to contraction-induced muscle damage in dystrophic mice. Additional design features, including codon optimization and reduction of CpG content, may potentially improve gene expression, increase translational efficiency and reduce immunogenicity. RGX-202 is designed to use the NAV AAV8 vector, a vector used in numerous clinical trials, and a well-characterized muscle specific promoter (Spc5-12) to support the delivery and targeted expression of genes throughout skeletal and heart muscle.

Forward-Looking Statements

This press release includes "forward-looking statements," within the meaning of Section 27A of the Securities Act of 1933, as amended, and Section 21E of the Securities Exchange Act of 1934, as amended. These statements express a belief, expectation or intention and are generally accompanied by words that convey projected future events or outcomes such as "believe," "may," "will," "estimate," "continue," "anticipate," "design," "intend," "expect," "could," "plan," "potential," "predict," "seek," "should," "would" or by variations of such words or by similar expressions. The forward-looking statements include statements relating to, among other things, REGENXBIO's future operations and clinical trials. REGENXBIO has based these forward-looking statements on its current expectations and assumptions and analyses made by REGENXBIO in light of its experience and its perception of historical trends, current conditions and expected future developments, as well as other factors REGENXBIO believes are appropriate under the circumstances. However, whether actual results and developments will conform with REGENXBIO's expectations and predictions is subject to a number of risks and uncertainties, including the timing of enrollment, commencement and completion and the success of clinical trials conducted by REGENXBIO, its licensees and its partners, the timing of commencement and completion and the success of preclinical studies conducted by REGENXBIO and its development partners, the timely development and launch of new products, the ability to obtain and maintain regulatory approval of product candidates, the ability to accurately predict how long REGENXBIO's existing cash resources will be sufficient to fund its anticipated operating expenses, the ability to obtain and maintain intellectual property protection for product candidates and technology, trends and challenges in the business and markets in which REGENXBIO operates, the size and growth of potential markets for product candidates and the ability to serve those markets, the rate and degree of acceptance of product candidates, the impact of the COVID-19 pandemic or similar public health crises on REGENXBIO's business, and other factors, many of which are beyond the control of REGENXBIO. Refer to the "Risk Factors" and "Management's Discussion and Analysis of Financial Condition and Results of Operations" sections of REGENXBIO's Annual Report on Form 10-K for the year ended December 31, 2019, and comparable "risk factors" sections of REGENXBIO's Quarterly Reports on Form 10-Q and other filings, which have been filed with the U.S. Securities and Exchange Commission (SEC) and are available on the SEC's website at http://www.sec.gov. All of the forward-looking statements made in this press release are expressly qualified by the cautionary statements contained or referred to herein. The actual results or developments anticipated may not be realized or, even if substantially realized, they may not have the expected consequences to or effects on REGENXBIO or its businesses or operations. Such statements are not guarantees of future performance and actual results or developments may differ materially from those projected in the forward-looking statements. Readers are cautioned not to rely too heavily on the forward-looking statements contained in this press release. These forward-looking statements speak only as of the date of this press release. REGENXBIO does not undertake any obligation, and specifically declines any obligation, to update or revise any forward-looking statements,whether as a result of new information, future events or otherwise.

SCS Microinjector is a trademark of Clearside Biomedical, Inc. All other trademarks referenced herein are registered trademarks of REGENXBIO.

Preliminary Financial Information

REGENXBIO reports its financial results in accordance with U.S. generally accepted accounting principles. All financial data in this press release for the year ended December 31, 2020 is preliminary, as financial close procedures for the year ended December 31, 2020 are not yet complete. These estimates are not a comprehensive statement of the financial position of REGENXBIO for the year ended December 31, 2020. Actual results may differ materially from these estimates as a result of the completion of normal year-end accounting procedures and adjustments, including the execution of REGENXBIO's internal control over financial reporting, the completion of the preparation and management's review of REGENXBIO's financial statements for the year ended December 31, 2020 and the subsequent occurrence or identification of events prior to the filing of the financial results for the year ended December 31, 2020 on Form 10-K with the SEC.

Contacts:

Tricia TruehartInvestor Relations and Corporate Communications347-926-7709[emailprotected]

Investors:Eleanor Barisser, 212-600-1902[emailprotected]

Media:David Rosen, 212-600-1902[emailprotected]

1Koo, Taeyoung et al. "Delivery of AAV2/9-microdystrophin genes incorporating helix 1 of the coiled-coil motif in the C-terminal domain of dystrophin improves muscle pathology and restores the level of 1-syntrophin and -dystrobrevin in skeletal muscles of mdx mice." Human gene therapy vol. 22,11 (2011): 1379-88. doi:10.1089/hum.2011.020

SOURCE REGENXBIO Inc.

See the article here:
REGENXBIO Announces Update on RGX-314 and Pivotal Program for the Treatment of Wet AMD and New Gene Therapy Program for the Treatment of Duchenne...

Recommendation and review posted by Bethany Smith

INTRODUCTION

Tuberous sclerosis complex (TSC) is a hereditary disease affecting multiple organs with an incidence of about 1 of 5500 (1, 2), resulting from mutations in either TSC1 encoding hamartin or TSC2 encoding tuberin. Hamartin and tuberin normally act as a complex to inhibit mTORC1 (mammalian/mechanistic target of rapamycin complex 1) through guanosine triphosphatase (GTPase) activating effects on Ras homolog enriched in brain (Rheb) (3). When a mutation in the corresponding normal TSC1 or TSC2 allele occurs somatically in susceptible cells, they enlarge and proliferate causing abnormal development and tissue lesions. These secondary mutations can occur prenatally or after birth in different cell types, and the timing and frequency of these hits affect the severity of the disease in a stochastic manner. Neurodevelopmental manifestations are responsible for the greatest morbidity, including severe, refractory epilepsy and hydrocephalus, as well as autism (40%), cognitive impairment (50%), and mental health issues (70%) (46). In addition, renal angiomyolipomas forming later in life can cause life-threatening hemorrhage and/or renal failure, and pulmonary lymphangioleiomyomatosis can severely compromise respiratory function. Current treatments include surgical resection and/or treatment with rapamycin analogs (rapalogs). Although often well tolerated, rapalogs cause immune suppression (7) and potentially compromise early brain development (8), and lifelong therapy is often required. Therefore, there is a clear need to identify other therapeutic approaches for TSC.

Adeno-associated virus (AAV) vectors have been used widely in clinical trials for many hereditary diseases with little-to-no toxicity, long-term action in nondividing cells, and improvement in symptoms (911). Benefit can be seen after a single injection and some serotypes, e.g., AAV9, AAVrh8, and AAVrh10, can efficiently enter the brain, as well as peripheral organs after intravenous (IV) injection (12, 13). The insert capacity of AAV vectors is about 4.7 kb (including promoter, transgene, polyadenylation (poly A) sequence, and other regulatory elements), and the complementary DNA (cDNA) for tuberin (5.4 kb) cannot be accommodated. We generated a cDNA encoding a shorter form of tuberin, termed cTuberin. We tested its lack of toxicity and ability to bind to hamartin and Rheb1, as well as to suppress phosphoS6 kinase activity in cultured cells. In a stochastic mouse model of TSC2 [based on a TSC1 model; (14)], AAV vector encoding Cre recombinase was introduced by intracerebroventricular (ICV) injection into homozygous Tsc2-floxed mice (15) at postnatal day 0 (P0) typically leading to death at about P58 with enlarged ventricles. Near-normal life span and reduction of brain pathology were achieved in most of these animals by a single IV injection of an AAV9 vector encoding cTuberin under a strong, constitutive promoter. These studies demonstrate the ability of cTuberin to suppress overgrowth of tuberin-null cells, including neural cells and, presumably, other cells in the body, and, hence, support the preclinical efficacy of AAV-cTuberin for TSC2 lesions.

Whereas hamartin is encoded in a cDNA of 3.5 kb, which fits into an AAV vector (16), the cDNA for tuberin (5.4 kb) is too large. To generate a potentially functional form of tuberin encoded in a shorter cDNA, we retained the N-terminal domain that binds to hamartin and the C-terminal domain containing GAP (GTPase-activating protein) activity that inhibits Rheb, with N-terminal region and phosphorylation of the C-terminal region of tuberin also thought to regulate formation of the complex with hamartin Fig. 1A (3, 1720). The potential for cTuberin to retain some functional activity was supported by findings of Momose et al. (21) that genomic overexpression of the C-terminal region of rat tuberin (amino acids 1425 to 1755) can suppress renal tumors in the Tsc2 Eker rat model. We felt it was also important to retain the hamartin-binding domain at the N terminus, as hamartin and tuberin function together as a complex with Tre2-Bub2-Cdc16 (TBC) 1 domain family, member 7 (TBC1D7) to accelerate guanosine triphosphate (GTP) to guanosine diphosphate conversion of Rheb-GTP (3, 22). In addition, this requirement for complex formation for activity might act to limit potential negative effects of high levels of transgenic cTuberin expression. cTuberin was thus designed to retain key elements of function, including 450 amino acids from the N-terminal region and 292 amino acids from the C-terminal region, joined by a flexible serine-glycine linker of 16 amino acids (fig. S1). This cDNA, with a Kozak sequence, and a C-terminal c-Myc tag was inserted into an AAV2 backbone under a chicken -actin (CBA) promoter (23), with a WPRE (woodchuck hepatitis virus posttranscriptional regulatory element) and poly A signals (Fig. 1B).

(A) The functional domains of tuberin are depicted with numbers representing amino acid residues for the full-length human proteins [based on (3)]. T1BD, hamartin-binding domain; GAP, GAP domain homologous with that in Rap1GAP. cTuberin contains the T1BD and GAP domains of TSC2 with a glycine-serine linker and C-terminal c-Myc tag. (B) Schematic of AAV-cTuberin transgene expression cassette. ITR, inverted terminal repeats; CBA, chicken -actin promoter; WPRE, woodchuck hepatitis virus posttranscriptional regulatory element; pA, poly A signal sequences [from SV40 and bovine growth hormone (BGH)].

