SwanBio has been making tremendous progress in the advancement of our AAV-based pipeline of therapeutics for the treatment of neurological diseases, and we are thrilled to expand our Board of Directors with these key appointments, said Tom Anderson, Chief Executive Officer of SwanBio. Patty, Danny and Alex each bring a wealth of knowledge and expertise within their individual focus-areas, and their insights will be invaluable as we advance toward becoming a clinical company. We look forward to benefiting from their experience and collaborating on the important work ahead to deliver new medicines to patients with devastating diseases.

Im pleased to join the SwanBio Board of Directors, along with Danny and Alex, at this pivotal moment in the companys evolution, said Ms. Allen. SwanBio is driven by an exceptional team and founded based on innovative science, with a gene therapy approach that could make a significant difference for a number of people who suffer from genetic neurological diseases. I am excited for the future of this company and the opportunity to help guide them forward.

Ms. Allen is a business finance and operations leader with more than 25 years of experience leading private and public companies through initial public offerings, equity and debt financings, SEC reporting, investor relations, sell-side and buy-side, strategic and long-range planning, FP&A, treasury, risk management and business development. Most recently, she served as Chief Financial Officer of Zafgen, Inc. (now Larimar Therapeutics) from 2013-2020. Prior to Zafgen, Ms. Allen was an independent financial consultant from 2011-2012; served as Vice President of Finance, Treasurer and Principal Financial Officer of Alnylam Pharmaceuticals, Inc from 2004-2011; and as Director of Finance at Alkermes from 1992-2004. Ms. Allen also serves as a Director on the Board of Directors of several biotechnology companies and serves as the Chair of their Audit Committees. Ms. Allen graduated summa cum laude from Bryant College with a B.S. in business administration.

Dr. Bar-Zohar is a certified physician with proven expertise in drug development and a personal commitment to change peoples lives by developing sustainable, transformative healthcare solutions using both traditional and emerging technologies. He was recently appointed Global Head of Development at Merck KGaA in Darmstadt, Germany. Prior to Merck KGaA, Dr. Bar-Zohar was a Partner at Syncona and held various roles at Novartis Pharma AG from 2013-2020, most recently serving as Global Head, Clinical Development and Analytics. Before Novartis, Dr. Bar-Zohar held various clinical and medical affairs roles at Teva Pharmaceuticals Industries from 2006-2012. He obtained his medical doctor degree at the Sackler Faculty of Medicine, Tel-Aviv University and was trained in general surgery at the Tel-Aviv Medical Center.

Dr. Hamilton is an experienced financial leader within the biotech and pharmaceutical industries. Since SwanBios founding, Dr. Hamilton has played a key role in helping shape the companys strategy as a Board Observer. Before joining Syncona, he was a member of the Healthcare Investment Banking team at Jefferies International, where he worked on a range of financings and mergers and acquisitions across the biotechnology, pharmaceutical and healthcare sectors. Dr. Hamilton received his Ph.D. in immunology from the University of Cambridge.

About SwanBio Therapeutics

SwanBio Therapeutics is a gene therapy company that aims to bring life-changing treatments to people with devastating, genetically defined neurological conditions. SwanBio is advancing a pipeline of AAV-based gene therapies, designed to be delivered intrathecally, that can address targets within both the central and peripheral nervous systems. This approach has the potential to be applied broadly across three disease classifications spastic paraplegias, monogenic neuropathies and polygenic neuropathies. SwanBios lead program is being advanced toward clinical development for the treatment of adrenomyeloneuropathy (AMN). For more information, visit SwanBioTherapeutics.com.

View source version on businesswire.com: https://www.businesswire.com/news/home/20201120005210/en/

See the rest here:
SwanBio Therapeutics Expands Board of Directors with Appointments of Proven Industry Leaders - BioSpace

Recommendation and review posted by Bethany Smith

MedicalResearch.com Interview with:

Richard C. Austin, PhDProfessor and Career Investigator of the Heart and Stroke Foundation of OntarioAmgen Canada Research Chair in NephrologyMcMaster University and St. Josephs HealthcareHamilton, Ontario, Canada

MedicalResearch.com: What is the background for this study? What are the main findings?

