While ex vivo CD34-selected allogeneic hematopoietic stem cell transplants (HCTs) are promising treatments for patients with hematologic and myeloid malignancies, they can be limited by delayed immune recovery and increased risk of death not caused by relapse.

A late-breaking abstract presented at the 2024 Transplantation and Cellular Therapy Tandem Meetings investigated a new approach to allogeneic HCT. Investigators of the phase 2 PRAISE-IR study (NCT04872595) explored using a model-based approach to determine the optimal dose of antithymocyte globulin (ATG), which is used to prevent graft-vs-host disease after transplant. Previous studies suggested high ATG exposure might contribute to nonrelapse mortality.

According to Michael Scordo, MD, the model successfully achieved a low posttransplant ATG exposure, and immune reconstitution by day 100 was achieved in 69% of patients, meeting the studys primary end point. Further, the 2-year rates of nonrelapse mortality and relapse were 9% and 13%, respectively, and relapse-free survival and overall survival rates were high at 78% and 86%, respectively.

These findings suggest that using a model to determine the ATG dose for ex vivo CD34-selected allogeneic HCT can lead to improved immune reconstitution and excellent survival outcomes. This approach may help reduce nonrelapse mortality previously observed in other trials and improve the safety and effectiveness of this type of transplant.

In an interview with Targeted OncologyTM, Scordo, bone marrow transplant specialist and cellular therapist at Memorial Sloan Kettering Cancer Center in New York, New York, discussed the findings from this study and their implications for the allogeneic HCT treatment landscape.

Targeted Oncology: What was the rationale or inspiration for the study you presented at the Tandem Meetings?

Scordo: Ex vivo CD34-selected [allogeneic] transplant is one of the many methods of reducing graft-vs-host disease. It uses a myeloablative conditioning platform and integrates ATG, antithymocyte globulin, into that platform to help reduce the risk of rejection. This has been well studied over the years, but 1 of the downsides of this approach is the delayed immune recovery, particularly the T-cell immune recovery that occurs after [allogeneic] transplant with this approach. What we did based on a recent publication that we have from last year was we used a different dosing of ATG to ensure that the T-cell immune recovery after [allogeneic] transplant using ex vivo CD34 selection would be improved.

What are some of the unmet needs in this space?

There are many methods to reduce graft-vs-host disease after transplant CD34 selection. Many of the other methods including posttransplant cyclophosphamide [PTCy], which has now become a standard of care, are out there and should be used in the appropriate setting. In matched donor transplants, ex vivo CD34 selection is one of the methods of being able to use an ablative or intensive conditioning regimen with very low rates of particularly chronic graft-vs-host disease. We saw this as an opportunity to improve on this platform significantly, using a novel approach but a simple approach.

What were the goals of this study?

The primary end point of the study was the ability to improve the CD34 T-cell immune recovery by day 100 after transplant. This was a sort of a validated predictor in other studies. We had key secondary end points that included nonrelapse mortality, relapse rates, progression-free, and overall survival. With the primary end point, we exceeded that end point. With our trial, about 70% of our 56 patients achieved this appropriate immune recovery by day 100, which was significantly higher than our historical numbers had shown.

What were some of the other findings?

Aside from achieving the primary end point, we saw very low rates of nonrelapse mortality at 2 years, estimated at 8%, which is much lower than some of the previously published data using this platform in the last couple of years. [We also saw] low relapse rates [of] about 12% at 2 years and very favorable progression-free and overall survival, which was 80% and 87%, respectively, at 2 years.

What are some of the takeaways?

I look at this as a simple but novel approach to improving on a platform. We have existing platforms that work well, but we can improve them doing well. To community oncologists, I would say that for patients with myeloid malignancies, there are many different types of transplants that can be done safely and effectively. The appropriate choice of a platform really depends on many factors. We can improve on all these platforms individually, including PTCy. [For] ex vivo CD34 selection, I look at this as a method of just improving on what we have already shown to be an effective platform, being able to use dose-intensive chemotherapy or total body radiation to achieve maximal disease control but making the platform safe and tolerable.

Read this article:
New Allo-HCT Approach Boosts Immune Response, Survival - Targeted Oncology

Recommendation and review posted by Bethany Smith

Patient characteristics

The baseline characteristics of the study population are presented in Table1. A total of 8764 patients were included, from which 7725 (88%) received rATG, and 1039 (12%) received PTCy as GVHD prophylaxis.

Overall, the majority of patients were transplanted for acute leukemia (58%), myelodysplastic syndrome (MDS) (19.7%), myeloproliferative neoplasm (MPN) (9.7%) or lymphoma (9%). A high proportion of patients had a low/intermediate Disease Risk Index (DRI, 72.1%), and myeloablative conditioning (MAC) was more frequently performed (53.3%) than reduced intensity conditioning (RIC).

Patients in the rATG group were older, with a median age of 58.6 years (IQR (48.1, 65.4)) vs. 53 years in the PTCy group (IQR 38.6, 62.3) (p<0.01), with a similar proportion of males (57.3% in rATG vs. 58.9% in PTCy, p=0.33), along with a significantly lower use of TBI (14.5% vs. 24.7%, p<0.01) and lower use of MAC (52% vs. 62.3%, p<0.01). Also, the disease relapse index was lower and the year of transplant was more recent in the PTCy group (Table1). The remaining parameters were balanced between the two groups. Median follow up was 2.1 years in both arms. More detailed information is given in Table1.

Univariate outcomes are shown in Figs.1, 2and Table2. The results of the multivariate analyses are summarized in Table3. The P-values and hazard ratios (HR) presented in the following results section are derived from the multivariate analysis.

A NRM; B Overall survival, C Relapse incidence, D Progression-free survival and E GVHD-free relapse-free survival. Cumulative incidences are shown.

A Acute GVHD grades IIIV; B Acute GVHD grades IIIIV, C Chronic GVHD all grades and D Extensive chronic GVHD - Cumulative incidences are shown.

Patients receiving PTCy had a significantly lower NRM as compared to patients receiving rATG (2y incidence: 12.4% vs. 16.1%; HR: 0.72 [95% CI 0.550.94], p=0.016). Similarly, OS and PFS showed a statistically significant and clinically meaningful benefit for PTCy arm, with a higher OS (2y incidence: 73.9% vs. 65.1%; HR: 0.82 [95% CI 0.720.92], p=0.001), and a higher PFS (2y incidence: 64.9% vs. 57.2%; HR: 0.83 [95% CI 0.740.93], p<0.001). RI was lower in the PTCy arm (2y incidence: 22.8% vs. 26.6%; HR: 0.87 [95% CI 0.751.00], p=0.046).

The causes of death are given in Table4. No major differences between the two groups were apparent. Relapse of the underlying malignancy was the most frequent cause of death, accounting for ~50% of total deaths in both arms, followed by NRM causes: infections ~18%, GVHD~16% and other alloSCT-related causes ~8% of total deaths. Secondary malignancies contributed to approximately 1% of total deaths.

Overall chronic GVHD was lower in the PTCy group (2y incidence: PTCy 28.4% vs. rATG 31.4%; HR: 0.77 [95% CI 0.630.95], p=0.012). Extensive chronic GVHD was also reduced in patients receiving PTCy vs. rATG: (2y incidence: 11.9% vs. 13.5%; HR: 0.75 [95% CI 0.620.91], p=0.004).

The incidence of acute GVHD grades II-IV in patients receiving PTCy, compared to those receiving ATG was not statistically significant: (100d incidence: 24.1% vs. 26.5%; HR: 0.85 [95% CI 0.691.04], p=0.11). Similarly, for severe acute GVHD grades IIIIV (100d incidence: 8.7% vs. 9.7%; HR: 0.76 [95% CI 0.551.05], p=0.091).

GRFS was significantly higher in the PTCy arm compared to the rATG arm (2y incidence: 51% vs. 45%; HR: 0.86 [95% CI 0.750.99], p=0.035).

The EBMT Database does not contain data on graft failure/rejection. To get insight into the initial grafts success and any subsequent requirement for additional transplantation procedures, we investigated neutrophil recovery after the first alloSCT as well as the incidence of a second alloSCT. The median incidence of neutrophil recovery at days +30 and +60 in the ATG vs. PTCy groups was: d+30 ATG 96% (IC95% 95.596.4) vs. PTCy 91% (8992.7) and d+60 ATG 97.9% (97.698.2) vs. PTCy 97.4% (96.298.3). The median incidence of a second alloSCT at 2 years was 4.3% (3.84.8) in the ATG group and 3.2% (2.24.6) in the PTCy group.

Continue reading here:
ATG or post-transplant cyclophosphamide to prevent GVHD in matched unrelated stem cell transplantation? | Leukemia - Nature.com

Recommendation and review posted by Bethany Smith

Scientists reversed some signs of immune aging in mice with a new treatment that could one day potentially be used in humans.

The new immunotherapy works by disrupting a natural process by which the immune system becomes biased towards making one type of cell as it ages.

The mouse study is an "important" proof-of-concept, but it's currently difficult to gauge the significance of the findings, Dr. Janko . Nikolich-Zugich, a professor of immunobiology at the University of Arizona who was not involved in the research, told Live Science in an email. More work is needed to see how well the therapy shifts the immune system into a more youthful, effective state.

All blood cells, including immune cells and the red blood cells that carry oxygen around the body, start life as hematopoietic stem cells (HSC) in the blood and bone marrow, the spongy tissue found within certain bones. HSCs fall into two main categories: those destined to become so-called myeloid cells and those that will develop into lymphoid cells.

Myeloid cells include red blood cells and immune cells belonging to our broadly reactive first line of defense against pathogens, including cells called macrophages that trigger inflammation. Lymphoid cells include cells that develop a memory of germs, such as T and B cells.

Related: 'If you don't have inflammation, then you'll die': How scientists are reprogramming the body's natural superpower

As we age, the HSCs slated to become myeloid cells gradually increase in number and eventually outnumber the lymphoid stem cells. This means we can't respond to infections as well when we're older as when we're young, and we're more likely to experience chronic inflammation triggered by increasing levels of myeloid cells that trigger inflammation.

Get the worlds most fascinating discoveries delivered straight to your inbox.

In the new study, published Wednesday (March 27) in the journal Nature, scientists developed an antibody-based therapy that selectively targets and destroys the myeloid HSCs, thus restoring the balance of the two cell types and making the blood more "youthful." The antibodies latch onto the targeted cells and flag them to be destroyed by the immune system.

The authors injected the therapy into mice aged 18 to 24 months, or roughly the equivalent of being between 56 and 69 years old as a human.

They then extracted HSCs from the mice after treatment and analyzed them, revealing the rodents had a smaller percentage of the myeloid HSCs than untreated mice of the same age.

This effect lasted for two months. Compared with untreated mice, the treated mice also produced more naive T cells and mature B cells. These cells can go on to form memory cells, which are directly involved in the immune attack; in the case of the B cells, they can form antibody-producing plasma cells.

"Not only did we see a shift toward cells involved in adaptive immunity, but we also observed a dampening in the levels of inflammatory proteins in the treated animals," Dr. Jason Ross, lead study author and postdoctoral researcher at Stanford University, said in a statement. Specifically, the researchers saw that the levels of one proinflammatory protein fell in the treated mice. This protein, called IL-1beta, is mainly made by myeloid cells.

Eight weeks post-treatment, the researchers vaccinated the mice against a virus they'd never been exposed to before. The mice that had received the immunotherapy had more apt immune responses to vaccination than the untreated mice, producing more T cells against the germ.

"We believe that this study represents the first steps in applying this strategy in humans," Ross said. However, other experts have cautioned against jumping to conclusions.

Nikolich-Zugich noted that, although the researchers measured changes in the numbers of naive T cells in the mice, they didn't look at the function of the organ that makes them: the thymus. The team also saw reductions only in IL-1beta and not other inflammatory proteins. They also didn't test whether the mice's baseline immunity to new infections could be improved with this therapy, without vaccination, he said.

Furthermore, the study didn't consider potential long-term side effects of the treatment, such as anemia, or a deficiency in red blood cells, said Dr. Ilaria Bellantuono, a professor in musculoskeletal aging at the University of Sheffield in the U.K. who was not involved in the research.

Although an "interesting" study, more work is needed to understand whether it can bring "meaningful changes" in the immune system, Bellantuono told Live Science in an email, whether that of mice or humans.

Ever wonder why some people build muscle more easily than others or why freckles come out in the sun? Send us your questions about how the human body works to community@livescience.com with the subject line "Health Desk Q," and you may see your question answered on the website!

Here is the original post:
New immunotherapy could make blood more 'youthful,' mouse study hints - Livescience.com

Recommendation and review posted by Bethany Smith

Theres a universal fact for women. If they live long enough, their capacity to bring forth children will end, and they will become menopausal. Menopause can be when the thermostat becomes their most prized possession.

But not all women have hot flashes. Some go through this period wondering why they have no symptoms. The best advice for them is, Enjoy the smooth sailing!

Other women endure needless suffering. There are treatments, and these women should see their doctors.

The medical journal The Lancet has urged women to become educated about hormone replacement therapy. Menopause should not be considered a disease. It is a natural process. Be cautious with commercial interests of pharmaceutical companies propaganda. Seek information from a medical specialist.

The authors of The Lancet report stress they are not opposed to HRT, as it can be effective in treating hot flashes, vaginal dryness, and genital urinary symptoms. Many years ago, HRT was often used by women to control menopausal symptoms. The standard treatment involved the hormones estrogen and progestin, a synthetic form of progesterone.

But a large and widely publicized study called the Womens Health Initiative identified problems with HRT. Doctors and patients concluded HRT was dangerous, and this misconception lingers today. The study had significant shortcomings, however, and subsequent studies have more nuanced conclusions. For women under 60, or for those less than a decade out of menopause, the benefits of HRT in fighting debilitating symptoms outweighed the risk. There was one other caution. Those using HRT should not have a family history of stroke, breast cancer, or coronary heart disease.

Which women suffer the most from menopause? Its those who are affected by severe symptoms. Imagine a stalwart high school principal. She has handled the tough job for years. But with the onset of menopause, the slightest provocation has her bursting into tears behind closed doors. For the first time, she feels incapable of the task. If she meets the criteria mentioned above, then she is a textbook case for HRT. Within a week, her problem would be history.

Menopause is not just one event or one symptom, such as hot flashes. A gradual decrease in the production of estrogen influences organs such as the vagina and urinary bladder. Its these organs that women are loath to discuss with their family doctor, to say nothing of their partners.

It may come as a shock to younger people to know that seniors have sexual relations. But menopause can make vaginal tissues thinner and more easily irritated. Past columns have tried to explain this with a touch of eloquence, noting that its hard for females to sing with a sore throat. Put plainly, its hard for menopausal and post-menopausal women to enjoy sex with an inflamed vagina (atrophic vaginitis). Sometimes neither the woman nor her partner knows whats causing the severe pain. Unfortunately, many women suffer silently.

Those who ask for help will find there are good remedies. Something as simple as an estrogen cream can resolve an irritated vagina within two weeks. Other consequences of menopause, like the accelerated loss of bone density, may also be treated with HRT.

Sometimes problems are missed because a vaginal examination is not done during a check-up. Or patients dont mention issues to the doctor.

The comedian Joan Rivers made a joke about news that having a dog makes you 10 years younger. My first thought was to rescue two more, she said, before adding, but I dont want to go through menopause again.

Today, women can and should get their symptoms treated.

Dr. W. Gifford-Jones, aka Ken Walker, is a graduate of the University of Toronto and Harvard Medical School. You can reach him online at his website, docgiff.com, or via email at contact-us@ docgiff.com. Follow him and his daughter on Instagram @docgiff and @diana_gifford_jones.

Visit link:
The Doctor Game: What women suffer most from menopause? - The Westerly Sun

Recommendation and review posted by Bethany Smith

One of the most significant challenges in treating HIV is the virus ability to integrate its genome into the hosts DNA. This means that lifelong antiretroviral therapy is essential as latent HIV can reactivate from reservoirs as soon as treatment ends.

One potential technique being developed to address this problem is the use of gene editing technology to cut out and incapacitate HIV from infected cells. Currently, there is a Phase I/II Clinical Trial underway in people with HIV-1 (the most common strain of HIV)

Now, new research from another team shows that gene editing can be used to eliminate all traces of the HIV virus from infected cells in the laboratory.

The research is being presented early ahead of the European Congress of Clinical Microbiology and Infectious Diseases, which will be held from 27-30 April in Barcelona, Spain. Its been carried out by scientists from the Amsterdam Medical University in the Netherlands, and the Paul Ehrlich Institute in Germany, and has not yet been submitted for peer review.

Our aim is to develop a robust and safe combinatorial CRISPR-Cas regimen, striving for an inclusive HIV cure for all that can inactivate diverse HIV strains across various cellular contexts, they write in a conference abstract submitted ahead of ECCMID.

CRISPR-Cas gene editing technology acts like molecular scissors to cut DNA and either delete unwanted genes or introduce new genetic material, while guidance RNA (gRNA) tells CRISPR-Cas exactly where to cut at designated spots on the genome.

In this research, the authors used 2 gRNAs that target conserved parts of the viral genome this means they remain the same or conserved across all known HIV strains. This genetic sequence does not have a match in human genes, to prevent the system going off target and causing mutations elsewhere in the human genome.

The hope is to one day provide a broad-spectrum therapy capable of combating multiple HIV variants effectively. But before this dream can become a reality, the researchers had to address a number of issues with getting the CRISPR-Cas reagents into the right cells.

To delivered CRISPR components into cells in the body a viral vector, containing genes that code for the CRISPR-Cas proteins and gRNA, is used. This is the vehicle that delivers into the host cell the instructions to make all necessary components, but these instructions need to be kept as simple and short as possible.

Another issue is making sure the viral vector enters HIV reservoir cells specifically cells that express the receptors CD4+ and CD32a+ on their surface.

They found that in one system, saCas9, the vector size was minimised, which enhanced its delivery to HIV-infected cells. They also included proteins that target the CD4+ and CD32a+ receptors specifically in the vector.

This system showed outstanding antiviral performance, managing to completely inactivate HIV with a single guide RNA (gRNA) and excise (cut out) the viral DNA with two gRNAs in cells in the lab.

We have developed an efficient combinatorial CRISPR-attack on the HIV virus in various cells and the locations where it can be hidden in reservoirs and demonstrated that therapeutics can be specifically delivered to the cells of interest, the authors write.

These findings represent a pivotal advancement towards designing a cure strategy.

But the researchers stress that, while these preliminary findings are very encouraging, it is premature to declare that there is a functional HIV cure on the horizon.

See the original post:
How CRISPR-Cas genome editing could be used to cure HIV - Cosmos

Recommendation and review posted by Bethany Smith

CRISPR gene editing technology is beginning to deliver on a promise to quickly create crops with traits that withstand a changing climate, resist aggressive pests and reinvigorate healthy soils, according to experts at the South by Southwest event in Austin earlier this month.

Companies exploring CRISPR to make climate-friendly foods and medicines are enjoying some tailwinds:

At the same time, startups and researchers are taking on investment partnerships with larger organizations to commercialize CRISPR innovations. Bayer has a project with Pairwise to create a corn crop that is more resilient to environmental factors. In 2011, The Gates Foundation gave a $10.3 million grant to the International Rice Research Institute (IRRI) and has re-invested more than $16 million to the organization in 2023 to create climate resistant rice varieties.

The past 200 years of industrialized agriculture have increased yields and eased shipping with large, durable produce often to the detriment of the soil, the planet and taste.

"We think with gene editing you wont have to make that choice," said Tom Adams, CEO of Pairwise. The startup is producing the first CRISPR consumer product by editing out the wasabi-like spiciness of a mustard green to make it more palatable to eaters.

Pairwise sold the green at a New York grocer earlier this year and is seeking to partner with companies to sell to consumers. The companys main focus is developing business-to-business markets by selling ingredient crops or seeds to big agricultural companies or seed banks.

Traditionally, farmers mated or cross-pollinated organisms to augment their desired characteristics. It could take decades to cultivate a plant to the desired enhancement for human consumption.

In the 1970s, scientists began genetically modifying organisms (GMOs) by cultivating foreign DNA in a bacteria or virus and then inducing those cells to add their modified DNA into a plant or animal. The modified DNA would typically offer resistance to pests or diseases.

CRISPR opens up new possibilities to modify crops by knocking out or enhancing genes that are already present. "Its more precise, and more accurate and more intuitive than breeding," said Elena Del Pup, a plant genetics researcher at Wageningen University in the Netherlands. "[It] allows us to make very specific edits."

"The hope and the promise of [CRISPR] is that by making a few simple edits, you confer a highly valuable disease resistance trait onto a crop," said Vipula Shukla, senior program officer at the Bill and Melinda Gates Foundation.

If European Union states eventually accept the recent parliamentary vote, they would exempt plants with CRISPR edits from GMO labeling requirements.

The EU has been notoriously strict on GMOs, requiring labeling under consumer "right to know" rules since 1997. Every GMO product must receive EU authorization and a risk assessment.

In the United States, the FDA began requiring clear labeling on consumer products containing GMOs in 2022. In 2018, the USDA decided that CRISPR-edited foods do not need to be regulated or labeled as genetically edited because these modifications could have been done with traditional breeding alone.