Human embryonic kidney (HEK) 293T cells were transfected with plasmids for empty AAV (AAV1-null that contains all the elements except the cTuberin cDNA), AAV-CBAgreen fluorescent protein (GFP), or AAV-CBA-cTuberin-Myc to assess the expression level of cTuberin. In addition to endogenously expressed tuberin (200 kDa), cTuberin expression at the appropriate molecular weight (MW) of 85 kDa was detected on Western blots using anti-tuberin and anti-Myc antibodies (Fig. 2A; representative blot, n = 3) Immunocytochemistry of 293T cells transfected with different plasmids demonstrated stronger tuberin immunoreactivity in those transfected with AAV-CBA-cTuberin-Myc compared to other groups that expressed only endogenous tuberin (Fig. 2B; representative micrographs, n = 3). We determined transfection efficiency of these cells in two waysmicroscopically and by flow cytometry. As it is challenging to differentiate expression of endogenous tuberin from cTuberin, image analysis was carried out microscopically for each well (approximately 2000 cells per well; n = 3) for 4,6-diamidino-2-phenylindole (DAPI)positive and c-Mycpositive cells, and we determined that 43 2% of cells were transfected with the AAV-CBA-cTuberin-Myc (Fig. 2B). Cytotoxicity assays were also performed following transfection of HEK293T cells with AAV-null, AAV-CBA-GFP, or AAV-CBA-cTuberin-Myc plasmids to evaluate potential toxicity of cTuberin. The lactate dehydrogenase (LDH) assay (Dojindo Molecular Technologies Inc., Rockville, MD, USA) revealed no cytotoxicity in cTuberin-transfected cells, as compared to controls (Fig. 2C; n = 3). As a second way to evaluate the extent of transfection of these 293T cells with AAV-CBA-cTuberin-Myc plasmid DNA (n = 3), we sorted the c-Mycpositive cells using flow cytometry, after staining the cells with unlabeled c-Myc primary antibody followed by Alexa Fluor 647conjugated secondary antibody. Compared to the background in nontransfected cells (4 1%), we detected a marked increase of c-Mycpositive cells (50 1% or 46% minus the background, similar to the 43% determined by cell counting) after transfection with the AAV-CBA-cTuberin-Myc plasmid (P < 0.0001) (Fig. 2D). This suggests that the apparently endogenous levels of cTuberin reflect 43 to 46% transfection efficiency and that levels of cTuberin are about twice as high as endogenous tuberin in these transfected cells, without apparent toxicity.

(A) HEK293T cells were transfected with empty AAV (AAV-null), AAV-CBA-GFP, or AAV-cTuberin-Myc (AAV-CBA-cTub-Myc) plasmids. Representative Western blot (WB) (from n = 3 experiments) shows endogenous tuberin (~200 kDa) using anti-tuberin antibody and cTuberin-Myc (predicted 85 kDa) using anti-tuberin and anti-Myc antibodies. -Actin served as a loading control. (B) HEK293T cells were transfected with AAV-null and AAV-cTub-Myc plasmids and immunostained 72 hours later for tuberin (red) and c-Myc (green) with nuclear DAPI (blue). Scale bar, 100 m. The bar graph (bottom right) summarizes the cell count analysis (43 2% of the AAV-cTuberin-Myctransfected cells expressed c-Myc). (C) Cell death was quantified 72 hours after transfection using the Cytotoxicity LDH Assay Kit. Each bar represents the mean SD. (n = 3). ****P < 0.0001, compared with the positive apoptotic control (Bortezomib, 100 nM). (D) To further quantify transfection efficiency, HEK293T cells were transfected with AAV-CBA-cTub-Myc plasmid for 72 hours (n = 3 experiments) followed by sorting for the c-Mycpositive cells using flow cytometry. There was a significant increase in c-Mycpositive cells (50 1%) in the transfected cells (P < 0.0001) as compared to the nontransfected cells (4 1%). ****P < 0.0001.

COS-7 cells were cotransfected with plasmids for empty AAV (AAV-null), Myc-tagged full-length tuberin (Myc-FL-tuberin), AAV-CBA-cTuberin-Myc, Myc-tagged glycogen synthase kinase-3 (Myc-GSK-3), FLAG-tagged hamartin, and/or hemagglutinin (HA)tagged glutathione S-transferase (GST)tagged Rheb1 (HA-GST-Rheb1). Coimmunoprecipitation experiments performed with anti-Myc antibody showed that Myc-tagged cTuberin bound to FLAG-tagged hamartin and HA-tagged GST-Rheb1 to the same extent as Myc-FL-tuberin (Fig. 3). Myc-tagged GSK-3, used as a negative control, did not bind to FLAG-tagged hamartin or HA-tagged GST-Rheb1. These results indicated that cTuberin binds to hamartin and Rheb1 in cells, supporting a similarity in these biochemical parameters between cTuberin and full-length tuberin.

Representative blot (n = 3 experiments) after cotransfection of the Myc-tagged cTuberin (AAV-CBA-cTub-Myc) or full-length tuberin (Myc-FL-tuberin) along with FLAG-tagged hamartin and HA-tagged GST-Rheb1. Coimmunoprecipitation (co-IP) using anti-Myc antibody demonstrated that cTuberin-Myc interacts with both Flag-hamartin and HA-Rheb1 similar to Myc-FL-tuberin. Conversely, negative control Myc-GSK-3 showed no interaction with FLAG-hamartin or HA-GST-Rheb1.

For functional assessment tuberin and cTuberin on mTORC1 activity in vitro, we evaluated S6K T389 phosphorylation in cells expressing these proteins, together with hamartin and S6K, as described (24, 25). To determine whether cTuberin overexpression could inhibit mTORC1 activation, the Myc-tagged cTuberin plasmid was cotransfected with Flag-tagged hamartin and HA-tagged p70S6K (HA-S6K) reporter plasmids into HEK293T cells. As a control, a plasmid encoding Flag-tagged full-length tuberin was cotransfected with Flag-hamartin and HA-S6K plasmids. Hamartin and full-length tuberin coexpression inhibited phosphorylation of S6K T389, as expected, and similarly, coexpression of hamartin and cTuberin also decreased pS6K T389 levels (Fig. 4A), supporting the ability of cTuberin to bind to hamartin and efficaciously inhibit TORC1 activity. Level of pS6K T389 inhibition was quantified relative to HA-S6K using Fiji/ImageJ. Flag-hamartin cotransfected with AAV-GFP served as a control (normalized to 1.0), and cotransfection with full-length tuberin and cTub-Myc revealed a significant inhibition of S6K T389 phosphorylation by 69 and 56%, respectively (*P < 0.05; n = 3 separate experiments).

(A) Full-length Flag-tagged tuberin (Flag-tuberin), Myc-tagged cTuberin (AAV-cTub-Myc), or AAV-GFP plasmids were cotransfected into HEK293T cells along with full-length Flag-tagged hamartin (Flag-hamartin) and HA-tagged p70S6K (HA-p70S6K), which is phosphorylated at T389 by mTORC1 (latter used as a reporter for mTORC1 activation). Representative blot (n = 3 experiments) demonstrated similar inhibition levels of phosphorylated p70S6K (pS6K T389) with either full-length tuberin or cTub-Myc cotransfected with full-length hamartin. (B) Quantitation of decrease in S6K T389 phosphorylation was performed relative to HA-S6K using Fiji/ImageJ. Flag-hamartin cotransfected with AAV-GFP served as a control (normalized to 1.0), and cotransfection with full-length tuberin or cTub-Myc revealed inhibition of 69 or 56%, respectively, representing the results from three experiments. *P < 0.05.

To evaluate preclinical efficacy of the AAV9-CBA-cTuberin-Myc vector (hereafter referred to as AAV9-cTuberin), Tsc2 homozygous floxed mice (referred to as Tsc2-floxed or Tsc2flox) were first injected ICV at P0 with an AAV1-CBA-Cre recombinase vector (1 1012 vg/kg) to inactivate Tsc2 in a subset of neurons, astrocytes, and other cells in the brain (16). At P21, these AAV1-Creinjected mice were injected IV (retro-orbitally) with AAV9-cTuberin vector (9 1011 vg/kg) or AAV9-null vector (1 1013 vg/kg) and were compared to control animals that did not receive any IV injection. Tsc2-floxed AAV1-Creinjected (P0) mice had a median survival of 58 days, as did similar mice injected IV at P21 with AA9-null vector (mean survival of 58 days), mice injected IV at P21 with AAV9-cTuberin vector had the median survival of 462 days (P < 0.0001) (Fig. 5A). We also tested the potential toxicity of this dose of AAV9-cTuberin alone by injecting six Tsc2-floxed mice IV at P21 (in the absence of AAV1-Cre induced loss of Tsc2 at P0). All six mice survived over 500 days without apparent toxicity (Fig. 5A).

(A) Tsc2-floxed mouse pups were injected ICV with an AAV1-Cre vector (1 1012 vg/kg) at P0 to induce tuberin loss in multiple cell types in the brain. At 21 days, mice were injected IV with either AAV9-cTuberin (9 1011 vg/kg; n = 12) or AAV9-null (1 1013 vg/kg; n = 6) or noninjected (n = 6). Median survival of the AAV-cTuberin-injected mice (462 days, red line) was significantly longer than the non-cTuberin-injected mice (58 days, black line) (****P < 0.0001). Mice injected secondarily with the AAV9-null vector also died on average by 58 days (gray). Pups injected only with AAV9-cTuberin (no AAV1-Cre) all lived over 500 days. For (B) and (C), AAV1-Cre ICV (1 1010 vg/kg) was injected at P1 only or followed with AAV9-cTuberin (8 1012 vg/kg) IV at P21. (B) Body weights of Tsc2-floxed mice injected with AAV1-Cre vector, with and without AAV9-cTuberin vector, or noninjected were similar from P21 to P50. (C) For the rotarod test, the motor function of the Tsc2-floxed AAV1-Creinjected mice rescued by AAV9-CBA-cTuberin vectors was significantly better than that of the AAV1-Cre group and noninjected group. **P < 0.005. ns, not significant.