Response: A previous study published in 2011 by my collaborator, Dr. Michel Chretien at the IRCM, identified a rare mutation in the PCSK9, termed Q152H. Individuals harboring this mutation demonstrated dramatic reductions in their LDL cholesterol levels and had a significantly lower risk of CVD. Furthermore, individuals harboring the Q152H mutation showed increases in longevity with no evidence of other diseases such as liver disease, cancer and chronic kidney disease.This Q152H mutation was unique with only 4 families in Quebec shown to harbor this genetic variant.

In terms of its effect on PCSK9 expression/activity, themutation at Q152H was precisely at the cleavage site in PCSK9 necessary for its activation. As a result, the Q152H mutation fails to be cleaved and activated, thereby blocking its secretion into the circulation. This is why the Q152H mutation is considered a loss-of-function PCSK9 mutant. Given our labs interest in endoplasmic reticulum (ER) stress and ER storage diseases, we began to collaborate with Drs. Chretien and Seidah at the IRCM to investigate whether this Q152H mutant, when overexpressed in liver cells, would cause ER stress and liver cell injury. This was based on the findings that the Q152H mutant does not undergo autocatalytic cleavage and itssubsequent secretion from liver cells.

It is well known in the literature that the accumulation of misfolded or inactive proteins in the ER gives rise to ER stress and cell injury/dysfunction. As a result, we initially showed to our surprise that overexpression of the Q152H mutant in liver cells failed to cause ER stress BUT increased the protein levels of several important ER chaperones, GRP78 and GRP94, known to PROTECT against liver cell injury/dysfunction. As part of our JCI study, we furthered these studies to examine the effect of the Q152H mutant when overexpressed in the livers of mice. This is where we demonstrated that the Q152H mutation showed protection against ER stress-induced liver injury/dysfunction.

MedicalResearch.com: What are the main findings? How is this gene variant related to the PCSK9 inhibitor evolocumab (Repatha)?

1. That the Q152H variant is considered a loss-of-function PCSK9 variant that protects against CVD by lowering LDL cholesterol levels. The reason it is a loss-of-function variant is because the protein fails to be secreted out of liver cells because it is retained in the ER of hepatocytes.

In terms of its relation to evolocumab, there are some major differences. Evolocumab is a fully human monoclonal antibody against PCSK9 that can bind to circulating PCSK9 and block its ability to bind to the LDL receptor on the surface of the liver. As a result, the levels and half life of the LDL receptor increases on the surface of hepatocytes, thereby increasing the uptake of LDL cholesterol. You could say that evolocumab acts like a loss-of-function PCSK9 variant. As indicated above, the Q152H variant blocks the autocatalytic cleavage of PCSK9 and its secretion from the ER of hepatocytes. As a result, the Q152H PCSK9 protein is retained in the ER of hepatocytes and fails to be secreted into the blood.

MedicalResearch.com: What should readers take away from your report?

Response: That mutations in the PCSK9 gene that affect its activation may act to protect against several human diseases and may contribute to increaselongevity and good health. Therefore, gene therapy approaches or new medicines that block the secretion of PCSK9 protein from the liver may have multiple beneficial health effects.

MedicalResearch.com: What recommendations do you have for future research as a result of this study?

Response: We recommend that future research will allow us to determine whether gene therapy to express the Q152H variant or small molecule inhibitors of PCSK9 activation in the liver are novel approaches aimed at protecting against BOTH CVD and liver disease. WE are now in the process of generating a Q152H knockin mouse (using CRISPR/Cas9) to better understand the health benefits of the Q152H variant. This unique mouse model will allow us to perform a number of novel studies aimed at understanding the role of the Q152H variant in tissues/organs that are know to express PCSK9, such as liver, small intestine, kidney and brain.

MedicalResearch.com: Is there anything else you would like to add? Any disclosures?

Response: This study has utilized both clinical and biomedical approaches to better understand how a rare mutation in the PCSK9 gene can have a number of surprisingly protective effects on several different diseases.