Experts think the new EU vote that exempts CRISPR from these rules indicates a willingness to embrace new tools to address the challenges of providing enough food for a growing population facing climate change.

Heres how advocates foresee CRISPR helping the food system become more resilient to climate change.

In agriculture, maximizing yield remains a top priority. Crops that produce more food and use less fertilizer, water and pesticides also decrease embedded emissions.

Pairwise, in collaboration with Bayer, is editing corn that yields more kernels per ear. Another edited corn grows to 6 feet rather than the conventional 9 feet tall.

"The advantage is that it's much sturdier," said Adams. "So if there's a big wind it doesn't get blown over." It also makes applying insecticides, fungicides and herbicides easier.

To engineer the next generation of climate-efficient plants, scientists need to find specific genes in them, such as for controlling water usage or nitrogen fixation.

"One of the biggest limitations [for CRISPR] is our relatively limited knowledge of the biology of the organisms that were trying to edit," Shukla said. "You can't apply CRISPR to a gene if you don't know what the gene does."

Farmers and researchers are field-testing a strain of CRISPR-edited rice designed to resist bacterial blights, which can kill 75 percent of a crop. Rice blight is a particular problem in India and Africa.

Since 2011, The Gates Foundation has been funding field trials of CRISPR rice in India. It has engaged in similar field tests of a virus-resistant corn in Mexico since 2015. "The Gates Foundation wants to come in at a point where there's a testable hypothesis," Shukla said. "We're focusing on developing and delivering these innovations to people."

The foundation looks for preliminary laboratory results or small scale, proven field testing. It then funds a larger scale pilot in real-world conditions in developing countries.

"I don't personally have a lot of faith that we're going to reverse climate change," Adams said. "So, I think we probably should be investing in adapting to it."

Farmers need plants that can survive temperature extremes, including higher nighttime temperatures, as well as erratic rainfall patterns. CRISPR can help native plants adapt to their changing environment by enhancing their genes.

"One of the consequences of climate change is having to move crops into places they havent been before because it's warmer or wetter or drier," Shukla said. "And crops are not adapted to those pests [in the new locations]. We have the ability with gene editing to confer traits that make those crops more tolerant to pests and diseases that they haven't experienced before."

The Gates Foundation is looking at genes for heat tolerance as its next target for research and investment, according to Shukla.

CRISPR technology may also diversify the genetic composition of current crops and domesticate new crops. That could help address the damage done by industrial, monoculture farming practices, in which a single crop species dominates a field or farm, depleting the soil of its nutrients.

"Wild relatives of plants contain traits that can be super-valuable for agriculture," Shukla said. "But we haven't had a way through crossing or other methods to bring those traits into the agricultural system."

If Pairwises mild mustard green becomes a hit, it might offer an incentive for farmers to plant a new leafy green alongside their kale, lettuce and spinach adding to biodiversity.

See the original post:
Why Bayer and the Gates Foundation are using CRISPR to reduce food's climate impact - GreenBiz

Recommendation and review posted by Bethany Smith

TCGA data acquisition and pre-processing

TCGA SNV data for 16 cancer types (BLCA, BRCA, COAD, GBM, HNSC, KIRC, KIRP, LIHC, LUAD, LUSC, OV, PAAD, PRAD, READ, STAD, and UCEC) were downloaded from the GDC data portal (https://portal.gdc.cancer.gov/, DR-7.0). The mutation files were initially collected as VarScan2 processed protected mutation annotation format (MAF) files. To eliminate low-quality and potential germline variants, we further processed the files according to the guidelines provided by the GDC portal (https://docs.gdc.cancer.gov/Data/File_Formats/MAF_Format/) to generate high-confidence somatic mutation files. For gene expression analysis, we obtained fragments per kilobase of exon per million mapped fragments (FPKM) data using the TCGAbiolinks19 R package (version 2.26.0). The gene expression values were then normalized to log2(FPKM+1).

The DepMap CRISPR/Cas9 screen dataset20 (https://depmap.org/portal/, DepMap Public 21Q2) was used to collect essential genes. Haploinsufficient genes were compiled from three sources: (1) Vinh T Dang et al.s study11, (2) ClinGen12 (https://clinicalgenome.org, genes with haploinsufficiency scores of 2 or 3, downloaded on January 20, 2021), and (3) DECIPHER13 (https://deciphergenomics.org, genes located in the top 5% probability of haploinsufficiency scores, version 3). Oncogenes were obtained from the COSMIC Cancer Gene Census9 (https://cancer.sanger.ac.uk/census, v94) data by applying the filter Somatic=yes and including genes with the role of oncogene in cancer. Hotspot mutations were annotated using data from the Cancer Hotspots portal3 (https://www.cancerhotspots.org, Hotspot Results V2).

To generate targetable SNVs and the corresponding sgRNA sequences from a given SNV list of a sample, we followed the following steps: First, we identified the SNVs located within essential or haploinsufficient genes. If an SNV was encoded by an essential gene, only homozygous SNVs were further analyzed. Next, we calculated the allele frequency (AF) threshold ({AF}_{cut}) using the following equation:

$${AF}_{cut}={AF}_{M}+MAD(hetAF)$$

(1)

where ({AF}_{M}) is the median of AFs of SNVs from the sample, and (MAD(hetAF)) is the median absolute deviation (MAD) of AFs of heterozygous SNVs from the patient or sample. SNVs with AF below the samples ({AF}_{cut}) were filtered out. We then considered the expression of the gene in which an SNV was located and retained SNVs where the gene expression (log2(FPKM+1)) was greater than 1.

To identify SNVs that generate a novel and specific targetable site for the CRISPR/Cas9 approach, we searched for a PAM sequence (NGG, where N represents any nucleotide) within a 12-base pair region around the SNV or checked if the SNV itself created a new PAM sequence. For the satisfying SNVs, a 20-nucleotide sgRNA sequence was obtained.

To obtain sgRNAs with precise knockout efficiency and low potential off-target effects, we calculated the on- and off-target scores and applied strict cutoffs as follows: First, on-target scores were calculated using the Azimuth 2.015 method implemented in the crisprScore21 R package (version 1.2.0). sgRNAs with on-target scores greater than 0.5 were examined for possible off-target sites using CasOFFinder16 (offline version 2.4). The UCSC human reference genome assembly (GRCh38) was used as a reference, and off-target sites with a maximum of three mismatches were searched. If an sgRNA was found to have off-target sites, the off-target score was calculated using the CFD15 method, which was also implemented in the crisprScore21 R package. If off-target sites with scores>0.175 were present, the sgRNA was filtered out to mitigate potential off-target risks. Finally, the SNVs were reported along with their corresponding sgRNAs, on-target scores, and off-target scores.

All cells were maintained at 37C in a 5% CO2 atmosphere. Human embryonic kidney 293T (HEK293T) cells were purchased from ATCC. HEK293T cells were cultured in Dulbeccos modified Eagles medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillinstreptomycin (Invitrogen, USA). Human colorectal cancer cell lines (SNUC4, SW620, and NCIH498) were also purchased from the Korean Cell Line Bank and cultured in RPMI-1640 medium (Gibco) supplemented with 10% FBS and 1% penicillinstreptomycin.

The lentiviral plasmids lentiCas9-Blast and lentiGuide-puro were purchased from Addgene USA (#52,962, #52,963). The sgRNA sequences were cloned following the lentiCRISPR v2 cloning protocol22,23. For transfection, 7.5105 HEK293T cells were seeded in 60-mm plates one day before transfection. Transfection was performed using Opti-MEM I Reduced Serum Medium (Gibco) with 1g of lentiviral plasmid, 0.25g of pMD2.G (#12,259; Addgene), 0.75g of psPAX2 (#12,260; Addgene), and 6 L of FuGENE (Promega, USA). The medium was changed after 16h of incubation at 37C under 5% CO2. Viral supernatants were collected 48 and 72h after transfection, filtered through a 0.45-m membrane (Corning, USA), and stored at -80C. Cells were transduced with lentivirus encoding lentiCas9-Blast to establish stable Cas9-expressing cells, followed by selection with blasticidin (10g/mL) (Invitrogen) for seven days.

Stable Cas9-expressing SNUC4 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRNA targeting the RRP9 SNV of SNUC4 (sgRRP9-SNV). After selection with puromycin (SNUC4: 10g/mL, SW620: 2g/mL, Invitrogen) for 72h, 1103 cells/well were seeded into six-well plates. The medium was replaced every 72h. After 14days, the medium was removed, and the cells were stained with 0.05% crystal violet solution in a 6% glutaraldehyde solution for 30min. The crystal violet solution was then removed, and the cells were washed with H2O and allowed to dry. Colonies comprising more than 50 cells were counted using the ImageJ software24.

Parental or stable Cas9-expressing SNUC4 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRRP9-SNV. After selection with puromycin (SNUC4: 10g/mL, SW620: 2g/mL) for 72h, 1105 cells/well were seeded into six-well plates. After 3days, cells were trypsinized, stained with trypan blue (Bio-Rad, USA), and counted. All harvested cells were seeded onto 60-mm plates. After 3days of incubation, cells were trypsinized and counted with trypan blue again. The subculture was repeated once more using 100-mm plates. Growth curves were generated using cell counts obtained during the subculture.

Total RNA was extracted from SW620 cell line using the RNeasy Plus Mini Kit (QIAGEN, Germany) following the manufacturers instructions. cDNA was synthesized with PrimeScript RT Master Mix (Takara Korea Biomedical Inc, Korea), and full-length RRP9 cDNA was PCR amplified with CloneAmp HiFi PCR Premix (Takara Korea Biomedical Inc). The PCR-amplified RRP9 wild-type cDNA was cloned into pcDNA3 Flag HA (#10,792, Addgene) using In-Fusion HD Cloning Kit (Takara Korea Biomedical Inc). RRP9 sequence was confirmed by Sanger-sequencing.

Stable Cas9-expressing SNUC4 cells were transduced with lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRRP9-SNV. After selection with puromycin (10g/mL) for 72h, 3103 cells/well were seeded into 96-well plates. After a 24h incubation, 2g of empty or RRP9 plasmids were transfected with FuGene HD (Promega) according to the manufacturers protocol. Cell viability was assessed after 4days using Cell Titer Glo (Promega), and relative luminescence units (RLU) were measured using an EnVision plate reader (Perkin-Elmer, USA).

Stable Cas9-expressing NCIH498 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRNA targeting the SMG6 SNV of NCIH498 (sgSMG6-SNV). After selection with puromycin (NCIH498: 10g/mL, SW620: 2g/mL) for 72h, 3103 cells/well were seeded into 96-well plates. After 6days, cell viability was determined with Cell Titer Glo according to the manufacturers protocol, and RLU were measured using an EnVision plate reader.

Cells and tissues were harvested, washed with phosphate-buffered saline (PBS), and lysed on ice for 15min in a radioimmunoprecipitation assay buffer (R0278; Sigma, USA) supplemented with a protease and phosphatase inhibitor cocktail (GenDEPOT, USA). Cell lysates were centrifuged at 4C for 10min at 15,000rpm. Protein concentrations were determined using Bradford assay (Bio-Rad). Equal amounts of total protein were separated via sodium dodecyl sulfate gel electrophoresis and transferred to polyvinylidene difluoride membranes (Bio-Rad). The membranes were blocked with 5% skim milk for 1h at 22C and then incubated overnight at 4C with a primary antibody against the target protein in a buffer containing 0.1% Tween 20. Subsequently, the membranes were washed with Tween-PBS buffer three times for 10min each and incubated with a secondary antibody (anti-rabbit IgG or anti-mouse IgG) diluted in a blocking buffer containing 0.1% Tween 20 for 1h at 22C. The membranes were then washed with Tween-PBS three times for 10min each. The immunoreactive bands were visualized using Pierce enhanced chemiluminescence western blotting substrate (32,106; Thermo Fisher Scientific, USA). Mouse monoclonal anti-Cas9 (#14,697; Cell Signaling Technology, USA), rabbit polyclonal anti-RRP9 (#ab168845, Abcam, UK), rabbit polyclonal anti-FLAG (DYKDDDDK) (#2368; Cell Signaling Technology) and rabbit monoclonal anti-heat shock protein 90 (HSP90) (#4877, Cell Signaling Technology) and were used at a 1:1000 dilution. Anti-rabbit IgG (#111-035-144; Jackson ImmunoResearch, USA) was used at a 1:5000 dilution except for anti-FLAG which was used at a 1:10,000 dilution. Anti-mouse IgG (#115-035-146, Jackson ImmunoResearch) was used at a 1:10,000 dilution.

Genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Libraries were prepared with a two-step PCR reaction, in which the first step uses target-specific primers, and the second step utilizes primers containing unique barcodes and Illumina sequencing adaptor sequences. The primers used here are listed in Supplementary Data 4. PCR reactions were performed with KAPA HiFi HotStart Ready Mix (Roche Molecular Systems, Inc. USA). For the first PCR step, 100ng of genomic DNA was denatured at 95 for 5min, followed by 30 cycles of (98C at 20s, 61C for 15s, and 72C for 15s), and a final extension at 72C for 1min. Primers with unique barcodes and Illumina sequencing adaptor sequences were added to the PCR product from step 1 for the second PCR reaction, where denaturation at 95C for 5min was followed by 12 cycles of (98C at 20s, 61C for 15s, 72C for 15s), and a final extension at 72C for 1min. PCR products were verified with 2% agarose gel electrophoresis and extracted using the Zyomoclean Gel DNA Recovery Kit (Zymo Research, USA) according to the manufacturers instructions. The barcoded PCR products were pooled and subjected to paired-end sequencing (2150bp reads) on an Illumina NovaSeq-6000 instrument (Macrogen, Korea). InDel quantification was conducted using CRISPResso225 with default parameters.

Genomic DNA was extracted from colorectal cancer cell lines using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Target regions were PCR-amplified with nTaq (Mg2+plus) (Enzynomics, Korea) with the following primers: sgRRP9-SNV region (Forward: 5-TCAAGGCCCTCGTTGATTCC-3, Reverse: 5-TTTTTGGGCTTTGTGGCTGC-3), sgSMG6-SNV region (Forward: 5-TCTGCATCGAAAGTGACACGA-3, Reverse: 5- CTATCAGCCTGGACGACGTTT-3). PCR products were purified with PureLink Quick PCR Purification Kit (Invitrogen). 200ng of purified PCR product were denatured at 95C for 10min, re-annealed at 2C per second temperature ramp to 85C, followed by a 1C per second ramp to 25C. 1l of T7E1 enzyme (Enzynomics) was added to the heterocomplexed PCR product and incubated at 37C for 15min. Products were electrophoresed on a 2% agarose gel using TAE buffer. Band intensities were measured with ImageJ, and the estimated non-homologous end joining (NHEJ) event was calculated with the following formula:

$$NHEJleft( % right) = 100 times left[ {1 - left( {1 - fraction; cleaved} right)^{{left( {frac{1}{2}} right)}} } right]$$

(2)

where the fraction cleaved is (frac{(Density; of; digested; products)}{(Density; of; digested; products,+,undigested; parental; band}).

All animal procedures were approved by the Institutional Animal Care and Use Committee of Yonsei University, Seoul, Korea (2021-0106). All methods were performed in accordance with the relevant guidelines and regulations for the care and use of laboratory animals. Six-week-old female BALB/c-nu Slc mice were purchased from Orient Bio (Korea) and SLC Inc. (Japan). The mice were housed in individual ventilation cages equipped with a computerized environmental control system (Techniplast, Italy). The animal room temperature was maintained at 222C with a relative humidity of 5010%. Before the experiments, the animals were acclimated for seven days under a 12-h lightdark cycle.

Stable Cas9-expressing SNUC4 cells were transduced with lentivirus encoding either the control sgRNA or sgRNA targeting the RRP9 SNV in SNUC4 cells. After selection with 10g/mL puromycin for 72h, 3106 cells were subcutaneously injected into the left (control sgRNA) or right (RRP9 SNV of SNUC4 sgRNA) flanks of 10 mice. Similarly, stable Cas9-expressing SW620 cells were transduced with lentivirus encoding either the control sgRNA or sgRNA targeting the RRP9 SNV in SNUC4 cells. After selection with 2g/mL puromycin for 72h, 2106 cells were subcutaneously injected into the left (control sgRNA) and right (RRP9 SNV of SNUC4 sgRNA) flanks of 10 mice. Among the mice, we excluded those with no observable tumor growth in the left flank (control sgRNA) from further analysis.

Tumor sizes were measured using a caliper, and the volume was calculated using the formula: 0.5lengthwidth2. Mice were sacrificed when the largest tumor reached a volume of 1000 mm3. Each tumor was considered an experimental unit. The sample size was determined to be sufficient to identify statistically significant differences between groups.

Genomic DNA was extracted from colorectal cancer cell lines using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Whole-exome capture was performed using the SureSelect Human All Exon V4 51Mb Kit (Agilent Technologies, USA). The captured DNA was then sequenced on the HiSeq 2500 platform (Illumina, USA), generating a minimum of 98.9 million paired-end sequencing reads of 100bp per sample.

The Burrows-Wheeler Alignment26 tool was used with the default parameters to align the paired-end reads to the UCSC human reference genome assembly (GRCh37/hg19). An average of 98.3% of the reads were successfully aligned to the human genome. Duplicate reads were removed using the Picard software package. The Genome Analysis Tool Kit (GATK) version 3.446 was used for read quality score recalibration and local realignment to identify short InDels using the HaplotypeCaller27 package. The variants were filtered using the GATK Best Practices quality control filters.

SNVs were identified using Mutect28, specifically the tumor-only option, with default parameters. Variants supported by at least five high-quality reads (Phred-scaled quality score>30) and detected with at least 20% AF were selected for further analysis. The detected SNVs and InDels were annotated using various databases, including the single nucleotide polymorphism (SNP) database (dbSNP29, build 147), 1000 Genomes Project30 (Phase 3), Korean dbSNP (build 20,140,512), and somatic mutations in TCGA colon adenocarcinoma (COAD), using the Variant Effect Predictor software31 (version 87). ANNOVAR32 was used to annotate regions of known germline chromosomal segmental duplications and tandem repeats.

Several steps were performed to filter variants. Patients with germline polymorphisms, chromosomal segmental duplications, or tandem repeats were excluded. The variants were then filtered to include known somatic mutations observed in at least one sample from TCGA COAD dataset. Additionally, nonsynonymous mutations observed in genes belonging to the Cancer Gene Census, as reported in at least ten samples in the COSMIC9 database (version 87), were included in the analysis.

Total RNA was extracted from colorectal cancer cell lines using the RNeasy Plus Mini Kit (QIAGEN) following the manufacturers instructions. The TruSeq RNA Sample Prep Kit v2 (Illumina) was used to generate mRNA-focused libraries. Libraries were sequenced on the HiSeq 2500 platform, generating at least 40 million paired-end reads of 100bp per sample.

The TopHat-Cufflinks33 pipeline was employed to align the reads to the reference genome and calculate normalized gene expression values in FPKM. TopHat was used to align and map the reads to the reference genome. The resulting alignments were then processed using Cufflinks, which estimates transcript abundance and calculates FPKM values, providing a measure of gene expression levels that takes the length of exons and the total number of mapped reads into account.

R (ver. 4.2.1) (R Foundation, Austria) and the ImageJ software were used to analyze the data.

The figures were generated using the R software, and statistical analyses were performed using RStudio software (version 2022.07.2+576). Specific statistical tests are identified in the figure legends for each experiment.

The study design, animal use and all experimental methods were conducted and reported in accordance with ARRIVE guidelines (https://arriveguidelines.org).

Go here to read the rest:
CRISPR/Cas9 targeting of passenger single nucleotide variants in haploinsufficient or essential genes expands cancer ... - Nature.com

Recommendation and review posted by Bethany Smith

Figure 1: Total deal value by deal therapy area of licensing agreements for innovator drugs utilising the CRISPR system, globally, 2019-2024, year to date. Credit: GlobalData.

Licensing agreements for innovator drugs utilising clusteredregularly interspaced short palindromic repeats (CRISPR) technologies saw oncology, immunology, and central nervous system as the top three therapy areas by total deal value with a combined $21bn over the past five years.

Furthermore, haematological disorders saw almost three times more licensing agreement deal value in 2022 compared to 2020, reaching a total deal value of $1.8bn in the past five years (Figure 1), as reported by GlobalDatas Pharma Intelligence Center Deals Database.

This highlights the growing importance of advancements in CRISPR for haematological disorder therapies.

In December 2023, the US Food and Drug Administrations approval of Casgevy, the first CRISPR and CRISPR-associated protein 9 (Cas9) genome editing therapy developed by Vertex Pharmaceuticals and CRISPR Therapeutics for sickle cell disease and beta thalassemia represented a major milestone in gene therapy.

Casgevy precisely edits DNA in blood stem cells by utilising CRISPR/Cas9 technology, involving taking the patients bone marrow stem cells and enhancing their expression of fetal haemoglobin before reintroducing these edited stem cells back into the patient.

This restores healthy haemoglobin production in patients with sick cell disease and beta thalassemia, effectively alleviating the symptoms of these diseases.

Access the most comprehensive Company Profiles on the market, powered by GlobalData. Save hours of research. Gain competitive edge.