Different cohorts of mice were subjected to body weight measurement and motor function assessment starting at P21/22 for nave, noninjected animals, AAV1-Cre ICV injected (1 1010 vg/kg) at P1 only or followed with AAV9-cTuberin injected (8 1012 vg/kg) IV at P21. Body weights of these mice from age 21 to 50 days did not differ according to treatment (Fig. 5B). Movement was assessed using an automated rotarod apparatus with accelerating rotary velocity (4 going to 64 rpm over 2 min) to assess motor skills of the mice as time of latency to fall. A significant increase in latency was observed for the AAV1-Cre + AAV9-cTuberin as compared to the AAV1-Creinjected mice and naive mice (Fig. 5C). During animal handling, two mice of six Tsc2-floxed AAV-Creinjected mice (day 41) and two mice of seven Tsc2-floxed AAV-Creinjected + AAV-cTuberininjected mice (one each on days 47 and 50) manifested straub (vertical tail), humped back, and/or motor seizures, which did not, however, compromise their consequent rotarod performances (fig. S2).

Two other approaches were less effective at extending survival of AAV1-Cre ICVinjected Tsc2-floxed mice. In one, using a similar time scheme (fig. S3), Tsc2-floxed pups were injected with 1 1014 vg/kg AAV1-Cre ICV at P3 and then 3 1012 vg/kg of AAV1-cTuberin (in contrast to AAV9 serotype) IV at P21, with the higher amount of AAV1-Cre (without cTuberin) leading to death with a mean of 36 days and survival only being extended by AAV1-cTuberin to a mean of 54 days. This probably reflects the fact that AAV1 is less efficient at crossing the blood-brain barrier (BBB) than AAV9. In another experiment, the Tsc2-floxed pups were injected ICV with AAV1-Cre (1 1012 vg/kg) at P0, followed by ICV injection (in contrast to systemic injection) of 4.5 1013 vg/kg of AAV9-cTuberin at P3. This approach led to median survival of 50 days in Tsc2-floxed mice without cTuberin injection, while those injected with AAV9-cTuberin had extended median survival only up to 95 days (fig. S4). This experiment raises the possibility that other lesions in the body (in addition to the brain) resulting from ICV injection of AAV1-Cre were associated with death and were not sufficiently alleviated by ICV injection of the cTuberin vector and/or that the high dose AAV-cTuberin injected ICV into P3 pups had some toxicity (26).

In nave (normal) Tsc2-floxed mice, the ventricle is lined by a single layer of ependymal cells (Fig. 6A). Neuropathological examination at P42 revealed that ICV injection of AAV1-Cre in Tsc2-floxed mice at P0 led to multiple layers of ependymal and subependymal cells lining the lateral ventricle (indicating increased proliferation of these cells) (Fig. 6B, asterisk), which sometimes appeared as nodules along the ventricular lining (Fig. 6C). When these AAV1-Creinjected mice were treated with AAV9-cTuberin (IV injected at P21), there was apparent regression of ependymal/subependymal overgrowths (Fig. 6D). We also stained these mouse brain sections (P42) for Ki67 as an indication of cell proliferation. As expected, there was little-to-no proliferation of ependymal/subependymal cells lining the ventricles in the nave brain (Fig. 7A). In contrast, after AAV1-Cre injection at P0, there was marked proliferation of these cells, including apparent migration of dividing cells into the brain parenchyma (Fig. 7B), also seen after subsequent IV injection with AAV9-null vector (Fig. 7C). In contrast, IV injection of the AAV9-cTuberin vector decreased proliferation and inward migration of Ki67+ ependymal/subependymal cells (Fig. 7D).

Tsc2-floxed mouse pups were either not injected (nave) or injected ICV in both ventricles (1 1012 vg/kg) with an AAV1-Cre vector at P0. At 21 days, some mice were injected IV with AAV9-cTuberin (9 1011 vg/kg) or noninjected. At 42 days, all mice were euthanized. (A) Nave, noninjected brain (black arrowhead indicating the choroid plexus). (B and C) Tsc2-floxed mice with AAV1-Cre at P0 and no further injection showed (B) proliferation of ependymal/subependymal cells (asterisk) and (C) subependymal nodules. (D) Little-to-no subependymal overgrowth was detected in mice receiving both the P0 AAV1-Cre ICV injection and P21 IV AAV9-cTuberin injection. Representative images are shown. Magnification bar, 100 m. CC, corpus callosum; LV, lateral ventricle.

Tsc2-floxed mouse pups were either not injected (nave) or injected ICV in both ventricles (1 1012 vg/kg) with an AAV1-Cre vector at P0. At 21 days, some mice were injected IV with AAV9-cTuberin (9 1011 vg/kg), AAV9-null (1 1013 vg/kg) or noninjected. At 42 days, all mice were euthanized. (A) Nave, noninjected brain reveals little-to-no staining in the ependymal/subependymal layers. (B) Tsc2-floxed mice injected with AAV1-Cre vector only showed abnormal mitotic activity and apparent migration of cells (yellow arrows) away from the ventricular zone, as well as multiple ependymal/subependymal layers (green arrowheads) as compared to the nave group. (C) Tsc2-floxed mice injected with AAV1-Cre vector followed by AAV9-null vector showed abnormal mitotic activity of the cells and thickening of the subventricular zone. (D) The Tsc2-floxed mice injected with AAV1-Cre and then rescued with the AAV9-cTuberin vector showed a trend toward normalization of the ependymal/subependymal layer. The corresponding brain sections were counterstained with DAPI. The yellow asterisk denotes autofluorescence in the choroid plexus. Representative images are shown. Magnification bar, 100 m.

The brain sections (P42) were also immunostained for phosphorylated ribosomal protein S6 (pS6). We observed low pS6 expression in the whole brain sections of the noninjected (nave) mouse brain (Fig. 8A, top). In contrast, in AAV1-Cre ICVinjected Tsc2-floxed mice, pS6 expression was intense in many brain cells [Fig. 8, A (middle) and Bi], with the pS6-positive cells being significantly larger in size (Fig. 8Bii) and with a higher pS6 immunofluorescence signal (Fig. 8Biii). When the AAV1-Creinjected mice were subjected to IV injection of the AAV9-cTuberin vector at P21, the pS6 immunoreactive cells were significantly decreased in average size by 23% [P < 0.05; Fig. 8, A (bottom) and Bii] and showed a reduced pS6 signal by 28% (P < 0.05; Fig. 8Biii) consistent with reduced mTOR activity.

Tsc2-floxed mouse pups were either not injected (nave) or injected ICV (1 1012 vg/kg) with an AAV1-Cre vector at P0. At P21, some mice were injected IV with AAV9-cTuberin (9 1011 vg/kg) or noninjected. All were euthanized at P42. (A) Whole mouse brain sections from nave, AAV1-Cre, and AAV1-Cre+ AAV9-cTuberin injected mice stained for pS6 and DAPI. Representative whole brain sections (scale bar, 1 mm; eight-bitthresholded inverted images) indicated absence of pS6 puncta in nave group. In other groups, pS6 puncta appeared as darkened spots within the cerebral cortex and caudate putamen; high magnification inset images (scale bar, 100 m; 12-bitthresholded inverted images). (B) pS6 analysis included puncta density (i), size (ii), and intensity (iii). *P < 0.05; n = 3. a.u., arbitrary units. (C) Compared to nave pups, immunoblotting demonstrated AAV1-Cremediated decrease of tuberin (54%) and increase in pS6 (76%) in Tsc2-floxed mice injected with AAV1-Cre, relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with nave brain as control (normalized to 1.0; *P < 0.05; n = 3). (Di) Ct values for biodistribution of AAV vector genomes in the brain and liver measured by qPCR. (Dii) Ct value of GAPDH and cTuberin cDNAs in brains of nave animals injected with AAV1-Cre only or with AAV1-Cre and AAV9-cTuberin. n.d., not determined.

To assess the Cre-mediated loss of tuberin and activation of mTOR activity in vivo, newborn pups (P0, n = 3) were injected ICV with AAV1-CBA-Cre recombinase vector (AAV1-Cre at dosage of 1 1012 vg/kg), and another three noninjected (nave) pups were included as controls. One week after injection of vector, brain protein lysates were collected for immunoblotting with anti-tuberin and anti-pS6 antibodies. There was significant reduction in expression of tuberin by 54% (P < 0.05) and significant increase of pS6 by 76% (P < 0.05) in animals injected with AAV1-Cre, confirming that the Cre recombinase mediates loss of tuberin and activation of mTOR in the treated mice (Fig. 8C).