Citation:

Paul F. Lebeau, Hanny Wassef, Jae Hyun Byun, Khrystyna Platko, Brandon Ason, Simon Jackson, Joshua Dobroff, Susan Shetterly, William G. Richards, Ali A. Al-Hashimi, Kevin D. Won, Majambu Mbikay, Annik Prat, An Tang, Guillaume Par, Renata Pasqualini, Nabil G. Seidah, Wadih Arap, Michel Chretien, Richard C. Austin.The loss-of-function PCSK9Q152H variant increases ER chaperones GRP78 and GRP94 and protects against liver injury.Journal of Clinical Investigation, 2020; DOI:10.1172/JCI128650

The information on MedicalResearch.com is provided for educational purposes only, and is in no way intended to diagnose, cure, or treat any medical or other condition. Always seek the advice of your physician or other qualified health and ask your doctor any questions you may have regarding a medical condition. In addition to all other limitations and disclaimers in this agreement, service provider and its third party providers disclaim any liability or loss in connection with the content provided on this website.

6

Read more:
Rare Mutation in the PCSK9 Gene Confers Long Healthy Life - MedicalResearch.com

Recommendation and review posted by Bethany Smith

Among the imminent miseries worldwide, the mortalities and morbidities caused by the combination of covid-19 and Diabetes Mellitus are considered to be the most tragic. The pandemic has created a pandemonium and is a byword for misery. Since the beginning of the 21st century, the viruses of Nidovirales order have affected the humanity three memorable times: SARS-CoV in 2002, MERS-CoV in 2012 and SARS-CoV-2 in 2019-2020. Coronaviruses are large, enveloped and positive-stranded RNA viruses. The SARS-CoV-2 consists of an envelope which is made of spikes, membrane and envelope glycoproteins. Inside the envelope, there is the Nucleocapsid that is formed from multiple copies of the N proteins. The Nucleocapsids are perennially attached with te RNA of the virus. The Spike protein is implicated in binding to the ACE2 receptors that are located on the cell surfaces of the respiratory tract of human body. The pinioning of viral envelope and cell membrane of human cell is followed by the release of the viral genome into the target cell.

The clinical symptoms of covid-19 are fever, dry cough, malaise, diarrhea, dyspnea and pneumonia. Lab findings include lymphopenia and bilateral ground glass opacity or consolidation that is observed in Chest CT-scans. Covid-19 can be confirmed by real time RT-PCR and IgM plus IgG antibody tests.

The pharmacists and biotechnologists must track down a veracious antiviral that should eradicate the disease once and for all. Furthermore, the inhabitants of the globe should come forward to voice their apprehensions regarding any possibility of biological warfare in the New Cold War era that has already exhibited and manifested itself since the beginning of the 21st century

As a doctor in the pandemic, I made some observations regarding diabetes mellitus and unintentional childhood injuries at home. Diabetes Mellitus refers to a group of common metabolic disorders sowing as hyperglycemia. The factors contributing are reduced insulin secretion, decreased glucose utilization and increased glucose production. Type 1 DM is a subtype of diabetes mellitus (DM) due to an autoimmune beta-cell destructive process mediated by T-lymphocytes. It can transpire at any age but it frequently manifests itself before 30. It is estimated that between five and ten percent of those developing DM after the age of 30 years have Type 1 Diabetes Mellitus (DM). Another subtype of Diabetes Mellitus is called MaturityOnset Diabetes of the Young (MODY) that is characterized by autosomal dominant inheritance, early onset of hyperglycemia (usually under 25) and impairment in nsulin secretion. MODY is divided into MODY 1, 2, 3, 4, 5, 6 and so on. Other subtypes of DM are Gestational Diabetes and Type 2 Diabetes Mellitus. Type 2 Diabetes Mellitus is characterized by Impaired Insulin Secretion, Insulin Resistance, Excessive Hepatic Glucose Production and Abnormal Fat metabolism.