Your download email will arrive shortly

We are confident about the unique quality of our Company Profiles. However, we want you to make the most beneficial decision for your business, so we offer a free sample that you can download by submitting the below form

Country * UK USA Afghanistan land Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bonaire, Sint Eustatius and Saba Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos Islands Colombia Comoros Congo Democratic Republic of the Congo Cook Islands Costa Rica Cte d"Ivoire Croatia Cuba Curaao Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and McDonald Islands Holy See Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Isle of Man Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati North Korea South Korea Kuwait Kyrgyzstan Lao Latvia Lebanon Lesotho Liberia Libyan Arab Jamahiriya Liechtenstein Lithuania Luxembourg Macao Macedonia, The Former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Runion Romania Russian Federation Rwanda Saint Helena, Ascension and Tristan da Cunha Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and The Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and The South Sandwich Islands Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syrian Arab Republic Taiwan Tajikistan Tanzania Thailand Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates US Minor Outlying Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam British Virgin Islands US Virgin Islands Wallis and Futuna Western Sahara Yemen Zambia Zimbabwe Kosovo

Industry * Academia & Education Aerospace, Defense & Security Agriculture Asset Management Automotive Banking & Payments Chemicals Construction Consumer Foodservice Government, trade bodies and NGOs Health & Fitness Hospitals & Healthcare HR, Staffing & Recruitment Insurance Investment Banking Legal Services Management Consulting Marketing & Advertising Media & Publishing Medical Devices Mining Oil & Gas Packaging Pharmaceuticals Power & Utilities Private Equity Real Estate Retail Sport Technology Telecom Transportation & Logistics Travel, Tourism & Hospitality Venture Capital

Tick here to opt out of curated industry news, reports, and event updates from Pharmaceutical Technology.

Submit and download

Figure 1 shows innovator drugs harnessing CRISPR systems saw 182% growth in total licensing agreement deal value from $5.6bn in 2020 to $15.8bn in 2022, according to GlobalDatas Pharma Intelligence Center Deals Database.

Oncology represented more than half of the total deal value for the top three therapy areas with $11.9bn, followed by immunology with $6.7bn, and central nervous system with $2.3bn, according to GlobalDatas Pharma Intelligence Center Deals Database.

Pharma giants such as Lily and Sanofi have recently partnered with companies developing CRISPR-based technologies.

Last year, Prevail Therapeutics, a subsidiary of Lily, secured exclusive rights to Scribe Therapeutics CRISPR X-Editing (XE) technologies for $1.65bn.

This licensing agreement, aimed at developing genetic therapies for neurological and neuromuscular diseases, stands as the largest CRISPR-based deal of the year.

Concurrently, Sanofi expanded its collaboration with Scribe in July 2023, with a deal worth up to $1.24bn, focusing on leveraging Scribes XE genome editing technologies for the development of in vivo therapies, particularly sickle cell disease and other genomic disorders.

Moreover, Lilys expertise in cardiometabolic diseases prompted the company to partner with Beam Therapeutics in October last year.

This agreement, valued at up to $600m, involved acquiring rights held by Beam in Verve Therapeutics, a gene-editing company focused on single-course gene editing therapies for cardiovascular disease.

This includes Verves programmes targeting PCSK9 and ANGPTL3, both set for clinical initiation this year.

CRISPR technology is revolutionising targeted gene therapies for various unmet diseases by precisely targeting diverse genomic sites.

This advancement in precision medicine offers hope for more tailored treatments and improved patient outcomes.

Furthermore, the growing number of CRISPR-based therapies in clinical trials is expected to fuel significant interest and drive further progress in this field.

View original post here:
CRISPR drug licensing deals secure $21bn in top three therapy areas over five years - Pharmaceutical Technology

Recommendation and review posted by Bethany Smith

Leadership change simultaneous to the Eclipse Cell Engineering platform spinout asEditCo Bio

REDWOOD CITY, Calif., March 27, 2024 /PRNewswire/ -- Synthego Corporation, a leading provider of genome engineering solutions, announced that Paul Dabrowski will step down as Chief Executive Officer, effective immediately. Craig Christianson has been appointed Chief Executive Officer following an extensive search process. Mr. Dabrowski, a co-founder of the company, will continue his role as a Board Director and advisor. Additionally, the company announces the divestiture of the Eclipse Cell Engineering platform as EditCo Bio, Inc., enablingSynthego's unique focus on therapeutic applications of CRISPR.

"Founding and growing Synthego the past 12 years has been the privilege of a lifetime," said Dabrowski. "Our team has transformed the CRISPR landscape by staying true to our values and providing everyone, from individual scientists to the world's leading biotechnology companies, with unprecedented access to advanced genome engineering. I'm confident Craig is an ideal fit to further our mission by building a robust commercial engine leveraging Synthego's platform - in addition to his impeccable track record, he embodies Synthego's culture of innovation and excellence. As the world enters the era of CRISPR based therapeutics, Synthego is now focused to be the premier supplier to hundreds of programs entering the clinic."

Christianson has a track record of spearheading global commercial strategies, business development and operations to build global life sciences and other businesses. He joins Synthego from Water Street Healthcare Partners, preceded by 12 years with global biotechnology company Promega Corporation where he led commercial operations, accelerating their growth to $700M+ in annual sales through profit-driven strategies and successful digital transformation.

"I am honored to join this pioneering organization which plays an important role in the impact CRISPR has on life science research and clinical development," said Christianson. "Paul is a visionary who has built a foundation upon which Synthego will become the best partner for clients in terms of co-development and regulatory compliance for the advancement of therapies and, ultimately, human health."

Christianson's appointment, along with the spinout of EditCo Bio, previously operating as Synthego's Eclipse platform, reinforces Synthego's commitment to provide CRISPR therapeutic developers with best-in-class guide RNAs. With its state-of-the-art GMP facility and extensive experience of producing leading products, Synthego is uniquely positioned to address escalating clinical requirements and changing regulatory frameworks. Bolstered by the FDA approval of the first CRISPR-based therapy, Synthego is more dedicated than ever to accelerating life-saving technologies for improved human health in its next chapter.

For more information, click here.

About Synthego:Synthego is a genome engineering company that enables the acceleration of life science research and development in the pursuit of improved human health. Based on a foundation of engineering and chemistry, Synthego leverages automation and machine learning to synthesize high-quality CRISPR reagents for science at scale. Synthego's mission is to enable agile life science research and development from discovery through clinical trials by providing scientists with comprehensive CRISPR solutions for each phase coupled with full technical and regulatory support from industry-leading experts. With its technologies cited in hundreds of peer-reviewed publications and utilized by thousands of commercial and academic researchers and therapeutic drug developers, Synthego is at the forefront of innovation, enabling the next generation of medicines by delivering genome editing at an unprecedented scale.

SOURCE Synthego

Read more:
Synthego Announces CEO Transition to Focus on Enabling CRISPR Therapeutics - PR Newswire

Recommendation and review posted by Bethany Smith

The new Integrated Classifier Pipeline system uses genetic fingerprints to identify unintended bystander CRISPR edits. A confocal microscope image of an early blastoderm-stage nucleus in aDrosophila(fruit fly) embryo uses colorful fluorescent markers to highlight the homothorax gene undergoing transcription from two separate parental chromosomes (two distinct signal clusters). Credit: Bier Lab, UC San Diego

The ICP system can cleanly establish whether a given individual insect has inherited specific genetic components of the CRISPR machinery from either their mothers or fathers since maternal versus paternal transmission result in totally different fingerprints, said Bier, a professor in the UC San Diego School of Biological Sciences.

The ICP can help untangle complex biological issues that arise in determining the mechanisms behind CRISPR. While developed in insects, ICP carries vast potential for human applications.

There are many parallel applications of ICP for analyzing and following CRISPR editing outcomes in humans following gene therapy or during tumor progression, said study first author Li. This transformative flexible analysis platform has many possible impactful uses to ensure safe application of cutting-edge next-generation health technologies.

ICP also offers help in tracking inheritance across generations in gene drive systems, which are new technologies designed to spread CRISPR edits in applications such as stopping the transmission of malaria and protecting agricultural crops against pest destruction. For example, researchers could select a single mosquito from the field where a gene-drive test is being conducted and use ICP analysis to determine whether that individual had inherited the genetic construct from its mother or its father, and whether it had inherited a defective element lacking the defining visible markers of that genetic element.

The CRISPR editing system can be more than 90 percent accurate, said Bier, but since it edits over and over again it will eventually make a mistake. The bottom line is that the ICP system can give you a very high-resolution picture of what can go wrong.

In addition to Li and Bier, coauthors included Lang You and Anita Hermann. Prior Bier lab member Kosman also made important intellectual contributions to this project.

Funding for the study was provided primarily by an award from the Bill and Melinda Gates Foundation.

Competing interest disclosure: Bier has equity interest in two companies he co-founded: Agragene Inc. and Synbal Inc., which may potentially benefit from the research results. He also serves on Synbals board of directors and the scientific advisory boards for both companies.

Read this article:
New Genetic Analysis Tool Tracks Risks Tied to CRISPR Edits - University of California San Diego

Recommendation and review posted by Bethany Smith

ICP: an integrated pipeline for classifying CRISPR/Cas9 induced mutant alleles

We developed an integrated bioinformatic tool ICP (Integrated Classifier Pipeline), to parse complex DSB repair outcomes induced by CRISPR/Cas9 and automatically call for experimental errors generated during NGS library preparation and sequencing: 1) a Nucleotide Position Classifier (NPClassifier), and 2) a Single Allele-resolution Classifier (SAClassifier). We employed these two complementary sequence analysis modules in tandem to enable in-depth interpretation of deep sequencing data at single allele resolution (Fig.1ac, see Methods section for detailed description of ICP tools). In line with the unique DNA signatures generated by distinct DSB repair pathways, we categorized the repair products into four major categories. Alleles with a deletion only on the PAM-distal side (PAM-proximal side was protected by Cas9 protein after cleavage), a common category, were termed as PEPPR class mutations (PAM-End Proximal Protected Repair, PEPPR)41,42. While single strand cleavage by the Cas9 RuvC domain can also nick the non-complementary strand at locations beyond the canonical site between the 6th and 7th nucleotide upstream of the PAM sequence, we restrict our analysis here to the majority cases wherein Cas9 cleavage generates blunt DSB ends to simplify the robust classification scheme developed in this study43,44,45. Mutant alleles judged to be generated by directly annealing 2bp microhomology sequences spanning the gRNA cleavage site were assigned into MMEJ class (again acknowledging that such alleles can also be generated with 1bp microhomology sequence, which however, are not readily amenable to the semi-automated analysis we developed)46,47,48, while pure deletion alleles not belonging to either the PEPPR or MMEJ categories were classified as DELET class mutations. Remaining alleles that include insertions-only and indels (deletion plus insertion) were categorized as insertion class (INSRT) mutations (Fig.1b).

The process of DSB repair pattern profiling consists of preparing a NGS library (a), classifying the resulting parsed alleles (b) and displaying processed alleles by rank order and class of mutations (c). a NGS library preparation: Genomic DNA from F1 test flies carrying both Cas9 and gRNA expressing cassettes either maternally (dark blue bars) or paternally (red bars, or progeny from other designated crosses) are subjected for targeted PCR amplification with primers containing Illumina compatible adapters at the 5 terminal to detect somatic indels. The gray rectangle represents a short region of genomic DNA containing a Cas9/gRNA target: purple circle depicts Cas9 protein and sky-blue line is gRNA. b Classification: Raw NGS data are subjected to the NPClassifier to parse alleles into specific primary categories required for building allelic dictionaries used by the SAClassifier. Four major indel groups are categorized: PEPPR (PAM-End Proximal Protected Repair, sky-blue), MMEJ (Microhomology Mediated End-Joining, dark pink), DELET (deletion, any deletions do not belong to PEPPR and MMEJ, orange) and INSRT (insertion, including the alleles only with inserted nucleotides or had deletions and insertions, purple). The 24-nt short PEPPR, MMEJ and DELET dictionaries are used for a more accurate classification and error calling by binning together all alleles with the same seed region that match primary allelic entries in the SAClassifier dictionaries. c DSB repair pattern visualization: intuitive rendering of the processed raw sequence data as an output of rank ordered classes of alleles. Allelic classes derived from NGS sequencing of individual flies or mosquitoes are displayed by their ranked frequency (allele landscape) and repair pattern fingerprints (color-coded by categories).

Briefly, raw reads generated from deep sequencing were subjected to a preliminary categorization using the NPClassifier, which recognizes the relative positions of editing start- and end-points flanking Cas9 cleavage site and then generates a collection of priori alleles for each category. These primary outputs (MMEJ and DELET) were used for building full-length standard comprehensive dictionaries listing all observed mutations and derived 24-nt short dictionaries (with the same seed region flanking the Cas9 cleavage site) as inputs of the SAClassifier. In addition, a synthetic PEPPR dictionary was built by iteratively increasing the length of deletions by a single nucleotide distal to the PAM site, excluding alleles belonging to the MMEJ category. By fishing the raw reads with 24-nt dictionaries, we were able to automatically recognize reads that also contained experimentally generated errors (e.g., from PCR amplification), which usually are located outside of the narrow 24-nt short dictionary window, thereby assigning such composite alleles to correctly matched root alleles (Fig.1b). These dual iteratively employed ICP classification tools provide a robust and precise classification of CRISPR/Cas9 induced DSB repair outcomes. Next, we developed an evocative user-friendly interface to visualize processed allelic category information in the form of rank ordered allelic landscape plots and repair pattern fingerprints (color-coded DSB repair categories), both of which are sorted by read frequency (Fig.1c). These intuitively accessible data outputs are far more informative and discriminating than the unprocessed primary DNA sequence reads (e.g., compare the seemingly idiosyncratic raw lesions depicted in Fig.2a to the obviously unique processed and concordant replicate patterns shown Fig.2b, c). The ICP was thus employed to visualize results in all the following experiments.

a Examples of the top five somatic indels from individual flies derived from split-drive crosses in which the Cas9 transgene is inherited either maternally (Maternal-S, left) or paternally (Paternal-S, right), but separately from a cassette carryingthe gRNAtransmittedby the other parent. Purple stars indicate the color codes for mutation categories (dark pink: MMEJ, sky-blue: PEPPR, orange: DELET, purple: INSRT) and dark green star indicates the separate raw sequence color coded for the four nucleotides A, T, G, and C. The red bar indicates Paternal-S crosses while dark blue bar represents Maternal-S crosses. b Landscapes of top 50 alleles ranked by reads ratio. All six sequenced individual flies are plotted together, with dark blue lines plotting the data from Maternal-S crosses and the red lines from Paternal-S crosses. The y-axis presents the fraction of reads for a given allele and the x-axis depicts the top 50 alleles according to rank order by read frequency. c DSB repair fingerprints for three representative sequenced individual flies from each cross. The x-axis is the same as depicted in panel b. Both panels show the top 50 ranked alleles. d. Bar plots of Class Fraction for top 50 alleles. Color codes for classes are as in panels a and c. Correlation analysis of two out of three replicates from Maternal-S cross (e) or Paternal-S (f) cross. r2 values and p-values are indicated. Source data for panels b, d, e and f are provided as a Source Data file.

Since DSB repair outcomes have been found to vary considerably as a function of Cas9 or gRNA source and level49,50, we employed the ICP platform to parse somatic indels generated by co-expressing Cas9 and gRNAs in somatic cells of fruit flies (Drosophila melanogaster) and mosquitoes (Anopheles stephensi) in various configurations associated with gene-drive systems. We first applied ICP analysis to a split gene-drive system inserted into the Drosophila pale (ple)gene that is designed to detect copying of a gene cassette in somatic cells. This element, referred to as a CopyCatcher (pleCC), carries a gRNA targeting the first intron of Drosophila ple locus49. In this current study, we make use of low-level ectopic somatic Cas9 expression (which is substantial and broad for vasa-Cas9) to analyze DSB repair patterns across diverse cell types in F1 progeny carrying both Cas9 and gRNAs51,52,53. Because cells actively undergoing meiosis make up only a small fraction of dividing cells in an adult fly, the mutational effects of Cas9/gRNA cleavage in such F1 individuals largely reflect the somatic action of these nuclease complexes. We thus conducted several alternative crossingschemes to assess the somatic mutagenic activity of vasa-Cas9 and gRNA components when transmitted to F1 individuals in various configurations from their F0 parents: 1) Maternal Split (Maternal-S, females carrying vasa-Cas9 crossed with males carrying pleCC); 2) Paternal Split (Paternal-S, males carrying vasa-Cas9 crossed with females carrying pleCC); and 3) Maternal Full (Maternal-F, females carrying both the pleCC and vasa-Cas9 transgenes); or Paternal Full (Paternal-F, males carrying both the pleCC and vasa-Cas9 transgenes)49. Comparative ICP analysis revealed several striking and consistent differences between the prevalent somatic mutations generated in individual progeny in each of these different crossing schemes. In the case of Paternal-S crosses, the resulting mutations were dominated by PEPPR alleles (4 out of top 5 alleles in Fig.2a, Fig. S1a, and 70% of the top 50 alleles as rendered in rank ordered allelic landscapes and color coded DSB repair fingerprints in Fig.2c). In contrast, Maternal-S crosses primarily generated MMEJ and INSRT indels (4 out of top 5 alleles were MMEJ, and at least 50% of the top 50 alleles were INSRT mutations, Fig.2a, c, Supplementary Fig. S1a). These differences were also evident in the steeper allelic landscape curves that were generated from the Maternal-S versus Paternal-S crosses (Fig.2b) as characterized by the initial portion of the curve depicting the 5 most frequent alleles (i.e., the dark blue lines in Fig.2b are all above the red lines for the 5 most frequent alleles). We further quantified differences in allelic profiles between crosses by bar plots displaying the summed proportions of the different allelic classes (summing the percentages of all alleles from each category) which we termed as Class Fraction (Fig.2d). This analysis revealed that INSRT alleles were generated at a significantly higher frequency in Maternal-S crosses, while the PEPPR class dominated among the top 50 alleles in the reciprocal Paternal-S crosses (Fig.2d).

A striking feature of the highly divergent DSB repair signatures generated from maternally versus paternally inherited Cas9 sources was the remarkable reproducibility of their DSB repair fingerprints observed across three individual replicates from each cross (Fig.2e, f). We performed a correlation analysis within replicates by extracting 23 common alleles across all six sequenced flies and plotted the resulting allelic profiles together relative to an arbitrarily chosen Paternal-S replicate as reference (bold red line, Supplementary Fig. S1b). We observed that the frequency distributions of these 23 common alleles were much more similar to each other within intra-cross comparisons than between inter-crosses (Supplementary Fig. S1b). This trend was also revealed by higher correlation coefficients for intra-cross comparisons than for inter-cross comparisons based on allelic read ratios (Supplementary Fig. S1cg). Conspicuous defining differences between the Maternal-S and Paternal-S fingerprints were also evident based on the Class Fraction index (Fig.2d). In summary, a variety of differing statistical measurements all underscore the robust consistent similarities shared among allele profiles generated from individual replicates of same cross and clearly distinctive DSB repair pattern fingerprints generated by maternal versus paternal Cas9 inheritance.

We extended our ICP analysis of mutant allele profiles generated in the ple locus to the more extreme Maternal-F (dark blue lines) and Paternal-F (red lines) cross schemes to assess the role of inheritance patterns when both the source of vasa-Cas9 and gRNA originated from a single parent49. Again, we observed highly dominant alleles in the Maternal-F crosses, clearly evident in allelic landscapes, that deviated markedly from those produced by the Paternal-F crosses, which produced more evenly distributed spectra of alleles spread across a broad range of allelic frequencies (Fig.3a, b). As expected based on these large differences, the repair pattern fingerprints generated from different crosses produced clearly distinguishable patterns of mutation classes, which was particularly evident when considering the Class Fraction (Fig.3e). Cumulatively, these data suggest that the developmental timing and/or levels of Cas9 expression (maternal, early zygotic, or late zygotic) are likely to play a key role in determining which particular DSB repair pathway or sub-pathway is engaged in resolving DSBs.

ad Unique DSB repair signatures obtained using different Cas9 sources are displayed with the top 20 alleles (landscapes and DSB repair pattern fingerprints). NGS sequencing was performed on pools of 20 adults. a vasa-Cas9 inserted in the X chromosome and the pleCC element carrying the gRNA were both carried by either female or male parents, mimicking a full-drive configuration (Maternal-F and Paternal-F crosses with vasa-Cas9). b vasa-Cas9 split crosses wherein the Cas9 transgene was transmitted either maternally (Maternal-S) or paternally (Paternal-S) and the pleCC gRNA bearing cassette was carried by the other parent. Same Maternal-S versus Paternal-S crosses as in panel b, but using either actin-Cas9 (c) or nanos-Cas9 (d) sources. e Class Fraction Index for crosses in panels ad. Bars are shaded according to allelic class color codes. f UMAP embedding for visualizing a common set of 59 alleles shared between the four split crosses with actin-Cas9 and vasa-Cas9. Dots represent single alleles, and the colors indicate the allelic category. g Distribution of top 20 alleles generated from single flies derived from across between parents carrying theSpo11 gRNA and vasa-Cas9elements (Paternal-S cross: red lines and Maternal-S cross: dark blue lines). The top plot shows the allelic landscape for the top 20 alleles from all six sequenced single flies and the bottom shows three examples of the classification fingerprints (with all allelic classes condensed into single rows) color coded for the allele categories. h Class Fraction Index for Spo11 gRNA crosses. i, j Correlation analysis between two replicates from each cross. Dark blue is Maternal-S and red is for Paternal-S. r2 values and p-values are indicated. Source data are provided as a Source Data file.