To examine the vector biodistribution in the injected animals, Tsc2-floxed animals were injected ICV at P0, with an AAV1-CBA-Cre recombinase vector (AAV1-Cre; 1 1012 vg/kg, n = 4). At P21, these AAV1-Creinjected mice were injected IV with AAV9-cTuberin vector (9 1011 vg/kg). One week after injection, DNA was extracted from the brain and liver of these animals. For comparison, another three Tsc2-floxed animals subjected to no injections were used as controls. For quantitative polymerase chain reaction (qPCR) analysis of AAV genomes (probes and primer specific), 50 ng of DNA was used as a template, and primers and probes were designed to amplify the cTuberin in the infected animal (fig. S5). cTuberin DNA was not detected in the noninjected control group (Fig. 8D). Cycle threshold (Ct) values for the Tsc2-floxed animals injected with AAV1-Cre and AAV9-cTuberin vectors were readily detectable with approximately 30.8 2.6 and 17.2 0.2 cycles for brain and liver tissue, respectively (Fig. 8Di). The large difference between the AAV genomes in brain compared to liver is likely due to both the high tropism of systemically injected AAV for the liver and the relatively low dose of vector injected (9 1011 vg/kg). To detect cTuberin transgene expression, total RNA was extracted from the brains and livers of another set of animals, including noninjected controls; Tsc2-floxed animals injected with AAV1-Cre only, and Tsc2-floxed animals injected with AAV1-Cre and AAV9-cTuberin vectors (n = 3 for all groups), with the dosage of AAV1-Cre ICV injected at P1 (1 1010 vg/kg) or combined with AAV9-cTuberin injected IV at P21 (1.8 1012 vg/kg). Quantitative reverse transcription PCR (RT-qPCR) analysis indicated that cTuberin mRNA was undetectable in the noninjected control group and those injected with AAV1-Cre only. In contrast, in both brains and livers, we detected cTuberin mRNA in mice injected with AAV9-cTuberin at levels of Ct 36.8 3 and 34.8 0.5 cycles, respectively (Fig. 8Dii). We did not detect cTuberin cDNA when reverse transcriptase was omitted from the RT reaction, indicating that we were detecting bona fide cTuberin mRNA and not sample contamination with AAV-cTuberin genomes.

This is the first description of an alternative mode of therapy for TSC type 2 (TSC2) involving gene replacement using an AAV vector encoding a condensed form of tuberin, termed cTuberin. We developed a stochastic mouse model for central nervous system (CNS) lesions in TSC2 in which homozygous Tsc2-floxed mice (15, 27) are injected ICV in the newborn period (P0 to P3) with an AAV1 vector expressing Cre recombinase, as described for our stochastic TSC1 model (14). AAV1-Cre injection in the Tsc2-floxed model resulted in death at about 58 days. Death appeared to be due primarily to hydrocephalus caused by ependymal/subependymal overgrowths blocking cerebrospinal fluid flow, with whole-body pathology revealing no overt lesions except in the CNS. Although signs of seizures were noted in a few mice during motor performance assessment, these animals recovered normal activity. Experiments showed that IV injection of AAV9-cTuberin vector into this stochastic Tsc2-floxed mouse model on day 21 extended life span in most mice (9 of 12) to at least 450 days. Histochemical/immunohistochemical analysis of the brains supported a resulting reduction in size of ependymal/subependymal lesions, decreased proliferation of cells in the subependymal zone, and reduced phosphorylation of S6 kinase driven by mTOR activity. This study offers a potential single treatment paradigm for improving the outcome of patients with TSC2.

Limitations to this stochastic Tsc2 mouse model include the fact that floxed alleles (before Cre exposure) are normal in function during prenatal development and that Cre recombinase usually knocks out both alleles in a cell at once, which is different from the case in TSC2 patients, most of whom are heterozygous for one mutant and one normal allele in most-to-all cells in their body. TSC2 heterozygosity itself may compromise some cell functions and contribute to aspects of the disease phenotype (1, 28, 29). Further, the model used here is CNS oriented, with most pathology in the brain; whereas in TSC patients, a number of organs in addition to the brain are affected. In addition, this Tsc2 mouse model does not show all the brain abnormalities observed in human TSC2, many of which form prenatally, such as cortical tubers, disorganized cortical lamination, dysplastic neurons, and giant cells (30). Strengths of this model are that there is loss of tuberin expression in a number of different cell types in the brain with variation for animal to animal, as occurs in patients with TSC. This is in contrast to commonly used models where Tsc2-floxed mice are mated to mice expressing Cre recombinase under a cell-specific promoter, e.g., the synapsin promoter, in which case most and only neurons lose expression at embryonic day 12.5 (31).

The central portion of tuberin that was removed to fit coding sequences into the AAV vector contains a number of phosphorylation sites that are involved in regulating mTOR activity under some circumstances, with three of these sites bearing missense mutations associated with TSC2, suggesting that they may contribute to the disease phenotype or create truncated, nonfunctional proteins (6). By comparison, there is an ortholog of human tuberin in Schizosaccharomyces pombe that lacks about 500 amino acids in the equivalent central region of human tuberin, suggesting that these sites are dispensable to some functions (32). Further, some of the key Akt phosphorylation sites in mammalian tuberin are not essential in Drosophila (33), and phosphorylation sites for Akt, ribosomal protein S6 kinase, and AMP-activated protein kinase (AMPK) in the central region of human tuberin are not present in Schizosaccharomyces or Dictyostelium (34), suggesting that these sites may not be critical for function. Given the critical role of phosphorylation sites in tuberin in growth factor and cytokine signaling in mammalian cells, one would anticipate that cTuberin in TSC2-null cells would lack some of these regulatory controls. However, in the Eker rat model of TSC2, which is prone to renal carcinomas, the C-terminal region alone (amino acids 1425 to 1755) of rat tuberin suppresses tumor formation in a dose-dependent manner (35). Fortunately, in TSC2 patients, only a very small fraction of cells in the body suffer loss of tuberin, and most damage is done by the enlargement and proliferation of these deficient cells. Thus, if overgrowths can be suppressed by cTuberin, then that would bring therapeutic benefit for many of the symptoms of the disease, although the cells would not be fully normalized. So far, in cultured cells, cTuberin has been shown to bind to hamartin, and overexpression of cTuberin was not found to be toxic. cTuberin inhibited mTORC1 signaling in these cells to the same extent as tuberin, supporting the use of cTuberin as an effective replacement for tuberin for some cell properties.

Subependymal nodules (SENs) occur in 10 to 15% of children with TSC, usually appearing after birth and being more severe in TSC2 than TSC1 (3638). SENs can enlarge into subependymal giant cell astrocytomas (SEGAs) during the first decade of life causing obstruction of cerebrospinal fluid flow, potentially leading to life-threatening hydrocephalus, as well as endocrinopathy and visual impairment (36, 37, 39, 40). Under optimal care, infants and children with TSC are monitored for subependymal lesions by magnetic resonance imaging (MRI) every 6 to 12 months. The two current standards of care are neurosurgical removal of SEGAs through craniotomy, which can be associated with significant morbidity (37), or treatment with rapalogs, which inhibit mTOR activity. Rapalogs have proven effective in reducing lesion size, but they require continuous treatment and have limited access to the brain after peripheral administration. Potential problems with this class of drugs include a compromise of immune function (41), interference with white matter integrity (42), and possible interference with brain development in early childhood (43). In several studies, the mTOR pathway has been found to be critical to neurodevelopment, including neuronal growth, axonal guidance, synapse formation, and myelination (4446). Inhibition of mTOR by rapalogs may contribute to the observed memory dysfunction following prenatal/postnatal drug treatment in Tsc mouse models (47) and the behavioral abnormalities in wild-type mice treated prenatally with rapamycin (48). Some physicians do not recommend the use of these drugs in children or pregnant women as long-term effects on growth and development in pediatric patients are not fully known (43). Although in at least one study, rapalog treatment was reported to have no significant effect on neurocognitive function or behavior in children with TSC (49).

Our premise is that current therapies for children with TSC may have associated morbidity resulting in the potential for decreased mental functions. Another therapeutic approach would be intravascular administration of an AAV vector that can cross the BBB encoding a replacement gene for the mutant TSC1 or TSC2 alleles. Since SENs are slow growing, there would be time to monitor their size by MRI over several months and leave open the opportunity to administer standard-of-care treatment, as needed. It is hoped that gene replacement therapy might reduce use of more problematic standard-of-care procedures in young children and provide long-lasting benefit with a single administration. Certain serotypes of AAV, such as AAV9, are able to penetrate the BBB as well as deliver to peripheral tissues (13). Thus, with IV delivery, extra copies of the replacement gene would be provided to multiple tissues, including brain, kidney, liver, and lungs, which might reduce the likelihood that somatic mutations in TSC genes later in life would lead to disruptive hamartomas.

Advantages of AAV gene therapy are the potential for a single vector injection yielding long-term transgene expression in nondividing cells. It is assumed that once a tuberin analog is delivered to cells in TSC2 lesions, they would shrink and stop dividing and, hence, retain transgene expression. Gene therapy may be a viable option for infants/children with TSC to reduce potential compromise of brain functions caused by congenital lesions and secondary sequelae of these lesions. AAV9 vectors have been used in young mice with spinal muscular atrophy (SMA) for gene replacement of the survival motor neuron (SMN) protein using both IV (50) and intrathecal (51) gene delivery. An AAV9-SMN drug, Zolgensma (Novartis), is now U.S. Food and Drug Administrationapproved for IV treatment of babies/children with SMA. Two critical aspects of successful gene therapy with AAV vectors are as follows: (i) a known target, in the case of TSC2 loss of function of tuberin; and (ii) no toxicity resulting from overexpression of the replacement protein, since levels of expression cannot at present be regulated. There is a predicted reduced chance of toxicity of cTuberin as it should only be active in a 1:1 complex with hamartin, and hamartin levels are normal in TSC2 null cells (52), with cTuberin not bound to hamartin presumably being degraded. So far, no toxic effects of cTuberin expression have been observed in cells in culture or in mice. Clinical trials should be facilitated by the ability to image reduced lesion size within months by MRI due to shrinking of cell volume and inhibition of cell proliferation, as was found in the rapalog trial for renal angiomyolipomas (53). Typically, AAV vectors are just administered once due to previous exposure to the AAV virus in life eliciting an immune response to the capsid and reducing secondary transduction (54). If replacement is insufficient to reduce symptoms or new TSC2 null lesions arise later in life after AAV gene replacement, it would still be possible to treat patients with rapalogs or possibly exoAAV (55). These studies support the potential of AAV gene therapy for TSC2, which might be especially useful in infants and children where drug inhibition of the mTOR pathway may interfere with early brain development.