The acute complications of DM are Diabetic Ketoacidosis and Hyperglycemic Hyperosmolar State (HHS). The micro-vascular complications of DM are Retinopathy, Neuropathy and Nephropathy. The macrovascular complications are Coronary Heart Disease, Peripheral Arterial Disease and Cerebrovascular Disease. Other complications include Diabetic Foots and Ulcers. In the light of all the aforementioned complications of DM, simultaneous COVID-19 disease can lead to dreadful effects. This group of patients needs our sympathy.

Another hallmark of interest is the unintentional injuries of children at home, especially under the age of five. These injuries mostly occur due to burns, drowning, poisoning and fall and are responsible for the mortality of round about seven percent among 875,000 deaths of children each year. According to a report of Centers for Disease Control and Prevention (2001), In the USA, more children between the ages of one and four die annually from unintentional injuries than from all childhood diseases combined. Furthermore, For every childhood death caused by injury, there are approximately 18 hospitalizations, 233 emergency department visits, many more visits to medical facilities, and a much larger number of home-treated injuries. The factors associated with unintentional injuries at home are physical, biological and social environments. During the coronavirus pandemic, there is a dire need to minimize such types of injuries for reducing hospital admissions and stays, which are high-water marks for contamination of COVID-19 in third world countries.

To beat the extremities of agoraphobia and of the purgatory-like scenes around the world, the philanthropists and community of scientists must come forward to ferret out a pragmatic screenplay of active and passive immunity against SARS-CoV-2. Research should be carried out to discover a meaningful vaccine and synthetic immunoglobulins. Though, Pfizer and BioNTech in November 2020 released the details of a vaccine that could prevent more than 90 percent of people from getting covid-19, still much more efforts are required from brains and brawn of humanity. Antivirals like Favipiravir and Remdesivir are already approved for elimination of this menace in some countries but the pharmacists and biotechnologists must track down a veracious antiviral that should eradicate the disease once and for all. Furthermore, the inhabitants of the globe should come forward to voice their apprehensions regarding any possibility of biological warfare in the New Cold War era that has already exhibited and manifested itself since the beginning of the 21st century.

In order to give hope to diabetic patients who also suffer from covid-19, the whole health community should devise plans to find selective TGF- inhibitors. Studies should also be carried out on inhibition of Inflammatory Signalling Pathways such as Nuclear Factor kB (NF-kB) pathway. Similarly, gene therapy by viral vector or by non-viral transduction and stem cells curing techniques should be explored worldwide for the best results. VEGF-A inhibition therapy in retinopathic cases should be provided at nearby primary health care centres by a covid-19-free healthcare professional if possible. Incretin analogues may also be supplied to deserving patients. The depression and anxiety of these patients need to be reduced and for this purpose, psychiatrists and psychologists are advised to play their lead role.

Though Duloxetine is the drug of choice for curtailment of neuropathic pain, the clinicians and policy makers should ponder over the scenario as an organic whole that also includes factors like poverty, environment and trust capital. Vitamin B-12 (Cobalmin) should be proffered free of cost to diabetic patients. Antibiotics that can act against MRSA should be included in the essential drugs list of hospitals during the pandemic.

Policies should be shaped to bring into existence a safe environment within abodes for children during the pandemic and an awareness session must be arranged via media to educate the parents with more emphasis on keeping dangerous objects out of the reach of children.

Another way of bringing new hope and blessings to humanity during the pandemic is via introducing electronic government in every nook and corner of this world. Electronic governance comprises electronic administration, electronic services, electronic democracy and electronic business. The sowing of seeds of biometric voting system in elections and transformation of the revenue system by replacing conventional means should be spearheaded without any delay all over the world during the pandemic. Furthermore, the social security laws and system all over world should be made more labor/employee-friendly so that the poor (excluding rich) victims of unemployment in private sector institutions during this pandemic can satisfy their mouth and stomach. It is also added that States all over the world may initiate debt-free and interest-free currencies for a short period of time to bear the expenses during this pandemic. The humanity can emulate the Bradbury Pound initiative or the Constitutional Monetary System of Lincoln for a period of two or three months. Similarly, single/solitary person tourism should be encouraged to beat the woes of anxiety and depression.