Previous studies have shown that the relative frequencies of NHEJ versus HDR events depend on the source of Cas9 both in terms of timing and level of expression49,50,54. We thus wondered whether ICP analysis would similarly reveal distinct DSB repair outcomes for two additional Cas9 sources (actin-Cas9 and nanos-Cas9, expressing level of Cas9: actin-Cas9>vasa-Cas9>nanos-Cas9) inserted at the same locus with vasa-Cas9 (Fig.3c, d)49.

As was observed for the vasa-Cas9 source, the actin-Cas9 and nanos-Cas9 sources both generated differing allelic landscapes and repair pattern fingerprints when transmitted maternally versus paternally, which also were readily distinguishable from each other (Fig.3bd). Mirroring results with the vasa-Cas9 source, significant differences between the proportions of PEPPR versus MMEJ class among the top 20 alleles were observed in Maternal-S versus Paternal-S crosses for actin-Cas9. For the nanos-Cas9 source, both the MMEJ and INSRT categories were particularly reduced in Paternal-S crosses, although this latter sex-based difference was not as dramatic as for the other Cas9 sources (presumably due to its more germline restricted expression, Fig.3d)55,56. Overall, the general trend once again indicated that maternally inherited Cas9 sources biased somatic DSB repair outcomes in favor of MMEJ and INSRT classes over PEPPR alleles, while paternal transmission of Cas9 generated mutant alleles dominated by PEPPR class alleles (Fig.3e).

Based on the overall similarities of the DSB repair outcomes observed for actin-Cas9 and vasa-Cas9 crosses, we extracted a set of 59 shared alleles that appeared in all sequenced samples and performed UMAP (Uniform Manifold Approximation and Projection) analysis to cluster these common alleles, condensing them into 5 distinct clouds (Fig.3f). Clouds 1, 2, 3, and 4 were dominated by alternative subsets of PEPPR alleles distinguished primarily by the length of deletion (the average deletion sizes were 24bp, 40bp, 31bp for PEPPR Mini, Midi-I and Midi-II cluster, and it was longer than 55bp for PEPPR Maxi cluster), while cloud 5 was predominantly comprised of MMEJ alleles. We reviewed raw sequences for the few trans-cloud assigned alleles and discovered that some of these alleles could be interpreted as having been generated from a second round of repair using one of the core alleles from the same cloud as a repair template. For example, we inferred that allele 58 was actually a PEPPR deletion with several nucleotides potentially having been back-filled. This result is consistent with the previous report that alleles with insertions or complex repair outcomes would be generated from several rounds of synthesis following the generation of a primary deletion event57,58. Assessing the impact of such potential complexities, which we ignore here for simplicity, will require additional future scrutiny. The remainder of these alleles, such as allele 44, could be accounted for variability in the exact Cas9 cleavage site (between the 6th and 7th nucleotidescounting from the PAMside), with an extra nucleotide being deleted on the PAM-proximal side of the gRNA cleavage site (Fig.3f)43,59,60. Since both of these outcomes were rare, we hypothesized second-order origins for such outlier alleles further validate the robust nature of our ICP platform in recognizing core primary categories of DNA repair outcomes. We also analyzed the common 59 alleles by plotting their read frequencies and observed that the differences between the allelic landscapes for the two reciprocal crosses per each Cas9 source mirrored the trend in Fig.3ad described above (Supplementary Fig. S2a, b). Cumulatively, these concordant findings support a key role for theparental origin of Cas9 servingas a major determinant of the DSB repair outcome.

Another obvious determinant of DSB repair outcome is the local genomic DNA context. We assessed the general applicability of theICP by employing it to classify alleles generated by gRNAs targeting four other loci: prosalpha2 (pros2), Rab11, Spo11 and Rab5 using the vasa-Cas9 source61. Paralleling our findings from the ple locus, we observed divergent allelic profiles between Paternal-S and Maternal-S crosses with distinct dominant mutation categories based on the specific target site. For example, the predominant allelic classes generated at the Spo11, pros2 and Rab11 loci were PEPPR and INSRT alleles, while PEPPR and MMEJ alleles were most prevalent for the Rab5 targets (Fig.3g, h, Supplementary Figs. S36). Among these four targets, Spo11 displayed the greatest divergence in the prevalence of top alleles generated from Maternal-S and Paternal-S crosses (reminiscent of the fine distinctions parsed for the ple locus, Fig.3g). We nonetheless still observed high correlation coefficients between two replicates within the same cross and significantly lower correlation coefficients associated with inter-cross comparisons between maternal versus paternal Cas9 inheritance (averaged r2=0.33, Fig.3i, j, Supplementary Fig. S3). We also observed distinctive sex-specific DSB repair patterns for Cas9 transmission at the pros2 and Rab11 gRNAs targeting sites (Supplementary Figs. S4 and S5), although these differences were less pronounced than for ple and Spo11 gRNAs, while for Rab5, the allelic patterns were similar for both maternal and paternal crosses (Supplementary Fig. S6, see Supplementary Discussion Section). In summary, these data support the broad utility of the ICP pipeline to deliver unique discernable locus-specific fingerprints associated with distinct parental inheritance patterns of Cas9 that generalize to other genomic targets.

Given the strong Cas9 inheritance-dependent distinctions observed for allelic profiles resulting from maternal versus paternal Cas9/gRNA-induced DSBs in Drosophila, we wondered whether similar DSB repair pattern fingerprints could be discerned in mosquitoes carrying a linked full gene-drive in which the Cas9 and gRNA transgenes are carried together in a single cassette62,63,64,65. We examined this possibility using the transgenic An. stephensi Reckh drive,which is inserted into the kynurenine hydroxylase (kh) locus63. Because of the Cas9 and gRNA linkage, the Reckh drive behaves as the Maternal-F and Paternal-F cross configurations described above in which all CRISPR components are carried by a single parental sex63.

Consistent with our observations in flies, the Reckh Maternal-F crosses generated a high proportion of indels that were dominated to a remarkable extent by single mutant alleles with read percentages exceeding 85% for each of the three single mosquitoes sequenced, followed by a long distributed tail of lower frequency alleles. The highly biased nature of the replicate allelic distributions is readily revealed by a virtual step-function in their rank-ordered allelic landscapes (Fig.4a). In striking contrast, over 50% alleles recovered from the Paternal-F crosses were wild-type (WT), which presumably reflects alleles that either remained uncut or DSB ends that were rejoined accurately without further editing. The highly predominant WT allele was followed by a very shallow tail distribution of low frequency mutant alleles in the paternal rank-ordered allelic landscapes (Fig.4a). This dramatic difference in allelic profiles between Maternal-F versus Paternal-F crosses was also clearly displayed by the class-tally bars color coded for the different fractions of each class (black = WT) located beneath each landscape (Fig.4a). Here, the Class Fraction Index measure indicated that Maternal-F crosses generated a greater proportion of INSRT alleles in the first two samples, while Paternal-F crosses produced a high frequency of PEPPR alleles (Fig.4b). As in the case of allelic profiles recovered at the ple and Spo11 loci in flies, common sets of highly correlated mutant DSB repair fingerprints were observed across all three replicates of the Paternal-F Reckh crosses (Supplementary Fig. S7). A similar comparison of allelic distributions in the maternal crosses was precluded by virtue of the single highly dominant alleles and corresponding paucity of lower frequency events, the nature of which varied greatly between replicates. We conclude that the high-resolution performance of the ICP platform in Drosophila can be generalized to other insects such as An. stephensi to robustly discern sex-dependent CRISPR transmission patterns resulting in distinct DSB repair outcomes.

a Rank-ordered landscapes of the top 50 alleles generated from NGS analysis of single mosquitoes. Colored bars with red dots indicate mutated alleles, and black bars with black dots indicate an unmutated WT allele. Middle panels: allelic class fingerprints color coded as in previous figures. Bottom bars: fraction of each allelic class, including WT (black), PEPPR (sky-blue), MMEJ (deep pink), DELET (orange) and INSRT (purple). Numbers indicate the percentage of the corresponding class. b Class Fraction Index for single mosquito sequencing data in panel a. c Developmental time-points for sample collections. d Kinetics of Cas9 mutagenesis generated by the Reckh gRNA. Lines represent the summed fraction of mutant alleles at each time-point. Dark-blue lines indicate maternal (Maternal-F) crosses and red lines paternal (Paternal-F) crosses. e DSB repair fingerprints at different timepoints. Samples were collected at the time points shown in panel c and 20 eggs, larvae, pupae or adults were pooled together for genomic DNA extraction and deep sequencing. The far left and far right panels indicate the Class percentages including WT alleles (black), displaying the proportion of each class at single time-points. Source data are provided as a Source Data file.

Given the dramatic differences we observed in the frequency and nature of somatic alleles generated in maternal versus paternal-sourced Cas9 in both flies and mosquitoes, we wondered whether the developmental timing of Cas9/gRNA expression (maternal=early? and paternal=late?) was the key determinant for these highly reproducible DSB repair fingerprints. We tested this hypothesis by assessing whether DSB repair fingerprints varied as a function of developmental progression using a series of narrowly timed sample collections of F1 mosquitoes produced from crosses of Reckh parents to WT and assayed DSB repair spectra using the ICP pipeline at 12 different developmental stages (Fig.4c. Note: as homozygous Reckh transgenic mosquitoes were crossed to WT, all F1 progeny carried one Reckh allele and one WT receiver allele, the latter of which was amplified for DSB repair analysis). We tracked a diminishing proportion of WT (presumably uncut) alleles and a corresponding increase in mutant alleles of various classes at each of the time points (Fig.4d). Strikingly, nearly half of the target alleles were edited in embryos by 30minutes post-oviposition for both the Maternal-F and Paternal-F Reckh crosses, which corresponds to early pre-blastoderm stages prior to the maternal-to-zygotic transition, suggesting a very early activity of Cas9 in mosquito embryos driven either by maternally inherited Cas9/gRNA complexes or potentially by very early zygotic expression of the Cas9 and gRNA components (Fig.4d)66. We also observed similarly frequent indels being generated as early as 30min in flies expressing Cas9 (either maternally or paternally) with a gRNA targeting the pros2 locus, although the dynamics of Cas9 production are distinct in these two organisms (Supplementary Fig. S8a). Following this initial surge in target cleavage, we observed divergent trajectories in the accumulation of mutant alleles between maternal versus paternal lineages. As an overall trend, mutant alleles accumulated progressively in the Maternal-F lineage until virtually no WT alleles remained, while in Paternal-F lineage, even at the endpoint of adulthood, approximately 60% of WT alleles persisted, in line with our single time point experiments (Fig.4a, d, Supplementary Fig. S8b). As observed in the final distributions of adult alleles, progeny from Maternal-F crosses tended to be enriched for INSRT alleles over the entire developmental time course, while PEPPR alleles were more common in Paternal-F crosses with pronounced accumulation of such alleles during later stages (Fig.4e). A finer scale analysis of the categories of mutant alleles generated over time revealed dynamic patterns of prevalent alleles during mosquito developmental stages (Fig.4e). For example, the proportion of MMEJ alleles peaked at the 2-hour and 4-hour time points (Fig.4e). Similarly, a split-drive expressing a gRNA targeting the Drosophila pros2 locus generated distinct temporal profiles of cleavage patterns in crosses from female versus male parents carrying the drive element (Supplementary Fig. S9).

One unexpected feature of the developmental variations in allelic composition we observed was that the proportion of WT alleles increased at certain time points (e.g., 1-hour in maternal cross and 12-hour - day 1=24h in paternal cross). These temporal fluctuations were also observed in flies expressing Cas9 and a pros2 gRNA at two hours after oviposition (Supplementary Figs. S8a and S9), revealing that this phenomenon might reflect a generally relevant form of clonal selection for WT cells during pre-blastoderm stages. The latter clonal selection might arise if mutant cells experienced negative selection at certain development stages. In the case of paternal transmission, one strong line of evidence supporting this WT clonal selection hypothesis is that in adults, the Reckh element is transmitted to over 99% of F1 progeny, indicating that nearly all target alleles in the germline must be WT. This high frequency of paternal germline transmission is also consistent with the high prevalence of WT alleles tallied at 12h in embryos derived from the paternal crosses (Fig.4e, see Supplementary Discussion Section for more in-depth consideration of this point). We analyzed the developmental distributions of 21 common alleles that were generated at all time-points (Supplementary Fig. S10ae). Most of these common alleles belonged to the PEPPR class, while only five were INSRT alleles, despite the INSRT class overall being the most prevalent for both crosses, again suggesting that INSRT alleles have a higher diversity than other mutation categories (Supplementary Fig. S10a). Overall, this analysis is in line with our previous observation that Maternal-F crosses produced more INSRT alleles while Paternal-F crosses generated a preponderance of PEPPR alleles (Supplementary Fig. S10b).

Given the strong influence of maternal versus paternal origin of Cas9 on the resulting distributions of alleles characterized above by ICP analysis, we wondered whether such allelic signatures could be exploited for lineage tracing in randomly mating multi-generational population cages. We first examined ICP outputs from a controlled crossing scheme carried out over three generations with pleCC and Reckh gRNAs to derive allelic fingerprints distinguishing parents of origin by identifying both somatic alleles in the F1 generation as well as assessment of which of those alleles might be transmitted through the germline to non-fluorescent progeny (i.e., those not inheriting the pleCC or Reckh element) at the F2 generation (Fig.5ad, Supplementary Fig. S11). As anticipated, in both pleCC and Reckh Maternal-F crosses, single dominant somatic alleles were observed in the F1 generation, with the top single allele representing more than 50% of all alleles (Fig.5a, c). Furthermore, all such predominant somatic mutant alleles, which precluded gene-cassette copying of the pleCC or Reckh drive elements in those F1 individuals, were transmitted faithfully through the germline to non-fluorescent F2 progeny with approximately 50% frequency. Furthermore, we observed marked differences in the other half of total reads in F2 progeny depending on the origin of Cas9/gRNA complexes. Thus, a distribution of multiple diverse low frequency mutations were generated when crossing F1 pleCC+ or Reckh+ females with WT males (presumably derived from F1 drive females having deposited Cas9/gRNA complexes maternally that then acted on the paternally sourced WT allele somatically in F2 individuals). In the reciprocal male cross, however, approximately 50% of all alleles remained WT (Fig.5b, d, Supplementary Fig. S12af). These findings support the hypothesis that the top somatic indels derived from maternal Cas9 sources were generated at very early developmental stages (possibly at the point of fertilization or shortly thereafter during the first somatic cell division), resulting in a single mutant allele being initially produced and then transmitted to every descendent cell including all germline progenitor cells49. With the paternal-sourced Cas9 and gRNA, arrays of variable somatic mutations were recovered with the most prominent alleles accounting for fewer than 10% of the total alleles in F1 progeny (Fig.5b). Accordingly, paternally generated F1 somatic alleles were more randomly transmitted via the germline of individuals that failed to copy the gene cassette for either the pleCC or Reckh elements. As a result of this diversity of somatic F1 alleles, only occasionally were the most prevalent alleles also transmitted through germline (e.g., individuals 1, 4 and 5 in Fig.5b, Supplementary Fig. S12gl).

Primary DNA sequences of top single alleles and their percentages of the total alleles from six individual sequenced flies derived from ple gRNA Maternal-F (a) and Paternal-F (b) crosses. Gray bars indicate the location of the gRNA protospacer and red arrowheads are the associated PAM sites. The first row depicts the reference sequence covering the expected DSB cleavage site. Colored squares in the right column indicate the class to which a given allele belongs to. The tables shown on the right of each allele show its frequency among all reads. Left columns of the table indicate frequencies of the somatic allele, and the right columns are the top germline mutant allele frequency obtained by sequencing F2 non-fluorescence progeny derived from same F1 individuals whose top somatic allele is displayed in the left column (excluding WT alleles). Colored dots indicate different alleles with the same color shared between two columns indicating that the same allele appeared as both top 1 somatic and germline indels from the same F0 founders. c, d Allele profiles generated by Reckh parents and progeny generated with the same crossing scheme as for the pleCC. c Tabulation of the Maternal-F cross. d Tabulation of the Paternal-F cross. e Crossing scheme forthe Reckh cage trials. Three individual cages were seeded with 10 homozygous Reckh females, 90 WT females and 100 WT males for the maternally initiated lineage, while the paternally initiated cages were seeded with 10 homozygous Reckh males, 90 WT males and 100 WT females. At each of the following three generations, 10 Reckh+ females and 10 Reckh+ males were randomly collected for single mosquito deep sequencing. f Biased inheritance of Reckh was observed in the maternally seeded cages at generations 2 and 3, but not for the paternally seeded cages. Pink bars denote the fraction of sequenced individual mosquitoes inheriting Reckh from female parents, and cyan colored bars represent Reckh inheritance from the males. Source data are provided as a Source Data file.

The Reckh element in mosquitoes performed similarly to the fly pleCC, however, Reckh F1 individuals displayed less frequent zygotic cleavage and a corresponding reduction in the diversity of resulting somatically generated mutations (>50% WT alleles remained, Paternal-F cross). Consistent with this limited number and array of somatic mutations in the F1 generation from Paternal-F cross, NHEJ mutations were only rarely transmitted to the F2 generation, probably due to more germline-restricted expression of vasa-Cas9 in mosquitoes as compared to flies (Fig.5c, d). These results again suggest that cleavage and repair events were generated later during development in paternal crosses resulting in a stochastic transmission of F1 somatic alleles to the germline, which were largely uncorrelated with the most prevalent allele present somatically in the F1 parent49. Taken together, these highly divergent sex-dependent DSB repair signatures suggested that such genetic fingerprints could be used to track parental history in the context of randomly mating multi-generation population cages.

Based on the highly dominant mutant indels (Maternal-F) versus WT (Paternal-F) alleles generated by Reckh genetic element described above, we evaluated inheritance patterns of indels in multi-generational cages initiated by a 5% introduction of Reckh into WT populations either through maternal or paternal lineages in the F0 generation (Fig.5e). We randomly selected at least 20 fluorescence marker-positive mosquitoes (10 females and 10 males) for NGS analysis at generations 2 and 3, when the Reckh allele was still present at relatively low frequencies in the population and random mating was more likely to have taken place between Reckh/+ heterozygous and WT mosquitoes. Thus, we envisioned that the source of Reckh allele could be tracked back to a male versus female parent of origin by examining whether a dominant WT allele was present (inherited paternally) or not (inherited maternally) (Fig.5e, f). Following this reasoning, we inferred a strong bias for progeny inheriting the Reckh element from a Reckh+ males mating with WT females during generations 2 and 3 than the reverse (i.e., female transmission of Reckh alleles) in the maternally seeded lineage. Indeed, in one maternally seeded replicate (cage 2, generation 3), 100% of the progeny had inherited the Reckh element from their fathers (Fig.5f). In contrast to the striking sex-specific transmission bias observed in maternally seeded cages, progeny from paternally seeded cages displayed more evenly distributed stochastic parental inheritance patterns (Fig.5f). These highly reproducible parent of origin signatures demonstrate the utility of ICP in allelic lineage tracking, which could be of great potential utility in evaluating alternative initial release strategies for gene-drive mosquitoes as well as post-release surveillance of gene-drives as they spread through wild target populations (see Discussion).

Another important challenge for deciphering DSB repair outcomes is to track both NHEJ and gene-cassette mediated HDRevents within the same sample. Such a comprehensive genetic detection tool could have broad impactful applications (see Discussion). For example, one important and non-trivial application is to follow the progress of gene-drives in a marker free fashion as they spread through insect populations. Such dual tracking capability would address the potential concern that mutations eliminating a dominant marker for the gene-drive element could evade phenotype-based assessments of the drive process. Accordingly, we devised a three-step short-amplicon based deep sequencing (200400bp) strategy based on tightly linked colony-specific nucleotide polymorphisms distinguishing donor versus receiver chromosomes to detect copying of two CopyCatcher elements, pleCC and hthCC, from their chromosomes of origin (donor chromosome) to WT homologous (receiver chromosome) targets (Fig.6a)49. Notably, this strategy only amplified the inserted gene cassette on the donor chromosome and or the cassette if it copied onto the receiver chromosome. Thus, the measured allelic frequencies indicate the relative proportions of gene cassettes copied to the receiver chromosome versus those residing on the donor chromosome (Fig.6b displays the inferred somatic HDR frequency quantified from the three-step NGS sequencing protocol as well as Indels quantified by our standard 2-step NGS sequencing protocol - see Methods section for additional details).

a Scheme for tracking gene-drive copying using NGS. Gray bars: genomic DNA, pink oval: Cas9 protein, sky-blue line: gRNA, colored asterisks: polymorphisms. Color coded rectangles represent four nucleotides. Four possible recombinants listed are generated by resolving Holliday junctions at different sites marked with black crosses. b NGS sequencing-based quantification of somatic HDR generated by pleCC in F1 progeny. Areas delineated by dotted lines indicate patches of cells in which somatic HDR copying events have taken place either under bright field (upper) or RFP fluorescent filed (middle). Bottom bars are the summary of the inferred frequency for the somatic HDR (orange), indels (green) and WT alleles (black) derived from the deep sequencing data using the same samples photographed above. More than three flies from each cross were imaged and used for analysis. Scale bars indicate 200 pixels. c Somatic HDR profile with ple gRNA. The red line is for Maternal-F cross and dark blue line for the Paternal-F cross. d Diagram of the hthCC. Black double arrow: recoded hth cDNA, blue rectangles: exon 1, light green rectangles: exons 2-14, and colored lines underneath represent probes used for detection. e In situ images with embryos laid from hthCC-vasa-Cas9 females crossed with WT males. Blue=exon 1, green=WT exons 2-14, red=recoded cDNA for exons 2-14. Insets are magnified single nuclei indicated by colored arrows. This experiment has been repeated at least three times. Scale bars stand for 10m. f Temporal profiles for somatic HDR-mediated copying of the hthCC element assessed by NGS as described for the pleCC in panels c and f. Y-axis tabulates the percentage of HDR at a given time point. Table at the bottom quantifies the HDR fraction at given time points for both the Paternal-F and Maternal-F crosses. Source data are provided as a Source Data file.