The AAV vector plasmid, AAV-CBA-Cre-BGHpA, was derived as described in Prabhakar et al. (16). These AAV vectors carry AAV2 inverted terminal repeat elements, and gene expression is controlled by a hybrid promoter (CBA) composed of the cytomegalovirus (CMV) immediate/early gene enhancer fused to the -actin promoter (23). To increase the efficiency of cTuberin translation (for future use in human gene therapy approach), cDNA encoding cTuberin was human codon-optimized before gene synthesis by GenScript Biotech (Piscataway, NJ, USA). AAV vector plasmid, AAV-CBA-cTuberin-c-Myc, was derived from the plasmid pAAV-CBA-W (56). This vector contains the CBA promoter driving cTuberin, followed by a WPRE and both SV40 and bovine growth hormone (BGH) polyadenylation (poly A) signal sequences. Our cTuberin construct contains the following: ACC (Kozak sequence) :: amino acids 1 to 450 of human tuberin::gly/ser linker :: amino acids 1515 to 1807 of human tuberin :: c-Myc tag = 2307 bp encoding an 85-kD protein (fig. S1). The pAAV-CBA-W, which contains the CBA promoter, WPRE, and poly A sequences, but no transgene, served as AAV-null in our studies.

AAV1 and AAV9 serotype vectors were produced by transient cotransfection of HEK293T cells by calcium phosphate precipitation method of vector plasmids (e.g., AAV-CBA-cTuberin-Myc), adenoviral helper plasmid pAdF6, and a plasmid encoding AAV9 (pAR9) or AAV1 (pXR1) rep and capsid genes, as previously described (57). All AAV vectors carried the identity of all PCR-amplified sequences as confirmed by sequencing. Briefly, AAV vectors were purified by iodixanol density gradient centrifugation. The virus-containing fractions were concentrated using Amicon Ultra 100-kDa molecular weight cut-offs (MWCO) centrifugal devices (EMD Millipore, Billerica, MA, USA), and the titer vector genomes (vg) per milliliter was determined by quantitative real-time PCR amplification with primers and TaqMan probe specific for the BGH poly A signal.

HEK293T cells [American Type Culture Collection (ATCC)] and COS-7 cells (ATCC, Manassas, VA, USA) were cultured in Dulbeccos modified Eagles medium (DMEM; Thermo Fisher Scientific, Hampton, NH, USA) supplemented with 10% fetal bovine serum (FBS; Gemini Bio Products, West Sacramento, CA, USA) and 1% penicillin/streptomycin (Thermo Fisher Scientific). The cell cultures were periodically screened to ensure they are free from mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM, G238, Richmond, BC, Canada).

HEK293T cells were seeded in 96-well plates (10,000 cells per well) and, after 24 hours, transfected with various plasmid DNAs (AAV-null, AAV-GFP, and AAV-cTuberin) at 250 ng/10,000 cells using Lipofectamine 2000, according to the manufacturers instructions (Life Technologies, Carlsbad, CA, USA) in Opti-MEM (Life Technologies). Six hours later, transfection media was removed and replaced with DMEM (10% FBS and 1% Penicillin-Streptomycin solution), and cells were allowed to grow for 72 hours. One group of cells was treated with potent proteasome inhibitor Bortezomib (VELCADE; Millennium Pharmaceuticals Inc., Cambridge, MA, USA) (58) at 250 nM for 72 hours, as a positive control for toxicity. Cellular toxicity caused by plasmid DNA transfection was assessed by quantification of extracellular LDH activity using LDH assay kit-WST (Dojindo Molecular Technologies Inc.), following the manufacturers instructions. Briefly, the supernatant for each transfected or treated sample was collected and incubated with substrate for 30 min at 37C. Following incubation, stop solution was added, and absorbance was measured at 490 nm.

Briefly, cultured cells were harvested in lysis buffer [50 mM Hepes (pH 8.0), 150 mM NaCl, 2 mM EDTA, 2.5% sodium dodecyl sulfate, 2% CHAPS, 2.5 mM sucrose, 10% glycerol, 10 mM sodium fluoride, 2 mM sodium vanadate, 1 mM phenylmethylsulfonyl fluoride (Sigma-Aldrich, St. Louis, MO, USA), 10 mM sodium pyrophosphate, and protease inhibitor cocktail (P8340, Sigma-Aldrich)]. After sonication and incubation at 8C for 10 min, the samples were centrifuged at 14,000g for 30 min at 8C. Equal amounts of protein, determined by a detergent-compatible protein assay kit (Bio-Rad Laboratories, Hercules, CA, USA), were boiled for 5 min in Laemmli sample buffer (Bio-Rad), separated by SDSpolyacrylamide gel electrophoresis (PAGE), and transferred onto nitrocellulose membranes (Bio-Rad). Equal protein loading was confirmed by Ponceau S staining. The membranes were blocked in 2% blocking reagent (GE Healthcare, Pittsburgh, PA, USA) for 1 hour at room temperature (RT) and incubated with primary antibodies overnight at 4C. Anti-tuberin/TSC2 (#3612), antiphospho-S6 (#2211), anti-S6 (#2212), anti-Myc (clone 9B11, #2276) (Cell Signaling Technology, Danvers, MA, USA), anti-actin (#A5441), anti-FLAG (clone M2, #F1804) (Sigma-Aldrich), anti-HA (clone F-7, sc-7392, Santa Cruz Biotechnology, Dallas, TX, USA), and antiglyceraldehyde-3-phosphate dehydrogenase (GAPDH) (#CB1001, EMD Millipore) were used as primary antibodies. Anti-rabbit or anti-mouse immunoglobulin G antibody conjugated with horseradish peroxidase was used as a secondary antibody (Thermo Fisher Scientific). Enhanced chemiluminescence reagent, Lumigen ECL Ultra (TMA-6) (Lumigen, Southfield, MI, USA), was used to detect the antigen-antibody complexes.

For immunoprecipitations, COS-7 cells were transfected with plasmid vectorsAAV empty, AAV-CBA-cTuberin-Myc, pcDNA-hamartin-FLAG (V. Ramesh laboratory), pReceiver-M09/tuberin-Myc (catalog no. EX-Z5884-M09, GeneCopoeia, Rockville, MD, USA), pCMV-Tag3A-Myc-GSK-3 (GSK-3 sequence was cloned into pCMV-Tag3A vector; catalog no. 211173-51, Agilent Technologies, Santa Clara, CA, USA), and pRK5-HA-GST-Rheb1 [catalog no. 19310, Addgene, Watertown, MA, USA; provided by Sancak et al. (59)] using Lipofectamine 2000 (Life Technologies). Cells were lysed with ice-cold phosphate-buffered saline (PBS) (pH 7.4) containing 1% Triton X-100, 2 mM EDTA, 10 mM sodium pyrophosphate, 1 mM phenylmethylsulfonyl fluoride, 2 mM sodium vanadate, 10 mM sodium fluoride, and proteinase inhibitors cocktail (Sigma-Aldrich). Lysates were centrifuged at 15,000 rpm for 10 min at 4C, and protein concentration was measured using the Bradford protein assay (Bio-Rad). One milligram of lysates was incubated with 2 g of anti-Myc-tag antibody (catalog no. 16286-1-AP, Proteintech, Rosemont, IL, USA) in the presence of Protein A/G Agarose (Santa Cruz Biotechnology) at 4C overnight. After washing twice with ice-cold modified PBS buffer (pH 7.4) (287 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, 0.05% Triton X-100, and 1 mM EDTA), resins were incubated in 30 l of 0.2 M glycine-HCl buffer (pH 2.5) (Polysciences Inc. Warrington, PA, USA) at RT for 15 min, and then the supernatants were collected and neutralized by adding an equal amount of 1 M tris-HCl (pH 8.0) (Sigma-Aldrich). To increase stringency during the washing, NaCl concentration was increased from 137 to 287 mM in the modified PBS buffer to reduce ionic protein interaction. Eluted immunoprecipitates or whole-cell lysates were separated by SDS-PAGE and analyzed by immunoblotting with antibodies specific for Myc-tag (dilution 1:5000) (catalog no. 2276, Cell Signaling Technology), FLAG-tag (1:25,000) (catalog no. F1804, Sigma-Aldrich), and HA-tag (1:3000) (catalog no. sc-7392, Santa Cruz Biotechnology). Anti-mouse antibody conjugated with horseradish peroxidase (Thermo Fisher Scientific) was used as a secondary antibody (dilution 1:25,000). Enhanced chemiluminescence reagent, Lumigen ECL Ultra (TMA-6) (Lumigen, Southfield, MI, USA), was used to detect the antigen-antibody complexes.

To assess the functional activity of AAV-cTuberin-Myc, we cotransfected HEK293T cells, as previously described with minor modifications (60). Plasmids included HA-tagged p70S6 kinase (HA-p70S6K) (60), which is phosphorylated (pS6K T389) by mTORC1 and was used as a reporter for mTORC1 activation, and Flag-tagged hamartin (Flag-hamartin) (60), along with AAV-cTuberin-Myc. Full-length Flag-tagged tuberin (Flag-tuberin) (60) was used as a positive control, and AAV-GFP was used as a negative control. Transfections were carried out for 48 hours using Lipofectamine 2000. Cell lysates were prepared using radioimmunoprecipitation assay lysis buffer, and immunoblotting was performed, as described (60). Briefly, proteins were separated on a Novex 4 to 12% tris-glycine gradient gel (Life Technologies) followed by transfer to 0.45 M nitrocellulose membrane (Bio-Rad). Antibodies included M2 anti-Flag mouse monoclonal (Sigma-Aldrich), anti-hamartin and anti-pS6K (T389) (Cell Signaling Technology), anti-Myc mouse monoclonal (9E10, University of Iowa Hybridoma Bank), and anti-HA mouse monoclonal (HA.11, BioLegend/Covance, San Diego, CA, USA).