In our first set of experiments, we analyzed editing outcomes by examining F1 progeny derived from Maternal-S and Paternal-S pleCC crosses. We compared the rates of somatic HDR measured by NGS analysis to those evaluated by image-based phenotypes associated with copying of the CopyCatcher element. As summarized previously, CopyCatchers such as the pleCC are designed to permit quantification of concordant homozygous mutant clonal phenotypes (e.g., pale patches of thoracic cuticle and embedded sectors ofcolorless bristles), with underlying DsRed+ fluorescent cell phenotypes49. Individual flies in which imaging-based analysis had been conducted were then subject toseparate NGS HDR-fingerprinting and INDELs-fingerprinting resulting in a comprehensive quantification of HDR, NHEJ, and WT alleles within the same sample (Fig.6b, libraries for HDR-fingerprinting and INDELs-fingerprinting were prepared from the same individual fly, but with different DNA preparation and sequencing protocols as detailed description in Methods). For these experiments, F1 flies were genotyped and those carrying both Cas9 and pleCC gRNA were used for NGS analysis (data shown here are the inferred frequencies of somatic HDR, NHEJ events, and WT alleles). This dual integrated analysis revealed that HDR in the Maternal-S crosses resulted in ~15% somatic HDR-mediated cassette copying events on average based on sequencing, and that such cassette copying was yet more frequent in Paternal-S crosses, producing ~25% somatic HDR. The nearly two-fold greater HDR-mediated copying efficiency detected by sequencing in Paternal-S crosses mirrors phenotypic outcomes wherein maternally inherited Cas9 similarly results in a lower frequency of cassette copying detected by fluorescence image analysis in somatic cells than for paternally inherited Cas9 (Fig.6b)49.

Our genetic analysis of stage-dependent differences in DSB repair pathway activity in this study is consistent with a commonly held view in the gene-drive field based on a variety of indirect genetic transmission data that HDR-mediated cassette copying does not occur efficiently during early embryonic stages50,51,63,67,68,69,70. This inference, however, has not yet been verified experimentally. We thus sought to provide direct evidence supporting this key supposition using NGS-based HDR-fingerprinting to track the somatic HDR events across a range of developmental stages in both Maternal-F and Paternal-F crosses in which the Cas9 and gRNA transgenes are transmitted together either maternally or paternally using our validated NGS sequencing protocol. Notably, we collected samples at 9 timepoints and pooled 20 F1 progeny together for pooled sequencing to prime the developmental profile of somatic HDR with pleCC (samples were thus collected without genotyping since it is impractical to genotype individual embryos and young larvae). Because of the limitations imposed by embryo pooling we were unable to use the same samples collected here for also quantifying the generation of somatic NHEJ alleles (i.e., only half of the F1 progeny carried the vasa-Cas9 transgene on the X chromosome and those embryos lacking this transgene were not suitable for generating mutations - note that such an analysis was possible in the case of the viable Reckh drive shown in Fig.4e as well as for a viable split-drive allele inserted into the essential prosalpha2 locus shown in Supplementary Fig. S9). Indeed, NGS analysis detected only very rare examples of somatic HDR events in early embryos derived from both crosses (Fig.6c). Notably, HDR in the Paternal-F cross detected by this sequencing protocol increased substantially to 35.9% during adult stages, a period coinciding with the temporal peak of the pale expression profile (note that in this experiment we employed the actin-Cas9 rather than vasa-Cas9 source, which has higher level of Cas9 expression in somatic cells and generates a correspondingly higher frequency of somatic HDR)49.

We extended our sequencing-based strategy to quantify somatic HDR using a second CopyCatcher element (hthCC) designed specifically to identify even rare copying events in early blastoderm-stage embryos. The hthCC is inserted into the homothorax (hth) gene and was engineered to visualize HDR-mediated copying of the gene cassette by fluorescence in situ hybridization (FISH) using discriminating fluorescent RNA probes complementary to specific endogenous versus recoded cDNA sequences (Fig.6d, e). In this system, copying of the transgene from the donor chromosome to the receiver chromosome would be indicated by the presence of two nuclear dots of red fluorescence detected by the hth recoded cDNA-specific probe (indicating two copies of recoded hth cDNA). In contrast, cells in which no copying occurred should contain only a single nuclear red dot signal (from the donor allele). Such in situ analysis detected no clear case of gene cassette copying in any of the ~5000 blastoderm stage cells examined across ~500 embryos (with the caveat that some mitotic nuclei generate ambiguous signals depending on their orientation). This qualified negative result assessed by in situ analysis was consistent with the very low estimates of HDR frequency during the same early blastoderm-stage developmental window based on NGS analysis in staged time-course experiments, although the latter sequencing method did detect very low levels of somatic HDR at ~3hours after egg laying from the Paternal-F crosses (and no copying until day three of larvae with the maternal cross Fig.6df). The very low levels of somatic HDR observed in early embryos for the hthCC construct either by in situ hybridization or by NGS sequencing parallel the results summarized above for the pleCC element (Fig.6c, f). The maximal somatic HDR frequency observed for the hthCC Maternal-F crosses (0.06% at day 3 after egg laying) was somewhat lower than that for the similar cross for pleCC (0.35% at adult stage), consistent with the predominance of single mutant alleles being generated at very early stages following fertilization in Maternal-F crosses. In contrast to the exceedingly rare copying of the hthCC element detected in early embryos for either the Maternal-F or Paternal-F crosses, the same element frequently copied to the homologous chromosome during later developmental stages in Paternal-F crosses as assessed by NGS sequencing. The hthCC elementagain copied with somewhat lower efficiency than the pleCC element (e.g., 15.2% for hthCC versus 35.9% for pleCC tabulated in adults), presumably reflecting differing genomic cleavage rates or gene conversion efficiencies generated by their respective gRNAs (including total cleavage levels and temporal features). In aggregate, these two examples of quantitative analysis of copying frequencies based on both NGS and in situ analysis demonstrate that ICP and NGS-based quantification of gene conversion events can be successfully integrated for a comprehensive analysis of DSB repair outcomes, including both NHEJ and HDR events as a function of developmental stage. These powerful tools also could be applied for following gene-drive spread through freely mating populations in a marker-free manner as well as for a variety of other applications including gene therapy (see Discussion).

View post:
Developmental progression of DNA double-strand break repair deciphered by a single-allele resolution mutation ... - Nature.com

Recommendation and review posted by Bethany Smith

Our skin is a story, told chapter by chapter as we age. But what if we could rewrite it? That seemingly sci-fi future is already here thanks to cutting-edge technologies like exosomes, stem cells and bio-identical hormones. Changing the approach from preservation to regeneration, these new treatments and technologies are changing the narrative around aging.

Thats how New York dermatologistJulie Russak, MDdescribes the shift in her practice since employing these tools. The aging process leaves its mark on our skin, but advancements in regenerative medicine are rewriting the narrative, she says. Exosomes and stem cells, previously confined to the realm of science fiction, are now emerging as powerful tools in my dermatology arsenal.

The next big thing in dermatology, the exosome, is essentially a delivery system. Imagine microscopic envelopes meticulously created by stem cells, packed with genetic

instructions and protein packages, Dr. Russak explains. These are exosomes.

Just like envelopes, whats contained inside is whats really interesting.

Exosomes deliver key signaling molecules, instructing fibroblasts, or skin cells, to ramp up collagen production, Dr. Russak says. This translates to thicker, firmer skin with visibly reduced wrinkles and fine lines.

They offer an answer to sun damage as well.

Sun damage wreaks havoc on our skin, but exosomes offer a cellular-level repair kit, Dr. Russak explains. They promote the regeneration of UV-damaged structures, mitigating the appearance of sunspots and uneven tone. Unlike broad-spectrum approaches, exosomes excel at precision. They hone in on specific skin cells, ensuring their restorative cargo reaches the areas that need it most, maximizing effectiveness and minimizing potential side effects.

Stem cells are the master cells of regeneration, says Dr. Russak. These unique cells possess the remarkable ability to self-renew and differentiate into various specialized cell types, including those crucial for healthy skin.

In dermatology, stem cells are utilized to regenerate tissue and promote collagen production, which makes them perfect for tackling things like age spots, skin firmness and even hair loss. Theyre also employed during in-office treatments like microneedling and laser treatments to expedite recovery and maximize rejuvenation. Because they can be directed to become different kinds of skin cells, stem cells are especially versatile to dermatologists.

We use this versatility in dermatological treatments to replace damaged or aging cells with new, healthy cells, Dr. Russak explains. Both exosomes and stem cell treatments represent a shift towards a more regenerative and holistic approach in dermatology. Rather than merely masking the symptoms of aging skin, these treatments aim to restore the skins natural ability to heal and renew itself.

In the world of anti-aging, the name Dr. David Sinclair is a big one. Australian-American biologist and professor of genetics at Harvard Medical School, Dr. Sinclair has published pivotal work on the science of aging and longevity.

These innovative methods are partly inspired by groundbreaking research in cellular health and aging, including the work of Dr. David Sinclair, Dr. Russak explains. In the field of dermatology, theres a growing trend toward using regenerative medicine to slow aging, with a focus on treatments like exosomes, stem cell therapies and bio-identical hormone replacement therapy (BHRT).

Using exosomes in procedures like microneedling is just the beginning.

We are incorporating topical treatments with peptides and growth factors, as well as injectable therapies like PRP (Platelet-Rich Plasma) and biostimultary molecules like PLLC and CaHa to stimulate the skins natural repair processes, Dr. Russak explains.

Alongside things like diet, lifestyle change and nutraceuticals like NAD+ boosters, dermatologists aim to improve skin, slow down aging and potentially even reverse hair loss.

Unlike many traditional methods of anti-aging, exosomes and stem cells are a natural path to rejuvenation. Rather than masking signs of damage, these treatments are encouraging your body to do the work itself.

Its important to have realistic expectations and understand that multiple treatments may be necessary, Dr. Russak says. Rigorous clinical research is ongoing and long-term data is still needed to definitively establish the safety and efficacy of these treatments. While the future holds immense promise, I remain grounded in evidence-based practice, incorporating these innovations only when robust scientific data supports their benefit.

Due to the newness of these treatments, more long-term studies are needed to fully understand their safety and efficacy. Because the regulatory side of things havent caught up to the technology, practitioners also must consider how to ethically source stem cells and exosomes.

Patients should ensure treatments are performed by qualified professionals and that the products used are compliant with regulatory standards, Dr. Russak explains. As we are just at the very beginning of this exciting field, practitioners and patients need to exercise due diligence when considering these treatments.

Read the rest here:
Exosomes and Stem Cells Are the Future of Anti-Aging - NewBeauty Magazine

Recommendation and review posted by Bethany Smith

Jeffrey S. Heier, MD

Credit: Ophthalmic Consultants of Boston

Subretinal delivery of ABBV-RGX-314, a potential one-time gene therapy, was well-tolerated, with no clinically recognized immune response, in the treatment of neovascular (wet) age-related macular degeneration (nAMD), according to phase 1/2a results published in The Lancet.1

The publication detailed two-year data suggesting the novel approach of RGX-314 for sustained vascular endothelial growth factor (VEGF)-A suppression, with the potential to safely maintain vision and reduce treatment burden in patients with nAMD after a single dose.

Wet AMD is a chronic, life-long disease and real-world evidence shows patients are losing significant vision over time, and the burden of frequent anti-VEGF injections needed to manage their wet AMD is a major reason why, Jeffrey S. Heier, MD, director of the vitreoretinal service and retina research, Ophthalmic Consultants of Boston and the primary study investigator, said in a statement.2 A single treatment of ABBV-RGX-314 that can potentially provide long-lasting treatment outcomes and a strong safety profile would offer a novel approach to treating this serious and blinding disease.

Frequent anti-VEGF-A injections lessen the risk of rapid, severe vision loss among patients with nAMD, but the frequency-related burden could lead to undertreatment, and thus, vision loss over time.3 Sustained suppression of the VEGF-A pathway may provide the maintenance of vision and a reduction in the associated treatment burden.

RGX-314, an adeno-associated virus serotype 8 vector expressing an anti-VEGF-A antigen-binding fragment, is developed to allow continuous VEGF-A suppression after a single administration.2 REGENXBIO is investigating two separate routes of administration of RGX-314 to the eye, including standard subretinal delivery and suprachoroidal delivery.

Current results from the phase 1/2a, open-label, dose-escalation study reported the safety and efficacy of the subretinal delivery of five dose cohorts of RGX-314 for patients with nAMD.1 Between May 2017 and May 2019, investigators screened 110 patients with previously treated nAMD for eligibility criteria. The trials primary outcome was the safety of RGX-314 delivered by subretinal injection up to week 26.

After enrolling 68 individuals into the trial, 42 participants met the required anatomic response to intravitreal ranibizumab and received a single RGX-314 injection (dose range 3x109 to 2.5x1011 genome copies per eye). Participants were observed 1 day and 1 week after administration, then monthly for 2 years.

Analyses revealed 20 serious adverse events in 13 participants, with one event considered potentially related to RGX-314. The event was pigmentary changes in the macular with severe vision reduction 12 months after injection of RGX-314 at a dose of 2.5 x 1011 genome copies per eye.

Heier and colleagues observed asymptomatic pigmentary changes in the inferior retinal periphery months after subretinal RGX-314, primarily at doses of 6x1010 genome copies per eye or higher. In addition, the analysis demonstrated no clinically determined immune responses or inflammation outside of those expected after routine vitrectomy.

Overall, the doses of 6 x 1010 genome copies per eye or higher led to sustained concentrations of RGX-314 protein in the aqueous humor, as well as stable or improved BCVA and central retinal thickness, with little to no supplemental anti-VEGF injections administered in most participants.

Heier and colleagues noted these results inform the pivotal program to assess RGX-314 for the treatment of nAMD further. Two pivotal trials, ATMOSPHERE and ASCENT, are currently evaluating RGX-314 in patients with wet AMD with on-target enrollment.

RegenXBio expects these data to support regulatory submission with the US Food and Drug Administration (FDA) and European Medicines Agency (EMA) in late 2025 through early 2026.2

To have these Phase I/IIa data published in The Lancet highlights the groundbreaking work of our scientists and investigators, and further validates the clinically transformative nature of ABBV-RGX-314 as a potential one-time gene therapy for wet AMD that may help patients maintain or improve their vision, Kenneth T. Mills, president and chief executive officer of REGENXBIO, added in a statement.2

References

Link:
RGX-314 Gene Therapy for nAMD Well-Tolerated in Phase 1/2a Study - MD Magazine

Recommendation and review posted by Bethany Smith

Co-author Steven Gray, Ph.D., is Associate Professor of Pediatrics, Molecular Biology, Neurology, and in the Eugene McDermott Center for Human Growth and Development at UTSouthwestern.

DALLAS March27, 2024 A gene therapy developed by researchers at UTSouthwestern Medical Center for a rare disease called giant axonal neuropathy (GAN) was well tolerated in pediatric patients and showed clear benefits, a new study reports. Findings from the phase one clinical trial, published in the New England Journal of Medicine, could offer hope for patients with this rare condition and a host of other neurological diseases.

This trial was the first of its kind, for any disease, using an approach to broadly deliver a therapeutic gene to the brain and spinal cord by an intrathecal injection, said co-author Steven Gray, Ph.D., Associate Professor of Pediatrics, Molecular Biology, Neurology, and in the Eugene McDermott Center for Human Growth and Development at UTSouthwestern. Even with the relatively few patients in the study, there were clear and statistically significant benefits demonstrated in patients that persisted for years.

Dr. Gray developed this gene therapy with co-author Rachel Bailey, Ph.D., Assistant Professor in the Center for Alzheimers and Neurodegenerative Diseases and of Pediatrics at UTSW.Dr. Gray is an Investigator in thePeter ODonnell Jr. Brain Institute.

GAN is extraordinarily rare, affecting only about 75 known families worldwide. The disease is caused by mutations in a gene that codes for a protein called gigaxonin. Without normal gigaxonin, axons the long extensions of nerve cells swell and eventually degenerate, leading to cell death. The disease is progressive, typically starting within the first few years of a childs life with symptoms including clumsiness and muscle weakness. Patients later lose the ability to walk and feel sensations in their arms and legs, and many gradually lose hearing and sight and die by young adulthood.

In the clinical trial conducted at the National Institutes of Health (NIH), Drs. Gray and Bailey worked with colleagues from the National Institute of Neurological Disorders and Stroke (NINDS) to administer the therapy to 14 GAN patients from 6 to 14 years old. Using a technique they developed to package the gene for gigaxonin into a virus called adeno-associated virus 9 (AAV-9), the researchers injected it into the intrathecal space between the spinal cord and the thin, strong membrane that protects it. Tested for the first time for any disease, this approach enabled the virus to infect nerve cells in the spinal cord and brain to produce gigaxonin in nerve cells, allowing them to heal the cells axons, which grow throughout the body.

Amanda Grube, 14, one of the trial's participants, has seen improvement in her diaphragm and other muscles associated with breathing, her mother says. However, many of Amanda's other functions, including her mobility, did not benefit. (Photo credit: McKee family)

After one injection, the researchers followed the patients over a median of nearly six years to determine whether the treatment was safe and effective. Only one serious adverse event was linked to the treatment fever and vomiting that resolved in two days suggesting it was safe. Over time, some patients showed significant recovery on an assessment of motor function. Other measurements revealed that several of the patients improved in how their nerves transmitted electrical signals.

One of the trials participants, 14-year-old Amanda Grube, has experienced improvement in her diaphragm and other muscles associated with breathing, according to her mother, Katherine McKee. However, many of Amandas other functions did not benefit including her mobility.

Thats why I hope theres more to come from the research that can help patients even more,Mrs. McKee said. Amanda has dreams and ambitions. She wants to work with animals, save the homeless, and design clothes for people with disabilities.

Dr. Gray said that in many ways, the study offers a road map to carry out similar types of clinical trials. The findings have broader implications because this study established a general gene therapy treatment approach that is already being applied to dozens more diseases, he said.

Although the phase one results are promising, Dr. Gray said he and other researchers will continue to fine-tune the treatment to improve results in future GAN clinical trials. He is also using this method for delivering gene therapies to treat other neurological diseases at UTSW, where he is Director of the Translational Gene Therapy Core, and at Childrens Health. Work in theGray Labhas already led to clinical trials for diseases including CLN1 Batten disease, CLN5 Batten disease, CLN7 Batten disease, GM2 gangliosidosis, spastic paraplegia type 50, and Rett syndrome.

The GAN study was funded by the National Institute of Neurological Disorders and Stroke (NINDS), Division of Intramural Research, NIH; Hannahs Hope Fund; Taysha Gene Therapies; and Bamboo Therapeutics-Pfizer.

Drs. Bailey and Gray are entitled to royalties from Taysha Gene Therapies. Dr. Gray has also consulted for Taysha and serves as Chief Scientific Adviser.

About UTSouthwestern Medical Center

UTSouthwestern, one of the nations premier academic medical centers, integrates pioneering biomedical research with exceptional clinical care and education. The institutions faculty members have received six Nobel Prizes and include 25 members of the National Academy of Sciences, 21 members of the National Academy of Medicine, and 13 Howard Hughes Medical Institute Investigators. The full-time faculty of more than 3,100 is responsible for groundbreaking medical advances and is committed to translating science-driven research quickly to new clinical treatments. UTSouthwestern physicians provide care in more than 80 specialties to more than 120,000 hospitalized patients, more than 360,000 emergency room cases, and oversee nearly 5 million outpatient visits a year.

Read the original post:
Gene therapy offers hope for giant axonal neuropathy patients - UT Southwestern

Recommendation and review posted by Bethany Smith

According to latest study, the global advanced therapy medicinal products CDMO Market size was valued at USD 6.10 billion in 2023 and is projected to reach USD 34.53 billion by 2033, growing at a CAGR of 18.93% from 2024 to 2033.

Key Takeaways:

Request PDF Sample Copy of Report: (Including Full TOC, List of Tables & Figures, Chart)@ https://www.novaoneadvisor.com/report/sample/8439

owing to risingclinical trialsfor advanced therapy medicinal products and the increasing awareness among researchers about the benefits of advanced therapies, driving the advanced therapy medicinal products (ATMP) CDMO market growth. Tissue engineering has greatly benefited in recent years from technological development. The damaged tissues and organ function are replaced or restored using this technique. Similarly, gene and cell therapy are attracting a lot of patients for the treatment of rare diseases, whose incidence is rising globally.