HEK293T cells were seeded in a six-well plate (500,000 cells per well) for 24 hours. The cells were then transfected with plasmid DNAs (AAV-null, AAV-GFP, and AAV-cTuberin) at 2.5 g/500,000 cells using Lipofectamine 2000 in Opti-MEM. Six hours later, transfection media was removed and replaced with DMEM (10% FBS and 1% PS), and cells were grown for 72 hours. Cells were washed twice in PBS, and proteins were extracted with protein extraction solution (PRO-PREP, iNtRON Biotechnology, Korea) for 20 min at 20C. The cell lysates were centrifuged at 14,000g at 4C. Protein concentrations of cell lysates were determined using a Bio-Rad protein assay kit. Equal amounts of protein (20 g) were separated using 4 to 12% precast NuPAGE bis-tris SDS-PAGE gels (Invitrogen) and transferred onto nitrocellulose membranes (Thermo Fisher Scientific Inc., Rockford, IL, USA). Membranes were blocked for 1 hour in tris-buffered saline (TBS) with 0.1% Tween 20 and 5% nonfat dry milk, followed by an overnight incubation with primary antibody to tuberin (#3990, 1:1000 dilution, Cell Signaling Technology diluted in the same buffer at 4C). On the next day, the membranes were washed with TBS with 0.1% Tween 20 (three times, 5 min each) followed by incubation with the appropriate horseradish peroxidaseconjugated secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) for 1 hour at RT. An enhanced chemiluminescence kit (Pierce ECL Western Blotting Substrate, Thermo Fisher Scientific, Waltham, MA, USA) was used to detect protein expression. The optical density of each band was determined on Western blots scanned with a G:Box (Syngene, Cambridge, UK).

Brains and livers were flash-frozen to determine AAV genome biodistribution and expression of transgene mRNA. Genomic and AAV vector DNA was isolated using the Qiagen DNeasy Blood and Tissue Kit (catalog no. 69504) according to the manufacturers instruction. Total RNA was extracted using the Qiagen RNeasy Lipid Tissue Mini Kit (catalog no.74804) and Qiagen RNeasy Mini Kit (catalog no. 74104), with additional on-column deoxyribonuclease (DNase) digestion with the Qiagen RNase-free DNase set (catalog no. 79254) to ensure digestion of AAV-cTuberin genomes. Then, extracted RNA was converted to cDNA using the SuperScript VILO cDNA Synthesis Master Mix (Thermo Fisher Scientific, catalog no. 11754-050), according to the manufacturers protocol. A no-RT set of samples for the AAV-cTuberin group was included to confirm detection of cDNA derived from cTuberin mRNA and not contaminating AAV-cTuberin genomes. Using 50-ng genomic DNA as template, TaqMan qPCR was performed using custom TaqMan probe and primers to 3 end of cTuberin and c-Myc tag of the transgene expression cassette (forward primer, 5-AGCCAACACCAGGATACGAA-3; reverse primer, 5-GCTAATCAGCTTCTGCTCCAC-3; probe, 5-FAM- AGCGGCTGATCTCCTCCGTGG-MGB-3) (fig. S5). For each sample, a separate qPCR was performed using TaqMan probe and primer sets (Thermo Fisher Scientific, assay ID Mm01180221_g1, gene symbol Gm12070) that detects GAPDH genomic DNA, to ensure equal genomic DNA input for each sample. For each organ/tissue, the AAV vector genome copies for each sample were adjusted by taking into account any differences in GAPDH Ct values using the following formula: (AAV vector genome copies)/(2Ct). The Ct value was calculated as GAPDH Ct value (sample of interest) average GAPDH Ct value (sample with highest Ct value). Data were expressed as AAV vector genomes per 50 ng of genomic DNA.

Experimental research protocols were approved by the Institutional Animal Care and Use Committee for the Massachusetts General Hospital (MGH) following the guidelines of the National Institutes of Health for the Care and Use of Laboratory Animals. Experiments were performed on Tsc2c/c-floxed mice [Tsc2-floxed; (61)]. These mice have a normal, healthy life span. In response to Cre recombinase, the Tsc2c/c alleles are converted to null alleles. For vector injections, in the neonatal period (P0 to P3), pups were cryo-anesthetized and injected with 1 to 2 l of viral vector AAV1-CBA-Cre into each cerebral lateral ventricle with a glass micropipette (70 to 100 mm in diameter at the tip) using a Narishige IM300 microinjector at a rate of 2.4 psi/s (Narshige International, East Meadow, NY, USA). Mice were then placed on a warming pad and returned to their mothers after regaining normal color and full activity typical of newborn mice. At 3 weeks of age (P21), mice were anesthetized with isoflurane (Baxter Healthcare, Deerfield, IL, USA) inhalation [3.5% isoflurane in an induction chamber and then maintained anesthetized with 2 to 3% isoflurane and oxygen (1 to 2 liters/min) for the duration of the injection]. AAV vectors were injected retro-orbitally into the vasculature in a volume of 60 l (AAV1 or AAV9) of AAV-cTuberin-Myc using a 0.3-ml insulin syringe over less than 2 min (62) or noninjected.

Eighteen measurements of the body weight of the animals were recorded from P23 to P50. To assess motor coordination, animals were placed on an automated rotarod apparatus (Harvard Apparatus, Holliston, MA, USA) using accelerated velocities (4 to 64 rpm over 120 s). Each animal was assessed three times with 5-min rest intervals in each session for nine sessions 3 to 4 days apart. For each assessment, the time ended when the mouse fell off the treadmill or when the time interval elapsed. All functional assessment tests were performed blinded with respect to the mouse genotype.

HEK293T cells were seeded on coverslip coated with poly-d-lysine (25,000 cells per coverslip) for 24 hours. The cells were then transfected with plasmid DNAs (AAV-null, AAV-GFP, and AAV-cTuberin) at 250 ng/25,000 cells using Lipofectamine 2000 in Opti-MEM. Six hours later, transfection media was removed and replaced with DMEM (10% FBS and 1% PS), and cells were grown for 72 hours. The cells were fixed with 4% paraformaldehyde (PFA) (Boston BioProducts, Ashland, MA, USA) for 10 min at RT followed by permeabilization using 0.01% Triton X-100 (Sigma-Aldrich) in PBS (PBST) for 10 min at RT. The cells were then blocked with 3% bovine serum albumin (BSA) in PBST for 1 hour at RT, followed by overnight incubation with primary antibodies at 4C [primary antibodies: c-Myc (1:400 dilution; 9E10, Life Technologies)] and GFP (1:400 dilution; A11122, Life Technologies). The cells were then washed three times for 5 min in PBST and incubated with secondary antibody (goat anti-mouse 488, Jackson ImmunoResearch Laboratories) (1:400 dilution), for 1 hour at RT. The cells were washed three times for 5 min using PBST, mounted with Vectashield containing DAPI (Vector Laboratories, Burlingame, CA, USA). Note that, unfortunately, we were not able to detect cMyc in brain sections using several sources of c-Myc antibodies.

The mouse brains were harvested and subjected for standard histological processing as described (14). Five-micrometer sections were stained with hematoxylin and eosin. For frozen sections, adult mice were euthanized using ketamine/xylazine (100:10) (Akorn Inc., Lake Forest, IL, USA) followed by transcardiac perfusion with 1 PBS and 4% PFA in PBS overnight at 4C, cryo-protected with 25% sucrose in PBS, and embedded in optimal cutting temperature medium (catalog no. 4583, Tissue Teck). Brain sections were prepared in 10-mm coronal sections and were blocked in 10% BSA in 1 PBS + 0.3% Triton X-100 for 1 hour at RT and subsequently incubated with rabbit anti-Ki67 (1:1000; #ab15580, Abcam) or rabbit anti-phospho-S6 ribosomal protein (Ser235/236) (1:400; #2211, Cell Signaling Technology) overnight at 4C. Following three washes in 0.1 PBS, the sections were incubated with secondary antibody Alexa 555 (1:400; Jackson ImmunoResearch Laboratories) for 1 hour at RT. The sections were then washed three times with 1 PBS and mounted with DAPI mounting medium (Vectashield, #H-1200).

Whole mouse brain sections immunostained for pS6 (biological triplicates for each group, three coronal sections per mouse) were imaged using a Nikon Ti2 inverted microscope equipped with W1 Yokogawa Spinning disk scanhead with 50-m pinholes, a Toptica 4 laser launch, and an Andor Zyla 4.2 Plus sCMOS monochrome camera. The slides were mounted on a Nikon linear encoded motorized stage, and the mouse whole brain sections were scanned using Plan Apo 20/0.8 differential interference contrast (DIC) I objective lens objective lens at 405 nm for DAPI (100-ms exposure) and 561 nm for pS6 staining (100-ms exposure). Signals were collected using a Semrock di01-t405/488/568/647 dichroic mirror and Chroma 455/50 or 605/52 nm emission filters. Images were captured using NIS AR 5.02 acquisition software and 12-bit gain four-camera setting. A series of images were captured and stitched together using blending algorithm with 15% overlap among images.

Stitched images were analyzed in Fiji, an open source image processing package based on ImageJ (63). All images were thresholded within the 80 to 800 tonal range for both DAPI and pS6 staining. An outline was manually drawn to delineate choroid plexuses, ventricles, large empty spots, and meninges from the whole mouse brain section image. These regions are known to contain significant amounts of autofluorescence and therefore were excluded from downstream analysis. Within the confined region of interests (ROIs), we measured the area for the whole brain section. To identify pS6 puncta size and intensity within them, the thresholded pS6 channel image was converted into eight-bit image and further thresholded within the 70 to 255 tonal range. Subsequently, particle analysis was performed to identify any puncta within 5 to 200 m2 and 0.1 to 1.0 circularity parameters. The area for each punctum was measured. These puncta ROIs were then used to identify raw integrated density on original unthresholded 12-bit brain section images. Normalized pS6 puncta number of a brain section was calculated by dividing the total number of pS6 puncta by the brain section area.

All analyses of survival curves (Mantel-Cox test and log-rank test) were performed using GraphPad Prism software (GraphPad Software Inc., La Jolla, CA, USA). Flow cytometry analysis on c-Mycpositive cells was analyzed using unpaired t test. Western blot analysis on pS6 and tuberin expression levels in the mouse brain and PS6 puncta parameters were analyzed using unpaired t test. LDH cytotoxicity assay and Western blot analysis on relative levels of S6K T389 phosphorylation were analyzed using one-way analysis of variance (ANOVA) test. P values of <0.05 were considered statistically significant.

Acknowledgments: We thank S. McDavitt for editorial assistance, M. F. Lee (Medical Photographer in Pathology Media Laboratory, MGH) for imaging training, M. Zinter (Vector Core, MGH, Charlestown, MA, USA) for AAV vector packaging, and M. Whalen for the use of the rotarod. Funding: This work was supported by DOD Army Grant W81XWH-13-1-0076 (to X.O.B.), NIH R01GM115552 (to M.K.), NIH NIDCD R01DC017117-01A1 (to C.A.M.), NIH NINDS 1R61NS108232 (to X.O.B., C.A.M., and V.R.), and NIH NS109540 (to V.R.). We would like to acknowledge the MGH Vector Core for the production of viral vectors (supported by NIH/NINDS P30NS045776; B.A.T.) and P. M. Llopis, Microscopy Resources on the North Quad (MicRoN), Harvard Medical School, NRB-Longwood, MA, USA. Author contributions: X.O.B., S.P., D.Y., C.A.M., and M.K. conceived and designed the experiments. S.P., P.-S.C., R.L.B., X.Z., and S.K. performed the experiments. S.P., P.-S.C., K.-H.L., and S.K. analyzed the data. S.P., P.-S.C., D.Y., B.A.T., E.A.T., X.Z., R.L.B., R.T.B., D.J.K., A.S.-R., B.G., K.-H.L., V.R., M.K., C.A.M., and X.O.B. wrote and edited the paper. Competing interests: X.O.B., S.P., D.Y., and C.A.M. have filed a provisional patent application for the cTuberin construct. C.A.M. has a financial interest in Chameleon Biosciences Inc., a company developing an enveloped AAV vector platform technology for repeated dosing of systemic gene therapy. X.O.B., V.R., and C.A.M.s interests are reviewed and managed by MGH and Partners HealthCare in accordance with their competing interest policies. All other authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Plasmid requests can be provided by MGH pending scientific review and a completed material transfer agreement. Requests for the plasmid should be submitted to C.A.M. at cmaguire{at}mgh.harvard.edu.

See the article here:
Gene therapy for tuberous sclerosis complex type 2 in a mouse model by delivery of AAV9 encoding a condensed form of tuberin - Science Advances

Recommendation and review posted by Bethany Smith

BEIJING, Jan. 8 (Xinhua) -- For the first time, a genome-wide CRISPR-based screening technology has identified a new driver of cellular senescence. It can form part of new strategies to delay aging and prevent aging-associated diseases, Chinese researchers said.

By screening and identifying more than 100 genes responsible for the aging of human cells, the research team demonstrated that knocking out, or disabling, some genes by CRISPR can discourage the aging of human mesenchymal precursor cells (hMPCs). Among the genes that lead to senility, and KAT7 (a histone acetyltransferase), is one of the catalysts for aging.

Knocking out KAT7 has been proven effective in alleviating cellular senescence in the team's experiments, said Zhang Weiqi, a researcher at the Beijing Institute of Genomics under the Chinese Academy of Sciences. The scientists managed to reduce the proportion of the senescent cells in the livers of aged mice and prolonged the lifespan of physiologically aged mice and those with progeria.

The novel gene therapy, based on disabling a single gene or using KAT7 inhibitors, could extend mammal life. It could also slow down the aging of human liver cells. It suggests a massive potential for its application in translational medicine against human aging.

The study was published on Thursday in Science Translational Medicine online.

Originally posted here:
Chinese researchers discover new anti-aging gene therapy - The Star Online

Recommendation and review posted by Bethany Smith

Sana Biotechnology was founded in 2018 with a mission of solving some of the most difficult challenges in gene and cell therapy. Toward that end, the company is engineering hypoimmune stem cells that can evade detection and destruction by the immune system.

Now, some of Sanas founders, who are scientists at the University of California, San Francisco (UCSF), are describing how these engineered stem cells are able to shut down the immune systems natural killer (NK) cells. They believe their findings could enhance the development of implantable cell therapies, as well as cancer immunotherapies, they reported in the Journal of Experimental Medicine.

The ability to evade NK cells could enhance a range of experimental treatments, including implants of insulin-producing cells for patients with diabetes and cardiac cells to repair heart damage. These cells are typically rejected by the immune systema problem hypoimmune stem cells were designed to circumvent.

Virtual Clinical Trials Summit: The Premier Educational Event Focused on Decentralized Clinical Trials

In this virtual environment, we will look at current and future trends for ongoing virtual trials, diving into the many ways companies can improve patient engagement and trial behavior to enhance retention with a focus on emerging technology and harmonized data access across the clinical trial system.

The UCSF team used gene modification technology to design the cells so they avoid the immune responses that are either built into the bodys defense system or learned. The researchers achieved that feat by engineering the cells to express the protein CD47, which shuts down innate immune cells by activating signal regulatory protein alpha, or SIRP-alpha.

The researchers were surprised to discover that the hypoimmune stem cells were able to escape NK cells, even though NK cells were not previously known to express SIRP-alpha. Rather than studying lab-grown cell lines, they took cells directly from patients. Thats where they found SIRP-alpha.

Whats more, the UCSF team discovered that NK cells begin to express SIRP-alpha after they are activated by cytokines that are typically abundant in inflammatory states.

RELATED: Fierce Biotech's 2020 Fierce 15 | Sana Biotechnology

To further prove out the utility of engineered stem cells, the UCSF researchers implanted cells with rhesus macaque CD47 into monkeys. They documented the activation of SIRP-alpha in NK cells. Those NK cells did not kill the transplanted cells.

A similar technique could be used, but in reverse, to implant pig cardiac cells into people, the UCSF team argued. If human CD47 were engineered into pig heart cells, they could be implanted into people without risking rejection by NK cells, they suggested.

Sana made waves in 2018 when it raised a whopping $700 million in a single venture round from the likes of Arch Venture Partners, Flagship Pioneering and Bezos Expeditions. We believe that one of, if not the most, important thing happening in medicine over the next several decades is the ability to modulate genes, use cells as medicines, and engineer cells, said Steve Harr, president and CEO of Sana, at the time.

Sana did not provide materials or funding for the new study, but it is now developing the hypoimmune stem cell technology for clinical testing.

The UCSF team believes their findings could also boost cancer immunotherapy. The engineered cells could help combat checkpoints that allow tumors to evade immune detection, they said.

"Many tumors have low levels of self-identifying MHC-I protein and some compensate by overexpressing CD47 to keep immune cells at bay," said Lewis Lanier, Ph.D., director of the Parker Institute for Cancer Immunotherapy at the UCSF Helen Diller Family Comprehensive Cancer Center, in a statement. "This might be the sweet spot for antibody therapies that target CD47."

Original post:
Engineered stem cells that evade immune detection could boost cell therapy and I-O - FierceBiotech

Recommendation and review posted by Bethany Smith

At the end of the study, it was found that the rats had regained their ability to use their paws and were able to pick up sugar cubes to feed themselves, according to The Independent. The gene therapy trial was conducted at Kings College London, U.K. The focus of the work was to repair damage to the spinal cords of the rodents. The spinal cords of the rats had been purposefully damaged to mimic the damaged sometimes suffered to humans after car crashes. Quoted by Sky News, Professor Elizabeth Bradbury, one of the principal researchers, stated: "In some of the tests we looked at such as gripping the rungs of a ladder the treatment worked within one to two weeks."Gene therapyGene therapy is an important aspects of medicine. The process is designed to introduce genetic material into cells. This is to compensate for abnormal genes or, alternatively, to produce a beneficial protein. In cases where a mutated gene causes a necessary protein to be faulty or to become missing, then gene therapy could work to introduce a normal copy of the gene and hence to restore the function of the protein.There are different variants of gene therapy, including plasmid DNA, where circular DNA molecules are genetically engineered so they carry therapeutic genes into human cells; viral vectors, where viruses are used to deliver genetic material into cells; bacterial vectors, where bacteria are modified and then deployed as vehicles to carry therapeutic genes into human tissues; and human gene editing technology, where genes are edited to disrupt harmful genes or to repair mutated genes. There is also patient-derived cellular gene therapy products. With this more recent process, cells are taken from the patient, modified and then returned to the patient.For some scientists, the next phase is germinal gene therapy. This has been achieved experimentally in animals but not in humans.Novel researchWith the new study, the process involved injecting a gene that produces an enzyme called chondroitinase, into the spinal cords of the rats. This enzyme functions to breaks down scar tissue, a tissue that is formed following damage to the spinal cord. he tissue prevents new connections from being formed between nerves. The enzyme is also being used in trials for vitreous attachment and for treating cancer.

See the rest here:
article image Advances in gene therapy to help paralysis - Digital Journal

Recommendation and review posted by Bethany Smith

SAN DIEGO and STOCKHOLM, Sweden, Jan. 07, 2021 (GLOBE NEWSWIRE) -- Oncternal Therapeutics, Inc. (Nasdaq: ONCT), a clinical-stage biopharmaceutical company focused on the development of novel oncology therapies, today announced that it established a research and development collaboration with world-renowned Karolinska Institutet in Stockholm, Sweden, to advance novel ROR1-targeting cell therapies focused on CAR-T cells and CAR-NK (Natural Killer) cells from the laboratory into the clinic.