With rising demand for robust disease treatment therapies, key players have focused their efforts to ramp up research and development for effective gene therapies that target the cause of disorder at a genomic level. According to ASGCT, the number of cell and gene therapies in the U.S. pipeline programs (phase I-III trials) increased from 483 in 2021 to 529 in 2022. Furthermore, the FDA delivers constant support for innovations in the gene therapy field via a number of policies with regard to product manufacturing. In January 2020, the agency released six final guidelines on the manufacturing and clinical development of safe & efficient gene therapy products.

Moreover, awareness about ATMP treatment options is being driven by initiatives aimed at informing the public about the benefits of these products, which, in turn, is leading to increased adoption of advanced therapies and fueling market growth for CDMOs. For instance, Alliance for Regenerative Medicine Foundation for Cell and Gene Medicine prioritizes activities for increasing public awareness through educational programs, underlining the clinical & societal benefits of regenerative medicine.

Increasing clinical trial activity along with new product launches generates growth opportunities for the market. As of 2022, there are 1451 ATMPs in preclinical stages and 535 are being studied in Phase 1 to 3 studies. Since August 2020, EMA has approved six of these additional ATMPs, and five more will be approved by 2023. In the UK, there were approximately 168 advanced therapy medicinal product trials underway in 2021, up from the 154 studies reported the year before, which is a 9% increase. 2021 saw a 32% increase in phase 1 trials, indicating a significant shift from experimental medicines to first-in-human studies.

On the other hand, key players are undertaking various strategic initiatives to introduce novel products, which is expected to propel market growth. For instance, in March 2021, CureVac N.V. signed a partnership agreement with Celonic Group, engaged in the manufacture of CVnCoV, CureVacs mRNA-based COVID-19 vaccine candidate. CureVac's COVID-19 vaccine candidate is manufactured at Celonic's commercial manufacturing unit for ATMPs and biologics in Heidelberg, Germany. Under the terms of the commercial supply agreement, the Celonic facility could produce over 100 million doses of CVnCoV.

Immediate Delivery Available, Get Full Access@ https://www.novaoneadvisor.com/report/checkout/8439

Advanced Therapy Medicinal Products CDMO Market Trends

Segments Insights:

Product Insights

The gene therapy segment held the largest share of over 49.11% in 2023. Increase in financial support and rise in number of clinical trials for gene therapies are driving demand for gene therapy segment. In 2020, in the first three quarters, gene therapies attracted financing of over USD 12 billion globally, with around 370 clinical trials underway. Additionally, in mid-2022, approximately 2,000 gene therapies were in development, targeting several therapeutic areas, such as neurological, cancer, cardiovascular, blood, and infectious diseases.

The cell therapy segment is expected to show lucrative growth over the forecast period. The field of cellular therapeutics is constantly advancing with inclusion of new cell types, which, in turn, provides ample opportunities for companies to enhance their market positions. Furthermore, the market is attracting new entrants due to high unmet demand for cell therapy manufacturing, the recent approval of advanced therapies, and proven effectiveness of these products.

Indication Insights

The oncology segment accounted for the largest revenue share in 2023. The segments dominance is attributed to disease burden, strategic initiatives undertaken by key players, and availability of advanced therapies used for treating various cancer indications. In January 2021, around 18,000 to 19,000 patients and 124,000 patients were estimated to be potential patients for treating cancer using cell & gene therapy products Kymriah (Novartis AG) and Yescarta (Gilead Sciences, Inc.), respectively. Furthermore, a publication on PubMed reports that as of the conclusion of the first quarter of 2023, there have been over 100 distinct gene, cell, and RNA therapies approved globally, along with an additional 3,700-plus in various stages of clinical and preclinical development.

The cardiology segment is estimated to register the fastest CAGR over the forecast period. This is attributed to the increasing prevalence of cardiovascular diseases and research collaboration for development of advanced therapies. For instance, in October 2023, Cleveland Clinic administered a novel gene therapy to the first patient globally as part of a clinical trial, aiming to deliver a functional gene to combat the primary cause of hypertrophic cardiomyopathy (HCM). Similarly, in February 2021, Trizell GmbH entered into partnership with Catalent, Inc. for development of phase 1 cell therapy to treat micro- and macroangiopathy. Trizell's medication is an Advanced Therapy Medicinal Product (ATMP) that employs regulatory macrophagesa platform technology developed in Germany.

Phase Insights

The phase I segment dominated the market in 2023 due to growing R&D activities and increasing number of human trials for advanced therapies. Phase 1 helps ensure the safety levels of a drug at different doses and dosage forms administered to a small number of patients. This phase is mainly conducted to determine the highest dose a patient can take without any adverse effects. Around 70% of drugs in phase 1 move to the next phase.

The phase II segment has been anticipated to show lucrative growth over the forecast period. Phase II clinical studies comprise the largest number of developing ATMPs, due to the high clearance rate of phase I clinical studies. According to data published by Alliance for Regenerative Medicine, as of June 2022, more than 2,093 clinical trials are ongoing globally, out of which 1,117 are under phase II clinical trials accounting for 53%. Thus, the increase in number of products in phase II is driving the segment.

Regional Insights

North America dominated the overall market share of 49.11% in 2023. This can be attributed to increasing outsourcing activities and rising awareness about advanced therapy. North America has consistently been a leader in R&D for advanced treatments, and it is anticipated that it will keep this position during the forecast period. Recent approvals of products such as Kymriah and Yescarta have propelled investments in the regional market. Moreover, in March 2021, the U.S. FDA approved Abecma, the first approval of CAR-T cells to fight against cancer. Similarly, in December 2023, Casgevy and Lyfgenia, the initial cell-based gene therapies for sickle cell disease (SCD) in patients aged 12 and above, received approval from the U.S. Food and Drug Administration, marking a significant milestone.

The U.S. accounted for the largest share of the global market in the North America region in 2023. The U.S. maintains dominance in this sector due to the presence of a robust and highly advanced biopharmaceutical industry with a considerable focus on research and development. Additionally, the continuous presence of numerous pharmaceutical and biotechnology companies, along with academic and research institutions, generates a sustained demand for rigorous safety testing, further reinforcing the country's leadership in the field.

The Asia Pacific region is expected to grow at the fastest CAGR over the forecast period due to the increasing demand for novel ATMPs and rising R&D activities to develop novel therapies. Moreover, the market growth is driven by continuously expanding CDMO Cell Therapy in the country, a number of domestic players have collaborated with biotech companies from other countries involved in mesenchymal stem cell research and therapy development. In addition, in September 2022 Takara Bio, Inc. launched CDMO Cell Therapy for gene therapy products using siTCR technology for its genetically modified T-cell therapy products.

China accounted for the largest share of the global market in the Asia Pacific region in 2023 due to its strategic focus on advancing research and development capabilities, particularly in the pharmaceutical and biotechnology sectors. Additionally, with a rapidly growing biopharmaceutical industry and supportive government initiatives, China has become a key market for advanced therapy medicinal products (CDMO) market.

Recent Developments

Key Companies & Market Share Insights

Some of the key players operating in the market include AGC Biologics,WuXi Advanced Therapies and Celonic

Minaris Regenerative Medicine and BlueReg are some of the emerging market players in the global market.

Key Advanced Therapy Medicinal Products CDMO Companies:

Segments Covered in the Report

This report forecasts revenue growth at country levels and provides an analysis of the latest industry trends in each of the sub-segments from 2021 to 2033. For this study, Nova one advisor, Inc. has segmented the Advanced Therapy Medicinal Products CDMO market.

By Product

By Phase

By Indication

By Region

Immediate Delivery Available | Buy This Premium Research: https://www.novaoneadvisor.com/report/checkout/8439

You can place an order or ask any questions, please feel free to sales@novaoneadvisor.com| USA - +1 9197 992 333

About US

Nova One Advisor is a worldwide market research and consulting organization. We give unmatched nature of offering to our customers present all around the globe across industry verticals. Nova One Advisor has expertise in giving deep-dive market insight along with market intelligence to our customers spread crosswise over various undertakings.

Read more from the original source:
Advanced Therapy Medicinal Products CDMO Industry is Rising Rapidly - BioSpace

Recommendation and review posted by Bethany Smith

Raiden Pham

Parents of children with rare diseases go to endless lengths to raise funds and awareness for research that might lead to a cure. Now, the story of 4-year-old Raiden Pham has been to the moon. He has an ultra-rare neurodegenerative disease known as UBA5 disorder that UMass Chan Medical School researchers are targeting.

The story of Raidens journey and its message of love, hope and strength is included on an indestructible digital time capsule of art, music, film and history, as part of the Lunaprise Moon Museum Mission, which was onboard the Odysseus spacecraft that landed on the moon Feb. 22.

When we think about gene therapy, or any kind of cure or treatment for these rare diseases, its always considered a moonshot, but thats not the case anymore in todays world, said Tommy Pham, Raidens father. Were willing to do whatever it takes to save my son and kids with UBA5 disorder and hopefully inspire the next generation of rare disease parents to go on this fight and have hope.

Since 2021, the Raiden Science Foundation, founded by Tommy and Linda Pham, of Beaverton, Oregon, on behalf of their son, has raised around $1 million of its $4 million goal, which supports research in UMass Chans Translational Institute for Molecular Therapeutics and other partner institutions.

The research on UBA5 is led by Toloo Taghian, PhD, instructor in radiology in the lab of Heather Gray-Edwards, DVM, PhD, assistant professor of radiology in the Horae Gene Therapy Center.

Dr. Taghian has identified the top two viral vector constructs for UBA5 expression in-vivo, which show great promise in successfully delivering UBA5 gene therapy to the targeted cells. Taghian and her team are now testing their efficacy in correcting the protein malfunction and treating the underlying cause of this disease and will soon initiate toxicology studies to assess their safety.

Working with Raiden Science Foundation to develop a gene therapy for UBA5 has been an impactful journey, said Taghian. The dedication of the Pham family in supporting UBA5 research allows the UMass Chan team to work toward unpacking the basic science underlying this ultra-rare disease in parallel with our gene therapy development program.

How Raidens story got to the moon was a journey of persistent efforts to raise awareness and support by the Phams. In October 2022, Raiden Science Foundation held a gaming charity stream, Kombat4Rare, based on the Mortal Kombat franchise. One of the main characters in Mortal Kombat is Raiden, named after the God of Thunder in Japanese mythology.

The response from the gaming and entertainment community was enthusiastic, and a few months later Tommy Pham was invited to be featured at a charity event in Marina del Rey, California. Dallas Santana, founder of Space Blue, the exclusive curator of the Lunaprise Museum, was touched by Tommys message and told him Raidens story should be included on the Lunaprise Moon Museum to inspire people on Earth.

Noting that it has been more than 50 years since the last American space capsule landed on the moon, Tommy said, We dont have to wait another 50 years for gene therapy. It could be done now in the coming years. We need to figure out a way with all the right stakeholders to unlock gene therapy for so many other kids suffering different rare diseases, not just us.

Donations to support UBA5 gene therapy at UMass Chan can be made here.

Go here to see the original:
Story of boy with ultra-rare UBA5 disorder being studied at UMass Chan goes to the moon - UMass Medical School

Recommendation and review posted by Bethany Smith

The Care Quality Commission (CQC) has registered Gender Plus Hormone Clinic to provide hormone treatments to 16 and 17-year-old children.

This paves the way for other private clinics to be registered, which would offer controversial medical treatments with lifelong consequences to vulnerable teenagers. The decision of the CQC to license a private clinic, creates a significant risk of a two tier approach, with less protection for those who seek help from the private sector. This further risks undermining the work of the Cass review for NHSE practice.

I want the court to set aside the registration by the CQC of Gender Plus Hormone Clinic to provide hormone treatment for teenagers. I also hope that this litigation will prevent the registration of other private clinics providing this controversial treatment. I want to ensure that those under 18 years old, do not suffer irreversible, lifelong harms both physical and psychological, from taking a controversial hormonal treatment which is not evidenced as safe or effective.

Why I am asking for this Judicial Review

I was in the NHS for nearly 40 years and I am now a psychotherapist in private practice. I have worked with people who present with issues around their gender identity for over 20 years. In my clinical experience of working with children and young people, I have not, to date, encountered a 16 to 17-year-old who I would have assessed to be sufficiently fully informed and psychologically ready to make such a life changing, potentially harmful decision. They are in the process of development from child to adult which involves significant mental and physical adjustments. Many of the young people with gender dysphoria/incongruence have no clear understanding of their underlying motivations to take cross, sex, hormones. However they are usually very aware of the discomfort they experience, and often hold a strong belief that the medication will help them feel better. They hope a change to their physical body will bring about a comfort in their mind. Some also receive strong messages from certain groups that medication is the answer to their difficulties which creates an urgent pressure on them and those around them for a solution. As a result, they are rarely able to give a full, in-depth psychological consideration to the implications and consequences of commencing a physical treatment, which is known to have serious, harmful side-effects, and, as yet has a very low level evidence base for it's efficacy and safety.

Under its current registration by the CQC, Gender Plus Hormone Clinic (GHPC) is not prevented from providing GnRH analogues (blockers) for the purpose of suspending puberty. There are some 16-year-olds who have not reached pubertal maturation. Further, the GPHC has said that it would prescribe puberty blockers alongside oestrogen therapy to achieve feminising effects. The NICE report (National Institute of Clinical Excellence) and the Cass review both state that this treatment model is not proven.

There is also considerable risk of complications due to this powerful medication. There are many known side-effects, including blood clots, gallstones, vaginal atrophy and male pattern baldness for females and potential loss of fertility, amongst many others.

The evidence base

The Cass review was commissioned by the NHS to provide a comprehensive review of the appropriate treatment for children and young people with gender dysphoria. The Cass Review sought advice from the National Institute for Health and Care Excellence (NICE) which conducted two separate evidence reviews.

Neither of them has found sufficient evidence to support the use of either puberty blockers or cross sex hormones as safe and effective.

In her interim report published in February 2022, Dr Cass has emphasised the gaps in the "evidence base regarding hormone treatment" (Para 1.41). Although some of her observations related specifically to puberty blockers, she also addressed cross-sex, hormones, and hormone treatment more generally. She said, among other things:

"The Review is not able to provide definitive advice on the use of puberty blockers and feminising/masculinising hormones at this stage, due to gaps in the evidence base; however, recommendations will be developed as our research programme progresses.

The lack of available high-level evidence was reflected in the recent NICE review into the use of puberty blockers and feminising/masculinising hormones commissioned by NHS England, with the evidence being too inconclusive to form the basis of a policy position(para 5.21)

At present we have the least information for the largest group of patients birth- registered females first presenting in early teens(para 5.11).

Your help:

I need your help to ensure that the registration of GPHC is cancelled and the other private clinics are unable to prescribe this controversial treatment to children under 18. We should not be careless or look away from the potential harms this medical treatment might cause to childrens previously healthy bodies.

Please support me with the legal fees required to mount a judicial review and challenge the CQC decision. I was the original claimant who started the Kiera Bell JR with Mrs A and our application on that occasion was successful in providing further scrutiny and attention in this area of paediatric healthcare. That judicial review potentially helped prevent irreversible harms to much younger children too as it led to a much wider scrutiny of the model of treatment in the GIDS.

I have assembled an expert legal team and will be lodging my claim with the High Court in the next few days. Please join me in seeking to protect vulnerable young people and share this crowdfunder link. I know these cases keep coming but we need to protect the next generation.

My X (twitter) handle is @sueevansprotect

Thank you very much.

The rest is here:
PROTECT TEENAGERS FROM HARMFUL AND IRREVERSIBLE MEDICAL TREATMENT - CrowdJustice

Recommendation and review posted by Bethany Smith

The cryonics industry and those who support cryonics refer to those who undergo the procedure after death as "cryonauts." ValentynVolkov /iStockPhoto

To some, its the possibility of another life for themselves or a loved one. To others, its science fiction.

Whatever it is, cryonicsdefined by the Alcor Life Extension Foundation as the science of using ultra-cold temperatures to preserve human life with the intent of restoring good health when technology becomes available to do so has now been around for 60 years, since the death of retired psychology professor James H. Bedford. Alcor, the company that still has his body in a frozen chamber, calls him the first cryonaut. (Cryonics is sometimes incorrectly referred to as cryogenics.)

Bedford was frozen long before Alcor was formed in 1976, but today thats where he rests with 148 others, in the Patient Care Bay in Scottsdale, Arizona. After his death, aged 73, of kidney cancer, his body was put on ice, The New York Times Magazine wrote in 1997. Then his body was processed by experts from the Cryonics Society of California, the Times wrote.

Sam Shaw of This American Life got a little more detail on what happened when the first cryonaut was frozen. He interviewed Bob Nelson, a TV repairman who became president of the society, a nonprofit consisting mostly of people who wanted to be cryonically preserved. What he discovered: like Nelson, most of the societys members were amateurs, and the scientists they had persuaded to work on the theoretical question of cryonics were skeptical. They wanted to take things slow, conduct research, publish papers, Shaw says. Then James Beford asked to be frozen, and they decided to go for it in spite of the fact that theyd lose the scientific communitys support.

When Dr. Bedford died on January 12, 1967, they were all caught off guard. Dr. Bedfords nurse had to run up and down the block collecting ice from the home freezers of neighbours. Cryonics was still just a theory, and the proceedings had the slightly manic quality of a local theater production, forced to open a couple of weeks early.

Bedford has been frozen ever since, although both his container and the place where he rests have changed. After his body was preserved, Alcor writes, he was handed over to family. His very devoted son stored him at a succession of locations over some two decades before transferring both his care and custody to Alcor, the foundation writes. According to the Times, his body was kept at a warehouse in Anaheim, a cryonics facility in Emeryville, somewhere else undisclosed and Fullerton before coming to Alcor. The reason for so many moves: fifty years ago, there was no cryonics industry and it was a fringe idea at best.

Around Bedfords body, the landscape of cryonics has also transformed dramatically, but despite Alcors strict protocols, theres no proof that its method of cryopreservation is actually working, writes George Dvorsky for Gizmodo. For all we know, every single person at the facility is a goner. Cryonics is still only the hope of a future for those preserved, even, as Dvorsky writes, when theyre terminally ill children.

If Bedford is ever re-animated, he will be in some strange company, writes Stacy Conradt for Mental Floss: mathematician Thomas K. Donaldson, a man who changed his name to FM-2030, Alcor vice president Jerry Leaf and both baseball player Ted Williams and his son John-Henry Williams are on ice at Alcor.

Get the latest stories in your inbox every weekday.

Excerpt from:
The First Cryonic Preservation Took Place Fifty Years Ago Today

Recommendation and review posted by Bethany Smith

Vitamin A could have a key role in both stem cell biology and wound healing: Study  Medical Dialogues

More here:
Vitamin A could have a key role in both stem cell biology and wound healing: Study - Medical Dialogues

Recommendation and review posted by Bethany Smith

This Swedish startup wants to reduce the cost, and controversy, around stem cell production  TechCrunch

See the original post:
This Swedish startup wants to reduce the cost, and controversy, around stem cell production - TechCrunch

Recommendation and review posted by Bethany Smith

Abstract

Genome editing is the modification of genomic DNA at a specific target site in a wide variety of cell types and organisms, including insertion, deletion and replacement of DNA, resulting in inactivation of target genes, acquisition of novel genetic traits and correction of pathogenic gene mutations. Due to the advantages of simple design, low cost, high efficiency, good repeatability and short-cycle, CRISPR-Cas systems have become the most widely used genome editing technology in molecular biology laboratories all around the world. In this review, an overview of the CRISPR-Cas systems will be introduced, including the innovations, the applications in human disease research and gene therapy, as well as the challenges and opportunities that will be faced in the practical application of CRISPR-Cas systems.

Keywords: CRISPR, Cas9, Genome editing, Human disease models, Rabbit, Gene therapy, Off target effects

Genome editing is the modification of genomic DNA at a specific target site in a wide variety of cell types and organisms, including insertion, deletion and replacement of DNA, resulting in inactivation of target genes, acquisition of novel genetic traits and correction of pathogenic gene mutations [1], [2], [3]. In recent years, with the rapid development of life sciences, genome editing technology has become the most efficient method to study gene function, explore the pathogenesis of hereditary diseases, develop novel targets for gene therapy, breed crop varieties, and so on [4], [5], [6], [7].

At present, there are three mainstream genome editing tools in the world, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and the RNA-guided CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) nucleases systems [8], [9], [10]. Due to the advantages of simple design, low cost, high efficiency, good repeatability and short-cycle, CRISPR-Cas systems have become the most widely used genome editing technology in molecular biology laboratories all around the world [11], [12]. In this review, an overview of the CRISPR-Cas systems will be introduced, including the innovations and applications in human disease research and gene therapy, as well as the challenges and opportunities that will be faced in the practical application of CRISPR-Cas systems.

CRISPR-Cas is an adaptive immune system existing in most bacteria and archaea, preventing them from being infected by phages, viruses and other foreign genetic elements [13], [14]. It is composed of CRISPR repeat-spacer arrays, which can be further transcribed into CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA), and a set of CRISPR-associated (cas) genes which encode Cas proteins with endonuclease activity [15]. When the prokaryotes are invaded by foreign genetic elements, the foreign DNA can be cut into short fragments by Cas proteins, then the DNA fragments will be integrated into the CRISPR array as new spacers [16]. Once the same invader invades again, crRNA will quickly recognize and pair with the foreign DNA, which guides Cas protein to cleave target sequences of foreign DNA, thereby protecting the host [16].

CRISPR-Cas systems can be classified into 2 classes (Class 1 and Class 2), 6 types (I to VI) and several subtypes, with multi-Cas protein effector complexes in Class 1 systems (Type I, III, and IV) and a single effector protein in Class 2 systems (Type II, V, and VI) [17], [18]. The classification, representative members, and typical characteristics of each CRISPR-Cas system are summarized in [10], [12], [15], [16], [17], [18].

Summary of CRISPR-Cas systems.

Type II CRISPR-Cas9 system derived from Streptococcus pyogenes (SpCas9) is one of the best characterized and most commonly used category in numerous CRISPR-Cas systems [18], [19]. The main components of CRISPR-Cas9 system are RNA-guided Cas9 endonuclease and a single-guide RNA (sgRNA) [20]. The Cas9 protein possesses two nuclease domains, named HNH and RuvC, and each cleaves one strand of the target double-stranded DNA [21]. A single-guide RNA (sgRNA) is a simplified combination of crRNA and tracrRNA [22]. The Cas9 nuclease and sgRNA form a Cas9 ribonucleoprotein (RNP), which can bind and cleave the specific DNA target [23]. Furthermore, a protospacer adjacent motif (PAM) sequence is required for Cas9 proteins binding to the target DNA [20].

During genome editing process, sgRNA recruits Cas9 endonuclease to a specific site in the genome to generate a double-stranded break (DSB), which can be repaired by two endogenous self-repair mechanisms, the error-prone non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway [24]. Under most conditions, NHEJ is more efficient than HDR, for it is active in about 90% of the cell cycle and not dependent on nearby homology donor [25]. NHEJ can introduce random insertions or deletions (indels) into the cleavage sites, leading to the generation of frameshift mutations or premature stop codons within the open reading frame (ORF) of the target genes, finally inactivating the target genes [26], [27]. Alternatively, HDR can introduce precise genomic modifications at the target site by using a homologous DNA repair template [28], [29] (). Furthermore, large fragment deletions and simultaneous knockout of multiple genes could be achieved by using multiple sgRNAs targeting one single gene or more [30], [31].

Mechanism of genome editing. Double-strand break (DSB) induced by nucleases can be repaired by non-homologous end joining (NHEJ) or homology-directed repair (HDR) pathways. NHEJ can introduce random insertions or deletions (indels) of varying length at the site of the DSB. Alternatively, HDR can introduce precise genomic modifications at the target site by using a homologous DNA donor template.

CRISPR-Cas systems have become the most favorite genome editing tool in the molecular biology laboratory since they were confirmed to have genome editing capabilities in 2012 [23]. They have made numerous achievements in the field of correcting pathogenic mutations, searching for essential genes for cancer immunotherapy, and solving key problems in organ xenotransplantation [5], [32], [33]. Unfortunately, there are still some limitations which need to solve in CRISPR-Cas systems, such as potential off-target effects, limited genome-targeting scope restricted by PAM sequences, and low efficiency and specificity [34], [35]. Therefore, many research teams have been trying to improve this tool.

By introducing two point mutations, H840A and D10A, into HNH and RuvC nuclease domain, researchers have obtained a nuclease dead Cas9 (dCas9) [36]. The dCas9 lacks DNA cleavage activity, but DNA binding activity is not affected. Then, by fusing transcriptional activators or repressors to dCas9, the CRISPR-dCas9 system can be used to activate (CRISPRa) or inhibit (CRISPRi) transcription of target genes [37], [38]. Additionally, dCas9 can be fused to various effector domains, which enables sequence-specific recruitment of fluorescent proteins for genome imaging and epigenetic modifiers for epigenetic modification [39], [40]. Furthermore, this system is easy to operate and allows simultaneous manipulation of multiple genes within a cell [38].

In order to improve the efficiency of site-directed mutagenesis, base editing systems containing dCas9 coupled with cytosine deaminase (cytidine base editor, CBE) or adenosine deaminase (adenine base editor, ABE) have been developed [41], [42]. It can introduce CG to TA or AT to GC point mutations into the editing window of the sgRNA target sites without double-stranded DNA cleavage [41], [42]. Since base editing systems avoid the generation of random insertions or deletions to a great extent, the results of gene mutation are more predictive. However, owing to the restriction of base editing window, base editing systems are not suitable for any target sequence in the genome. Accordingly, C-rich sequences, for example, would produce a lot of off-target mutations [43]. Therefore, researchers have always been trying to develop and optimize novel base editing systems to overcome this drawback [44]. At present, base editing systems have been widely used in various cell lines, human embryos, bacteria, plants and animals for efficient site-directed mutagenesis, which may have broad application prospects in basic research, biotechnology and gene therapy [45], [46], [47]. In theory, 3956 gene variants existing in Clin var database could be repaired by base substitution of C-T or G-A [42], [48].

An NGG PAM at the 3 end of the target DNA site is essential for the recognization and cleavage of the target gene by Cas9 protein [20]. Besides classical NGG PAM sites, other PAM sites such as NGA and NAG also exist, but their efficiency of genome editing is not high [49]. However, such PAM sites only exist in about one-sixteenth of the human genome, thereby largely restricting the targetable genomic loci. For this purpose, several Cas9 variants have been developed to expand PAM compatibility.

In 2018, David Liu et al.[50] developed xCas9 by phage-assisted continuous evolution (PACE), which can recognize multiple PAMs (NG, GAA, GAT, etc.). In the latter half of the same year, Nishimasu et al. developed SpCas9-NG, which can recognize relaxed NG PAMs [51]. In 2020, Miller et al. developed three new SpCas9 variants recognizing non-G PAMs, such as NRRH, NRCH and NRTH PAMs [52]. Later in the same year, Walton et al. developed a SpCas9 variant named SpG, which is capable of targeting an expanded set of NGN PAMs [53]. Subsequently, they optimized the SpG system and developed a near-PAMless variant named SpRY, which is capable of editing nearly all PAMs (NRN and NYN PAMs) [53].

By using these Cas9 variants, researchers have repaired some previously inaccessible disease-relevant genetic variants [51], [52], [53]. However, there are still some drawbacks in these variants, such as low efficiency and cleavage activity [50], [51]. Therefore, they should be further improved by molecular engineering in order to expand the applications of SpCas9 in disease-relevant genome editing.

In addition to editing DNA, CRISPR-Cas systems can also edit RNA. Class 2 Type VI CRISPR-Cas13 systems contain a single RNA-guided Cas13 protein with ribonuclease activity, which can bind to target single-stranded RNA (ssRNA) and specifically cleave the target [54]. To date, four Cas13 proteins have been identified: Cas13a (also known as C2c2), Cas13b, Cas13c and Cas13d [55]. They have successfully been applied in RNA knockdown, transcript labeling, splicing regulation and virus detection [56], [57], [58]. Later, Feng Zhang et al. developed two RNA base edting systems (REPAIR system, enables A-to-I (G) replacement; RESCUE system, enables C-to-U replacement) by fusing catalytically inactivated Cas13 (dCas13) with the adenine/cytidine deaminase domain of ADAR2 (adenosine deaminase acting on RNA type 2) [59], [60].

Compared with DNA editing, RNA editing has the advantages of high efficiency and high specificity. Furthermore, it can make temporary, reversible genetic edits to the genome, avoiding the potential risks and ethical issues caused by permanent genome editing [61], [62]. At present, RNA editing has been widely used for pre-clinical studies of various diseases, which opens a new era for RNA level research, diagnosis and treatment.

Recently, Anzalone et al. developed a novel genome editing technology, named prime editing, which can mediate targeted insertions, deletions and all 12 types of base substitutions without double-strand breaks or donor DNA templates [63]. This system contains a catalytically impaired Cas9 fused to a reverse transcriptase and a prime editing guide RNA (pegRNA) with functions of specifying the target site and encoding the desired edit [63]. After Cas9 cleaves the target site, the reverse transcriptase uses pegRNA as a template for reverse transcription, and then, new genetic information can be written into the target site [63]. Prime editing can effectively improve the efficiency and accuracy of genome editing, and significantly expand the scope of genome editing in biological and therapeutic research. In theory, it is possible to correct up to 89% known disease-causing gene mutations [63]. Nevertheless, as a novel genome editing technique, more research is still needed to further understand and improve prime editing system.

So far, as a rapid and efficient genome editing tool, CRISPR-Cas systems have been extensively used in a variety of species, including bacteria, yeast, tobacco, Arabidopsis, sorghum, rice, Caenorhabditis elegans, Drosophila, zebrafish, Xenopus laevis, mouse, rat, rabbit, dog, sheep, pig and monkey [64], [65], [66], [67], [68], [69], [70], [71], [72], [73], [74], [75], [76], [77], [78], as well as various human cell lines, such as tumor cells, adult cells and stem cells [79], [80]. In medical field, the most important application of CRISPR-Cas systems is to establish genetically modified animal and cell models of many human diseases, including gene knockout models, exogenous gene knock-in models, and site directed mutagenesis models [80], [81].

(1)

Establishing animal models of human diseases

Animal models are crucial tools for understanding gene function, exploring pathogenesis of human diseases and developing new drugs. However, traditional methods for generating animal models are complex, costly and time-consuming, which severely limit the application of animal models in basic medical research and preclinical studies [82]. Since the discovery of CRISPR-Cas systems, a series of genetically modified animal models have successfully been generated in a highly efficient manner [72], [73], [74], [75], [76], [77], [78].

Among numerous model animals, mice are widely used for scientific studies and recognized as the most important model animals in human disease research [83]. So far, researchers have successfully generated many genetically modified mouse models, such as cancer, cardiovascular disease, cardiomyopathy, Huntington's disease, albino, deafness, hemophilia B, obesity, urea cycle disorder and muscular dystrophy [84], [85], [86], [87], [88], [89], [90], [91], [92], [93]. Nevertheless, owing to the great species differences between humans and rodents, they cant provide effective assessment and long-term follow-up for research and treatment of human diseases [94]. Therefore, the application of larger model animals, such as rabbits, pigs and non-human primates, is becoming more and more widespread [74], [77], [78]. With the development of CRISPR-Cas systems, generating larger animal models for human diseases has become a reality, which greatly enriches the disease model resource bank.

Our research focuses on the generation of genetically modified rabbit models using CRISPR-Cas systems. Compared with mice, rabbits are closer to humans in physiology, anatomy and evolution [95]. In addition, rabbits have a short gestation period and less breeding cost. All these make them suitable for studies of the cardiovascular, pulmonary and metabolism diseases [95], [96]. Nowadays, we have generated a series of rabbit models for simulating human diseases, including congenital cataracts, duchenne muscular dystrophy (DMD), X-linked hypophosphatemia (XLH), etc (summarized in ) [97], [98], [99], [100], [101], [102], [103], [104], [105], [106], [107], [108], [109], [110], [111], [112], [113], [114]. Take the generation of PAX4 gene knockout rabbits as an example, the procedure we used to establish genetically modified rabbit models is summarized in and .

CRISPR-Cas system mediated rabbit models of human diseases.

Generation of PAX4 gene knockout (KO) rabbits using CRISPR-Cas9 system. (A) Schematic diagram of the sgRNA target sites located in the rabbit PAX4 locus. PAX4 exons are indicated by yellow rectangles; target sites of the two sgRNA sequences, sgRNA1 and sgRNA2, are highlighted in green; protospacer-adjacent motif (PAM) sequence is highlighted in red. Primers F and R are used for mutation detection in pups. (B) Microinjection and embryo transfer. First a mixture of Cas9 mRNA and sgRNA is microinjected into the cytoplasm of the zygote at the pronuclear stage. Then the injected embryos are transferred into the oviduct of recipient rabbits. After 30days gestation, PAX4 KO rabbits are born. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Summary of the PAX4 KO rabbits generated by CRISPR-Cas9 system.

In addition, the pig is an important model animal extensively used in biomedical research. Compared with mice, their body/organ size, lifespan, anatomy, physiology, metabolic profile and immune characteristics are more similar to those of humans, which makes the pig an ideal model for studying human cardiovascular diseases and xenotransplantation [115]. At present, several genetically modified pig models have been successfully generated, including neurodegenerative diseases, cardiovascular diseases, cancer, immunodeficiency and xenotransplantation model [116], [117], [118], [119], [120], [121], [122].

To date, non-human primates are recognized as the best human disease models. Their advantage is that their genome has 98% homology with the human genome; also, they are highly similar to humans in tissue structure, immunity, physiology and metabolism [123]. Whats more, they can be infected by human specific viruses, which makes them very important models in infectious disease research [124]. Nowadays, researchers have generated many genetically modified monkey models, such as cancer, muscular dystrophy, developmental retardation, adrenal hypoplasia congenita and Oct4-hrGFP knockin monkeys [125], [126], [127], [128], [129].

(2)

Establishing cell models of human diseases

It was found that the efficiency of CRISPR-Cas mediated genome editing is higher in vitro than in vivo, thus the use of genetically modified cell models can greatly shorten the research time in medical research [130]. Until now, researchers have used CRISPR-Cas systems to perform genetic manipulations on various cell lines, such as tumor cells, adult cells and stem cells, in order to simulate a variety of human diseases [79], [80].

Fuchs et al. generated the RPS25-deficient Hela cell line by knocking out ribosomal protein eS25 (RPS25) gene using CRISPR-Cas9 system [131]. Drost et al. edited four common colorectal cancer-related genes (APC, P53, KRAS and SMAD4) in human intestinal stem cells (hISCs) by CRISPR-Cas9 technology [132]. The genetically modified hISCs with 4 gene mutations possessed the biological characteristics of intestinal tumors and could simulate the occurrence of human colorectal cancer [132]. Jiang et al. induced site-specific chromosome translocation in mouse embryonic stem cells by CRISPR-Cas9, in order to establish a cell and animal model for subsequent research on congenital genetic diseases, infertility, and cancer related to chromosomal translocation [133].

In addition, induced pluripotent stem cells (iPSCs) have shown great application prospect in disease model establishment, drug discovery and patient-specific cellular therapy development [134]. iPSCs have the ability of self-renewal and multiple differentiation potential, which are of great significance in disease model establishment and regenerative medicine research [135]. In recent years, by combining CRISPR-Cas systems with iPSC technology, researchers have generated numerous novel and reliable disease models with isogenic backgrounds and provided new solutions for cell replacement therapy and precise therapy in a variety of human diseases, including neurodegenerative diseases, acquired immunodeficiency syndrome (AIDS), -thalassemia, etc [134], [135], [136].

With the development of CRISPR-Cas systems and the discovery of novel Cas enzymes (Cas12, Cas13, etc.), CRISPR-based molecular diagnostic technology is rapidly developing and has been selected as one of the world's top ten science and technology advancements in 2018 [137].

Unlike Cas9, Cas13 enzymes possess a collateral cleavage activity, which can induce cleavage of nearby non-target RNAs after cleavage of target sequence [54]. Based on the collateral cleavage activity of Cas13, Feng Zhang et al.[138] developed a Cas13a-based in vitro nucleic acid detection platform, named SHERLOCK (Specific High Sensitivity Enzymatic Reporter UnLOCKing). It is composed of Cas13a, sgRNA targeting specific RNA sequences and fluorescent RNA reporters. After Cas13a protein recognizes and cleaves the target RNA, it will cut the report RNA and release the detectable fluorescence signal, so as to achieve the purpose of diagnosis [138]. Researchers have used this method to detect viruses, distinguish pathogenic bacteria, genotype human DNA and identify tumor DNA mutations [137], [138]. Later, Feng Zhang et al. improved SHERLOCK system and renamed it as SHERLOCKv2, which can detect four virus at the same time [139].

In addition to Cas13, Cas12 enzymes are also found to possess collateral cleavage activity [140]. Doudna et al.[141] developed a nucleic acid detection system based on Cas12a (also known as Cpf1), named DETECTR (DNA endonuclease-targeted CRISPR trans reporter). DETECTR has been used to detect cervical cancer associated HPV subtypes (HPV16 and HPV18) in either virus-infected human cell lines or clinical patient samples [141]. Furthermore, Doudna et al. are trying to use the newly discovered Cas14 and CasX proteins in molecular diagnosis, which may further enrich the relevant techniques of CRISPR-based molecular diagnosis [142], [143].

CRISPR-based molecular diagnostic technology has incomparable advantages over traditional molecular diagnostic methods, such as high sensitivity and single-base specificity, which is suitable for early screening of cancer, detection of cancer susceptibility genes and pathogenic genes [137], [144]. Meanwhile, CRISPR diagnostics is inexpensive, simple, fast, without special instrument, and is suitable for field quick detection and detection in less-developed areas [137], [144]. At present, many companies are trying to develop CRISPR diagnostic kits for family use, to detect HIV, rabies, Toxoplasma gondi, etc.

CRISPR-Cas9 system enables genome-wide high-throughput screening, making it a powerful tool for functional genomic screening [145]. The high efficiency of genome editing with CRISPR-Cas9 system makes it possible to edit multiple targets in parallel, thus a mixed cell population with gene mutation can be produced, and the relationship between genotypes and phenotypes could be confirmed by these mutant cells [146]. CRISPR-Cas9 library screening can be divided into two categories: positive selection and negative selection [147]. It has been utilized to identify genes associated with cancer cell survival, drug resistance and virus infection in various models [148], [149], [150]. Compared with RNAi-based screening, high-throughput CRISPR-Cas9 library screening has the advantages of higher transfection efficiency, minimal off-target effects and higher data reproducibility [151]. At present, scientists have constructed human and mouse genome-wide sgRNA libraries, and they have been increasingly improved according to different requirements [152], [153]. In the future, CRISPR-Cas9-based high-throughput screening technology will definitely get unprecedented development and application.

Gene therapy refers to the introduction of foreign genes into target cells to treat specific diseases caused by mutated or defective genes [154]. Target cells of gene therapy are mainly divided into two categories: somatic cells and germ line cells. However, since germ line gene therapy is complicated in technique as well as involves ethical and security issues, today gene therapy is limited to somatic cell gene therapy [155]. Traditional gene therapy is usually carried out by homologous recombination or lentiviral delivery. Nevertheless, the efficiency of homologous recombination is low, and lentiviral vectors are randomly inserted into the recipient genome, which may bring potential security risks to clinical applications [156]. Currently, with the rapid development of CRISPR-Cas systems, they have been widely applied in gene therapy for treating various of human diseases, monogenic diseases, infectious diseases, cancer, etc [155], [156], [157]. Furthermore, some CRISPR-mediated genome-editing therapies have already reached the stage of clinical testing. briefly summarizes the ongoing clinical trials of gene therapy using genome-editing technology, including ZFN, TALEN and CRISPR-Cas systems.

(1)

Monogenic diseases

Monogenic diseases refer to the genetic diseases caused by mutations of a single allele or a pair of alleles on a pair of homologous chromosomes [158]. There are more than 6600 known monogenic diseases around the world, -thalassaemia, sickle cell disease (SCD), hemophilia B (HB), retinitis pigmentosa (RP), leber congenital amaurosis type 10 (LCA10), duchenne muscular dystrophy (DMD), hutchinson-gilford progeria syndrome (HGPS), hereditary tyrosinemia (HT), cystic fibrosis (CF), etc [159]. Most of the monogenic diseases are rare diseases lacking of effective treatment, which will greatly affect the life quality of patients. Nowadays, many animal models of monogenic diseases have been treated with CRISPR-mediated gene therapy. Furthermore, even some CRISPR clinical trials for monogenic diseases are going on [160].

Summary of clinical trials of gene therapy using genome-editing technology.

-Thalassaemia, a hereditary hemolytic anemia disease, is one of the most common and health-threatening monogenic diseases in the world. It is characterized by mutations in the -globin (HBB) gene, leading to severe anemia caused by decreased hemoglobin (Hb) level [161]. For the moment, the only way to cure -thalassemia is hematopoietic stem cell transplantation (HSCT). Yet, high cost of treatment and shortage of donors limit its clinical application [162]. Other therapy, for example, blood transfusion, can only sustain the life of patients but cant cure the disease [161]. To better treat -thalassemia, researchers have turned their attention to gene therapy. A major technical idea is to repair the defective -globin gene of iPSCs from patients with -thalassemia by CRISPR-Cas9 technology, then red blood cells can be produced normally and the disease could be cured [163], [164]. Besides, reactivating fetal hemoglobin (HbF) expression has also been proposed to be an effective method to treat -thalassemia through knockout of BCL11A gene, which suppresses the expression of fetal hemoglobin [165], [166].