As part of the collaboration, IND-supporting preclinical studies will be performed in the Cell and Gene Therapy Group led by Evren Alici, M.D. Ph.D., within the NextGenNK Center, which is a Competence Center for the development of next-generation NK cell-based cancer immunotherapies. The Center is coordinated by Karolinska Institutet and collaborates with the Karolinska University Hospital as well as prominent national and international industrial partners. The Center was launched in 2020, and is jointly funded by Swedens innovation agency Vinnova, Karolinska Institutet, and the industrial partners.

Given that NK cells were discovered at Karolinska Institutet, we are excited to work together with industry partners to translate scientific advances into next-generation cell therapies that will benefit cancer patients, said Hans-Gustaf Ljunggren, M.D. Ph.D., Director of the NextGenNK competence center. We look forward to collaborating with the outstanding team at Oncternal to develop cutting-edge T and NK cell therapies targeting ROR1, which is a promising target in many oncology indications. It could be ideally suited for cell therapy.

We are honored to work together with the world-leading academic team at Karolinska Institutet to accelerate the development of our ROR1-targeting CAR-T cell immunotherapy program, said James Breitmeyer, M.D., Ph.D., Oncternals President and CEO. ROR1 has emerged as an important and underexplored target for cancer therapy, and we believe that ROR1-targeting CAR-T and CAR-NK therapies hold significant promise for patients with both hematologic cancers and solid tumors. We believe that utilizing the ROR1 binding domain of our clinical-stage antibody cirmtuzumab as a component of the CAR has the potential to give us a safety and efficacy advantage.

About Oncternal TherapeuticsOncternal Therapeutics is a clinical-stage biopharmaceutical company focused on the development of novel oncology therapies for the treatment of cancers with critical unmet medical need. Oncternal focuses drug development on promising yet untapped biological pathways implicated in cancer generation or progression. The clinical pipeline includes cirmtuzumab, an investigational monoclonal antibody designed to inhibit the ROR1 (Receptor-tyrosine kinase-like Orphan Receptor 1) pathway, a type I tyrosine kinase-like orphan receptor, that is being evaluated in a Phase 1/2 clinical trial in combination with ibrutinib for the treatment of patients with mantle cell lymphoma (MCL) and chronic lymphocytic leukemia (CLL) and in an investigator-sponsored, Phase 1b clinical trial in combination with paclitaxel for the treatment of women with HER2-negative metastatic or locally advanced, unresectable breast cancer. The clinical pipeline also includes TK216,an investigational targeted small-molecule inhibitor of the ETS family of oncoproteins, that is being evaluated in a Phase 1 clinical trial for patients with Ewing sarcoma alone and in combination with vincristine chemotherapy. In addition, Oncternal has a program utilizing the cirmtuzumab antibody backbone to develop a CAR-T therapy that targets ROR1, which is currently in preclinical development as a potential treatment for hematologic cancers and solid tumors. More information is available at http://www.oncternal.com.

About KarolinskaInstitutetKarolinska Institutetis one of the worlds leading medical universities. Its vision is to advance knowledge about life and strive towards better health for all. Karolinska Institutet accounts for the single largest share of all academic medical research conducted in Sweden and offers the countrys broadest range of education in medicine and health sciences. The Nobel Assembly at Karolinska Institutet selects the Nobel laureates in Physiology or Medicine.

Forward-Looking InformationOncternal cautions you that statements included in this press release that are not a description of historical facts are forward-looking statements. In some cases, you can identify forward-looking statements by terms such as may, will, should, expect, plan, anticipate, could, intend, target, project, contemplates, believes, estimates, predicts, potential or continue or the negatives of these terms or other similar expressions. These statements are based on the companys current beliefs and expectations. Forward looking statements include statements regarding Oncternals beliefs, goals, intentions and expectations including, without limitation, Oncternals belief that ROR1-targeting CAR-T and CAR-NK therapies hold significant promise for patients with hematologic cancers and solid tumors; whether using ROR1 binding domain as a component of the CAR therapeutic candidate will provide a safety or activity advantage over other drugs or drug candidates; the potential that ROR1 could be an ideal target for cell therapy; and other statements regarding Oncternals development plans. Forward looking statements are subject to risks and uncertainties inherent in Oncternals business, which include, but are not limited to: the risk that the collaboration with Karolinska Institutet will not generate any intellectual property or otherwise identify drug candidates for development or provide Oncternal any benefits; the COVID-19 pandemic may disrupt Oncternals business operations or the business operations of Karolinska Institutet, increasing their respective costs; uncertainties associated with the clinical development and process for obtaining regulatory approval of product candidates, including potential delays in the commencement, enrollment and completion of clinical trials; Oncternals dependence on the success of cirmtuzumab, TK216 and its other product development programs; the risk that competitors may develop technologies or product candidates more rapidly than Oncternal, or that are more effective than Oncternals product candidates, which could significantly jeopardize Oncternals ability to develop and successfully commercialize its product candidates; Oncternals limited operating history and the fact that it has incurred significant losses, and expects to continue to incur significant losses for the foreseeable future; the risk that the company will have insufficient funds to finance its planned operations and may not be able to obtain sufficient additional financing when needed or at all as required to achieve its goals, which could force the company to delay, limit, reduce or terminate its product development programs or other operations; and other risks described in the companys prior press releases as well as in public periodic filings with the U.S. Securities & Exchange Commission. All forward-looking statements in this press release are current only as of the date hereof and, except as required by applicable law, Oncternal undertakes no obligation to revise or update any forward-looking statement, or to make any other forward-looking statements, whether as a result of new information, future events or otherwise. All forward-looking statements are qualified in their entirety by this cautionary statement. This caution is made under the safe harbor provisions of the Private Securities Litigation Reform Act of 1995.

Oncternal Contacts:

Company ContactRichard Vincent 858-434-1113rvincent@oncternal.com

Investor ContactCorey Davis, Ph.D. LifeSci Advisors 212-915-2577 cdavis@lifesciadvisors.com

Source: Oncternal Therapeutics, Inc.

Read more from the original source:
Oncternal Therapeutics and Karolinska Institutet Establish Collaboration for Research and Development of ROR1-targeting CAR-T and CAR-NK Cell...

Recommendation and review posted by Bethany Smith

SAN FRANCISCO--(BUSINESS WIRE)--AllStripes (formerly RDMD), a healthcare technology company dedicated to accelerating research for patients with rare diseases, today announced a multiyear collaboration with Taysha Gene Therapies, Inc. (NASDAQ: TSHA), a patient-centric gene therapy company focused on developing and commercializing AAV-based gene therapies for the treatment of monogenic diseases of the central nervous system in both rare and large patient populations.

The collaboration will focus on advancing the development of TSHA-104, an AAV9-based gene therapy in development for SURF1-associated Leigh syndrome, a deadly rare disease that primarily affects infants. AllStripes will use its platform, which gives patients control over their health histories, to unify otherwise scattered and fragmented SURF1-associated clinical data, allowing researchers to uncover new insights into the natural history and burden of disease and better inform the development of clinical studies.

This collaboration will allow us to leverage the AllStripes technology platform to optimize our therapeutic strategy and to potentially accelerate the development of TSHA-104 in SURF1-associated Leigh syndrome, said RA Session, II, president, founder and chief executive officer of Taysha. We remain committed to developing a safe and effective gene therapy for patients suffering with this devastating disease, and data generated from this unique collaboration could bring us one step closer to our goal.

Mutations in the SURF1 gene prevent mitochondria from producing enough energy for cells in the body to function normally, leading to Leigh syndrome, a severe and rare neurological disorder characterized by progressive loss of mental and movement abilities. SURF1-associated Leigh syndrome typically presents during infancy or early childhood, and often results in death within a few years. Approximately 10-15% of people with Leigh syndrome have a SURF1 mutation. There is currently no targeted treatment or cure for SURF1-associated Leigh syndrome.

Taysha has brought together accomplished and knowledgeable gene therapy and CNS disease experts to develop potentially transformative therapies, said Nancy Yu, co-founder and chief executive officer of AllStripes. With no available treatment for SURF1-associated Leigh syndrome, we are very pleased to empower patients and their families with an avenue to participate in research that will support the development path of TSHA-104. We are hopeful that this novel gene therapy will bring meaningful benefit to children and their families, and give them more time together.

TSHA-104 has been granted rare pediatric disease and orphan drug designations from the U.S. Food and Drug Administration (FDA) for the treatment of SURF1-associated Leigh syndrome. An Investigational New Drug (IND) application for TSHA-104 in SURF1-associated Leigh syndrome is expected to be submitted to the FDA in 2021.

About Taysha Gene Therapies

Taysha Gene Therapies (Nasdaq: TSHA) is on a mission to eradicate monogenic CNS disease. With a singular focus on developing curative medicines, we aim to rapidly translate our treatments from bench to bedside. We have combined our teams proven experience in gene therapy drug development and commercialization with the world-class UT Southwestern Gene Therapy Program to build an extensive, AAV gene therapy pipeline focused on both rare and large-market indications. Together, we leverage our fully integrated platforman engine for potential new cureswith a goal of dramatically improving patients lives. More information is available at http://www.tayshagtx.com.

About AllStripes

AllStripes is a healthcare technology company dedicated to unlocking new treatments for people with rare diseases. AllStripes has developed a technology platform that generates FDA-ready evidence to accelerate rare disease research and drug development, as well as a patient application that empowers patients and families to securely participate in treatment research online and benefit from their own medical data. AllStripes was founded by CEO Nancy Yu and technology developer Onno Faber, following his diagnosis and journey with the rare disease neurofibromatosis type 2. The company is backed by Lux Capital, Spark Capital, Maveron Capital, Village Global, Garuda Ventures and a number of angel investors. For more information, visit http://www.allstripes.com.

Read the original post:
AllStripes Announces Collaboration with Taysha Gene Therapies for SURF1-Associated Leigh Syndrome Program - Business Wire

Recommendation and review posted by Bethany Smith