Additionally, CRISPR-Cas systems have also been used for the treatment of other hematologic diseases, such as sickle cell disease (SCD) and hemophilia B (HB). SCD is a monogenic disease caused by a single-nucleotide mutation in human -globin gene, leading to a substitution of glutamic acid by valine and the production of an abnormal version of -globin, which is known as hemoglobin S (HbS) [167]. CRISPR-Cas9 system has been used to treat SCD by repairing the -globin gene mutation or reactivating HbF expression [168], [169]. HB is an X-linked hereditary bleeding disorder caused by deficiency of coagulation factor IX, and the most common treatment for hemophilia B is supplement blood coagulation factor [170], [171]. Huai et al. injected naked Cas9-sgRNA plasmid and donor DNA into the adult mice of F9 mutation HB mouse model for gene correction [172]. Meanwhile, Cas9/sgRNA were also microinjected into germline cells of this HB mouse model for gene correction. Both in vivo and ex vivo experiment were sufficient to remit the coagulation deficiency [172]. Guan et al. corrected the F9 Y371D mutation in HB mice using CRISPR-Cas9 mediated in situ genome editing, which greatly improved the hemostatic efficiency and increased the survival of HB mice [173].

Duchenne muscular dystrophy (DMD) is an X-chromosome recessive hereditary disease, with clinical manifestations of muscle weakness or muscle atrophy due to a progressive deterioration of skeletal muscle function [174]. It is usually caused by mutations in the DMD gene, a gene encoding dystrophin protein [174]. Deletions of one or more exons of the DMD gene will result in frameshift mutations or premature termination of translation, thereby normal dystrophin protein can not be synthesized [175]. Currently, there is no effective treatment for DMD. Conventional drug treatment can only control the disease to a certain extent, but can not cure it. It was found that a functional truncated dystrophin protein can be obtained by removing the mutated transcripts with CRISPR-Cas9 system [176], [177], [178]. In addition, base editing systems can also be applied in DMD treatment by repairing single base mutation or inducing exon skipping by introducing premature termination codons (PTCs) [179].

Retinitis pigmentosa (RP) is a group of hereditary retinal degenerative diseases characterized by progressive loss of photoreceptor cells and retinal pigment epithelium (RPE) function [180]. RP has obvious genetic heterogeneity, and the inheritance patterns include autosomal dominant, autosomal recessive, and X-linked recessive inheritance [180]. To date, there is still no cure for RP. In recent years, with the rapid development of gene editing technology, there has been some progress in the treatment of RP. Several gene mutations causing RP have been corrected by CRISPR-Cas9 in mouse models to prevent retinal degeneration and improve visual function, for example, RHO gene, PRPF31 gene and RP1 gene [181], [182].

Leber Congenital Amaurosis type 10 (LCA10) is an autosomal retinal dystrophy with severe vision loss at an early age. The most common gene mutation found in patients with LCA10 is IVS26 mutation in the CEP290 gene, which disrupts the coding sequence by generating an aberrant splice site [183]. Ruan et al. used CRISPR-Cas9 system to knock out the intronic region of the CEP290 gene and restored normal CEP290 expression [184]. In addition, subretinal injection of EDIT-101 in humanized CEP290 mice showed rapid and sustained CEP290 gene editing [185], [186].

Hutchinson-Gilford Progeria Syndrome (HGPS) is a rare lethal genetic disorder with the characteristic of accelerated aging [187]. A point mutation within exon 11 of lamin A gene activates a cryptic splice site, leading to the production of a truncated lamin A called progerin [188]. However, CRISPR-Cas based gene therapy has opened up a broad prospect in HGPS treatment. Administration of AAV-delivered CRISPR-Cas9 components into HGPS mice can reduce the expression of progerin, thereby improved the health condition and prolonged the lifespan of HGPS mice [189], [190]. In addition, Suzuki et al. repaired G609G mutation in a HGPS mouse model via single homology arm donor mediated intron-targeting gene integration (SATI), which ameliorated aging-associated phenotypes and extended the lifespan of HGPS mice [191].

CRISPR-Cas systems have also showed their advantages in gene therapy of hereditary tyrosinemia (HT) and cystic fibrosis (CF). HT is a disorder of tyrosine metabolism caused by deficiency of fuarylacetoacetate hydrolase (Fah) [192]. Yin et al. corrected a Fah mutation in a HT mouse model by injecting CRISPR-Cas9 components into the liver of the mice [193]. Then, the wild-type Fah protein in the liver cells began to express and the body weight loss phenotype was rescued [193]. CF, an autosomal recessive inherited disease with severe respiratory problems and infections, has a high mortality rate at an early age [194]. It is caused by mutations in the CFTR gene, which encodes an epithelial chloride anion channel, the cystic fibrosis transmembrane conductance regulator (CFTR) [194]. Until now, genome editing strategies have been carried out in cell models to correct CFTR mutations. In cultured intestinal stem cells and induced pluripotent stem cells from cystic fbrosis patients, the CFTR homozygous 508 mutation has been corrected by CRISPR-Cas9 technology, leading to recovery of normal CFTR expression and function in differentiated mature airway epithelial cells and intestinal organoids [195], [196].

(2)

Infectious diseases

In recent years, gene therapy has gradually been applied to the treatment of viral infectious diseases. Transforming host cells to avoid viral infection or preventing viral proliferation and transmission are two main strategies for gene therapy of viral infectious diseases [197].

Human immunodeficiency virus (HIV), a kind of retrovirus, mainly attacks the human immune system, especially the CD4 T lymphocytes. When human cells are invaded by HIV, the viral sequences can be integrated into the host genome, blocking cellular and humoral immunity while causing acquired immunodeficiency syndrome (AIDS) [198]. There is still no known cure for AIDS but it could be treated. Although antiretroviral therapy can inhibit HIV-1 replication, the viral sequences still exist in the host genome, and they could be reactivated at any time [199]. CRISPR-Cas9 system can target long terminal repeat (LTR) and destruct HIV-1 proviruses, thus it is possible to completely eliminate HIV-1 from genome of infected host cells [200], [201]. In addition, resistance to HIV-1 infection could be induced by knockout of the HIV co-receptor CCR5 gene in CD4 T cells [202], [203].

Cervical cancer is the second most common gynecologic malignant tumor. The incidence is increasing year by year and young people are especially prone to this disease. It was found that the occurrence of cervical cancer is closely related to HPV (human papillomavirus) infection [204]. HPV is a double-stranded cyclic DNA virus, E6 and E7 genes located in HPV16 early regions are carcinogenic genes [205]. Researchers designed sgRNAs targeting E6 and E7 genes to block the expression of E6 and E7 protein, subsequently the expression of p53 and pRb was restored to normal, finally increasing tumor cells apoptosis and suppressing subcutaneous tumor growth in in vivo experiments [206], [207], [208]. Moreover, HPV virus proliferation was blocked through cutting off E6/E7 genes, and the virus in the bodies could be eliminated [206], [207], [208].

(3)

Cancer

Cancer is the second leading cause of death worldwide after cardiovascular diseases, and it is also a medical problem that needs to be solved urgently. A variety of genetic or epigenetic mutations have been accumulated in the cancer genome, which can activate proto-oncogenes, inactivate tumor suppressors and produce drug resistance [209], [210]. So far, CRISPR-Cas systems have been used to correct the oncogenic genome/epigenome mutations in tumor cells and animal models, resulting in inhibition of tumor cell growth and promotion of cell apoptosis, thereby inhibiting tumor growth [211], [212], [213].

In addition, immunotherapy is considered to be a major breakthrough in cancer treatment, especially chimeric antigen receptor-T (CAR-T) cell therapy, which has a significantly therapeutic effect on leukemia, lymphoma and certain types of solid tumors [214], [215], [216]. CAR-T cells are genetically manipulated, patient-specific T cells, which express receptors targeting antigens specially expressed on tumor cells, for example, CD19 CAR-T cells for B cell malignancies. Then these cells will be transfused back to patients to fight against cancer [217]. However, CAR-T cell therapy is complex, time-consuming and expensive, and it is greatly limited by the quality and quantity of autologous T cells. Therefore, researchers have used CRISPR-Cas9 system to develop universal CAR-T cells, such as simultaneously removing endogenous T cell receptor gene and HLA class I encoding gene on T cells of healthy donors and introducing CAR sequence [218], [219], [220]. Thereby, it could be used in multiple patients without causing graft versus host reaction (GVHR). In addition, CRISPR-Cas mediated genome editing has also been used to enhance the function of CAR-T cells by knocking out genes encoding signaling molecules or T cell inhibitory receptors, such as programmed cell death protein 1 (PD-1) and cytotoxic T lymphocyte antigen 4 (CTLA-4) [221], [222].

Though CRISPR-Cas mediated efficient genome editing technologies have been broadly applied in a variety of species and different types of cells, there are still some important issues needed to be addressed during the process of application, such as off-target effects, delivery methods, immunogenicity and potential risk of cancer.

It was found that designed sgRNAs will mismatch with non-target DNA sequences and introduce unexpected gene mutations, called off-target effects [223]. Off-target effects seriously restrict the widespread application of CRISPR-Cas mediated genome editing in gene therapy, for it might lead to genomic instability and increase the risk of certain diseases by introducing unwanted mutations at off-target sites [224]. At present, several strategies have been used to predict and detect off-target effects, online prediction software, whole genome sequencing (WGS), genome-wide, unbiased identification of DSBs enabled by sequencing (GUIDE-seq), discovery of in situ cas off-targets and verification by sequencing (DISCOVER-Seq), etc [225]. Furthermore, to minimize off-target effects, researchers have systematically studied the factors affecting off-target effects and developed a number of effective approaches.

(1)

Rational design and modification of sgRNAs

The specific binding of sgRNA with the target sequence is the key factor in CRISPR-Cas mediated genome editing. Rational design of highly specific sgRNAs might minimize off-target effects [224]. The length and GC content of sgRNAs, and mismatches between sgRNA and its off-target site will all affect the frequency of off-target effects [226]. In addition, on the basis of rational design of sgRNAs, the specificity of CRISPR-Cas systems can be further improved by modifying sgRNAs, such as engineered hairpin sgRNAs and chemical modifications of sgRNAs [227], [228].

(2)

Modification of Cas9 protein

As we know, the interaction between Cas9 and DNA affects the stability of DNA-Cas9/sgRNA complex as well as tolerance to mismatch [229]. Therefore, high-fidelity SpCas9 variants have been developed by introducing amino substitution(s) into Cas9 protein in order to destabilize the function structure of the CRISPR complex [230]. Researchers have developed several highly effective Cas9 mutants, high-fidelity Cas9 (SpCas9-HF1), enhanced specificity Cas9 (eSpCas9), hyper-accurate Cas9 (HypaCas9), etc [231], [232], [233]. All of them can significantly reduce off-target effects while retain robust target cleavage activity.

(3)

Adoption of double nicking strategy

Recently, a double-nicking strategy has been developed to minimize off-target effects, which employs two catalytic mutant Cas9-D10A nickases and a pair of sgRNAs to produce a cleavage on each strand of the target DNA, thus forming a functional double strand break [234]. Additionally, it was proven that the fusion protein generated by combining dCas9 with Fok nuclease can also reduce off-target effects [235]. Only when the two fusion protein monomers are close to each other to form dimers, can they perform the cleavage function [235]. This strategy could greatly reduce DNA cleavage at non-target sites.

(4)

Anti-CRISPRs

Off switches for CRISPR-Cas9 system was first discovered by Pawluk et al. in 2016. They identified three naturally existing protein families, named as anti-CRISPRs, which can specifically inhibit the CRISPR-Cas9 system of Neisseria meningitidis[236]. Later, Rauch et al. discovered four unique type IIA CRISPR-Cas9 inhibitor proteins encoded by Listeria monocytogenes prophages, and two of them (AcrllA2 and AcrllA4) can block SpCas9 when assayed in Escherichia coli and human cells [237]. Recently, Doudna et al. discovered two broad-spectrum inhibitors of CRISPR-Cas9 system (AcrllC1 and AcrllC3) [238]. Therefore, in order to reduce off-target effects, the anti-CRISPRs could be used to prevent the continuous expression of Cas9 protein in cells to be edited.

(5)

Others

The concentration of Cas9/sgRNA can also affect the frequency of off-target mutations [239]. Thus, the optimal concentration of Cas9 and sgRNA needs to be determined by pre-experiment. Besides, the formulation of CRISPR-Cas9 can affect the frequency of off-target mutations as well. Cas9 nucleases can be delivered into target cells in 3 different forms: DNA expression plasmid, mRNA or recombination protein [240]. Currently, the use of Cas9/sgRNA ribonucleoprotein complexes (Cas9-RNPs), which are composed of purified Cas9 proteins in combination with sgRNA, is becoming more and more widespread. It was found that delivery as plasmid usually produces more off-targets than delivery as RNPs, since the CRISPR-Cas system is active for a shorter time without Cas9 transcription and translation stages [241], [242].

Nowadays, how to effectively deliver CRISPR-Cas components to specific cells, tissues and organs for precisely directed genome editing is still a major problem in gene therapy. Ideal delivery vectors should have the advantages of non-toxicity, well targeting property, high efficiency, low cost, and biodegradability [35], [156]. At present, three main delivery methods have been employed in delivering CRISPR-Cas components, including physical, viral and non-viral methods [243]. Physical methods are the simplest way to deliver CRISPR-Cas components, including electroporation, microinjection and mechanical cell deformation. They are simple and efficient, which can also improve the expression of genes, and being widely applied in in vitro experiments [243], [244]. In addition, viral vectors, such as adenovirus, adeno-associated virus (AAV) and lentivirus viral vectors, are being widely used for both in vitro/ex vivo and in vivo delivery due to their high delivery efficiency. They are commonly used for gene delivery in gene therapy, and some of them have been approved for clinical use [245], [246]. However, safety issue of viral vectors is still a major problem needed to be solved in pre-clinical trials. Therefore, researchers have turned their attention to non-viral vectors, for instance, liposomes, polymers and nanoparticles [247]. Based on the advantages of safety, availability and cost-effectiveness, they are becoming a hotspot for the delivery of CRISPR-Cas components [248].

Since all these delivery methods have both advantages and disadvantages, its necessary to design a complex of viral vectors and non-viral vectors, which combines the advantages of both vectors. Along with the deepening of research, various carriers could be modified by different methods to increase the delivery efficiency and reduce the toxicity [249]. In addition, more novel vectors, such as graphene and carbon nanomaterials (CNMs), could also be applied in the delivery of CRISPR-Cas components [250], [251].

Since the components of CRISPR-Cas systems are derived from bacteria, host immune response to Cas gene and Cas protein is regarded as one of the most important challenges in the clinical trials of CRISPR-Cas system [156], [252]. It was found that in vivo delivery of CRISPR-Cas components can elicit immune responses against the Cas protein [252], [253]. Furthermore, researchers also found that there were anti-Cas9 antibodies and anti-Cas9 T cells existing in healthy humans, suggesting the pre-existing of humoral and celluar immune responses to Cas9 protein in humans [254]. Therefore, how to detect and reduce the immunogenicity of Cas proteins is a major challenge will be faced in clinical application of CRISPR-Cas systems. Researchers are trying to handle this problem by modifying Cas9 protein or using Cas9 homologues [255].

Recently, two independent research groups found that CRISPR-Cas mediated double-stranded breaks (DSBs) can activate the p53 signaling pathway [256], [257]. This means that genetically edited cells are likely to become potential cancer initiating cells, and clinical treatment with CRISPR-Cas systems might inadvertently increase the risk of cancer [256], [257], [258]. Although there is still no direct evidence to confirm the relationship between CRISPR-Cas mediated genome editing and carcinogenesis, these studies once again give a warning on the application of CRISPR-Cas systems in gene therapy. It reminds us that there is still a long way to go before CRISPR-Cas systems could be successfully applied to humans.

CRISPR-Cas mediated genome editing has attracted much attention since its advent in 2012. In theory, each gene can be edited by CRISPR-Cas systems, even genes in human germ cells [259]. However, germline gene editing is forbidden in many countries including China, for it could have unintended consequences and bring ethical and safety concerns [260].

However, in March 2015, a Chinese scientist, Junjiu Huang, published a paper about gene editing in human tripronuclear zygotes in the journal Protein & Cell, which brings the ethical controversy of human embryo gene editing to a climax [261]. Since then, genome editing has been challenged by ethics and morality, and legal regulation of genome editing has triggered a heated discussion all around the world.

Then, on Nov. 28, 2018, the day before the opening of the second international human genome editing summit, Jiankui He, a Chinese scientist from the Southern University of Science and Technology, announced that a pair of gene-edited babies, named Lulu and Nana, were born healthy in China this month. They are the worlds first gene-edited babies, whose CCR5 gene has been modified, making them naturally resistant to HIV infection after birth [262]. The announcement has provoked shock, even outrage among scientists around the world, causing widespread controversy in the application of genome editing.

The society was shocked by this breaking news, for it involves genome editing in human embryos and propagating into future generations, triggering a chorus of criticism from the scientific community and bringing concerns about ethics and security in the use of genome editing. Therefore, scientists call on Chinese government to investigate the matter fully and establish strict regulations on human genome editing. Global supervisory system is also needed to ensure genome editing of human embryos moving ahead safely and ethically [263].

Since CRISPR-Cas mediated genome editing technologies have provided an accessible and adaptable means to alter, regulate, and visualize genomes, they are thought to be a major milestone for molecular biology in the 21st century. So far, CRISPR-Cas systems have been broadly applied in gene function analysis, human gene therapy, targeted drug development, animal model construction and livestock breeding, which fully prove their great potential for further development. However, there are still some limitations to overcome in the practical applications of CRISPR-Cas systems, and great efforts still need to be made to evaluate their long-term safety and effectiveness.

Visit link:
CRISPR-Cas systems: Overview, innovations and applications in human ...

Recommendation and review posted by Bethany Smith

There's Reason For Concern Over CRISPR Therapeutics AG's (NASDAQ:CRSP) Massive 26% Price Jump  Simply Wall St

The rest is here:
There's Reason For Concern Over CRISPR Therapeutics AG's (NASDAQ:CRSP) Massive 26% Price Jump - Simply Wall St

Recommendation and review posted by Bethany Smith

Scientists are using AI to help detect heart disease, could help everyone live longer  WKRC TV Cincinnati

Go here to read the rest:
Scientists are using AI to help detect heart disease, could help everyone live longer - WKRC TV Cincinnati

Recommendation and review posted by Bethany Smith

The CI AdvantageStability, Safety, And Security

We have a proven track record of financial security and stability, as well as price stability. CI is the only cryonics organization with no debt, no stockholders, and no landlords. We own our patient care facilities outright, and all of our member officers and directors donate their services voluntarily. Were one of the oldest cryonics organizations in existence and the only such organization that has never raised its prices, even in high-inflation times like the late 70s and early 80s. Adjusting for inflation, our prices have actually steadily declined, and we hope to continue that trend.

As members, each and every one of us has a vested interest in the long-term viability of our organization our facilities, cryostats and finances are built to last into the future were striving toward.

We have a flexible and rapid system of emergency patient care based on widely available networks of mortuary assistance. This means that in the critical early stages, we can bring qualified professionals to you throughout most of the world. In particular, London-based F.A. Albin & Sons funeral directors are trained, practiced, equipped, and prepared to fly a team anywhere in Europe on short notice to help European CI members, tourists or business travellers.

Our prices are lower than any other organization in fact, the most affordable prices anywhere in the world. This is in keeping with our membership philosophy to provide ourselves reliable cryonic services at a reasonable and affordable cost. If we were to raise prices, wed only be charging ourselves more.

Our minimum whole-body suspension fee is $28,000. (For members at a distance, transportation costs and local help will be additional.) Our $28,000 fee is a one-time only payment, with no subsequent charges.Its easily funded by insurance or other means. (For last-minute cases, where the patient was not signed up beforehand, we ordinarily charge $35,000 rather than $28,000, if arrangements can be worked out at all.)

Does that lower fee mean lower quality patient care or services?Absolutely not.We believe that our non-profit status allows us to more successfully control costs. We believe that specific methods and research offered by alternative cryonics organizations differ only slightly from ours and that our procedures and policies give an equal or better chance for patient survival than competing organizations.

See for yourself. Read ourFAQand review The CI Advantage. Remember, many CI members could afford the higher prices of other organizations for themselves and their families, but weve chosen CI because we know its our best bet. And yours.

Read the rest here:
About CI - The Cryonics Institute

Recommendation and review posted by Bethany Smith

When an 87-year-old Californian man was wheeled into an operating room just outside Phoenix last year, the pandemic was at its height and medical protocols were being upended across the country.

A case like his would normally have required 14 or more bags of fluids to be pumped into him, but now that posed a problem.

Had he been infected with the coronavirus, tiny aerosol droplets could have escaped and infected staff, so the operating team had adopted new procedures that reduced the effectiveness of the treatment but used fewer liquids.

It was an elaborate workaround, especially considering the patient had been declared legally dead more than a day earlier.

He had arrived in the operating room of Alcor Life Extension Foundation located in an industrial park near the airport in Scottsdale, Ariz. packed in dry ice and ready to be cryopreserved, or stored at deep-freeze temperatures, in the hope that one day, perhaps decades or centuries from now, he could be brought back to life.

As it turns out, the pandemic that has affected billions of lives around the world has also had an impact on the nonliving.

We are having trouble retrieving the article content.

Please enable JavaScript in your browser settings.

Thank you for your patience while we verify access. If you are in Reader mode please exit andlog intoyour Times account, orsubscribefor all of The Times.

Thank you for your patience while we verify access.

Already a subscriber?Log in.

Want all of The Times?Subscribe.

Read more from the original source:
Cryonics During the Pandemic - The New York Times

Recommendation and review posted by Bethany Smith