Go here to see the original:
Living through the second wave - Pakistan Today

Recommendation and review posted by Bethany Smith

A person who has difficulty falling or staying asleep may find that they benefit from using natural sleep aids, such as melatonin, to help them get the sleep they need.

This article will look at five natural sleeping aids and suggest when a person should see a doctor for sleep issues. It will also discuss some research that focuses on the effectiveness of natural sleeping pills.

People should be aware that the Food and Drug Administration (FDA) do not regulate natural sleeping pills because they are supplements.

When a person is shopping for natural sleeping pills, they should check for third party testing and read the product labels carefully.

It is also important that they speak with a doctor before taking any supplements, especially if they have any underlying health conditions or are taking any prescription medications.

Below, we review five natural sleeping pills and discuss how they could benefit a person who is struggling to sleep.

Please note that the writer has not tested any of these products. All information is research-based.

Proponents of valerian root say that it may help relieve symptoms of anxiety and help people sleep.

Older research suggests that valerian root could be an effective sleep aid that people tolerate well. Indeed, a 2020 analysis of several studies also found it effective in the promotion of sleep.

People should remember that studies looking into the effects of valerian root are limited and conflicting, so further research is necessary to support their findings.

One valerian root-based supplement a person may want to try is Best Rest Formula, which contains a blend of valerian root, lemon balm, passionflower, and chamomile.

Best Rest Formula is available for purchase online.

Melatonin is a naturally occurring hormone in the human body. The hormone helps people relax and fall asleep.

The levels of melatonin in the body rise and fall naturally during the day and night. Because light blocks melatonin production, its levels are highest at night. However, if a person has exposure to light at night, it could block melatonin production.

A small 2016 study suggests that melatonin supplements are effective in helping improve the onset of sleep in people who work shifts.

However, a 2014 review suggests the opposite. That said, the reviewers do note a weak relationship between taking melatonin and a reduction in sleep disruption from jet lag.

As a result, people should be aware that studies investigating the effect of melatonin supplements on sleep are conflicting, and more research is necessary to fully understand how they work.

One melatonin supplement a person may want to try is Melaton-5 from Thorne. Thorne say that they test all their products at least four times as part of their quality control procedures.

Melaton-5 is available for purchase online.

Proponents of lavender suggest that it has relaxing and antianxiety properties.

One systematic review from 2019 concludes that lavender in either capsule or aromatherapy form not only helps people get to sleep but also provides some anxiety relief.

Another 2019 review found that when people took silexan lavender capsules in 160-milligram doses, they scored lower on an anxiety score questionnaire.

However, both reviews acknowledge that more studies are necessary to understand the effects of lavender when a person takes it in either capsule form or as an aroma.

One lavender supplement a person may want to try is the Be Grounded supplement from Happy Healthy Hippie. According to Happy Healthy Hippie, they use non-genetically modified organism (GMO) and vegan ingredients in their products.

Be Grounded is available for purchase online.

Magnesium is an essential nutrient responsible for various physiological functions within the body. Magnesium occurs naturally in some foods, while manufacturers add it to some others.

According to an older study, magnesium supplements may help with improving various aspects of sleep. The researchers identified significant increases in sleep time and quality.

Newer studies are also finding that magnesium supplementation is effective in helping relieve insomnia.

However, more studies are necessary to understand how magnesium supplements exert their effect on the body.

One magnesium supplement a person may want to try is magnesium+ by mindbodygreen. This supplement also contains jujube and pharmaGABA. According to mindbodygreen, they have state-of-the-art laboratories and conduct four rounds of testing.

magnesium+ is available for purchase online.

Glycine is an amino acid that may help people fall asleep.

According to one 2015 study, glycine improves sleep by helping modulate the circadian rhythm, which governs the sleep-wake cycle.

One glycine supplement a person may want to try is from Life Extension. Life Extension claim that this supplement is vegan, non-GMO, and gluten-free.

Glycine is available for purchase online.

Read the original post:
Natural sleeping pills: What are they? - Medical News Today

Recommendation and review posted by Bethany Smith

DetailsCategory: AntibodiesPublished on Thursday, 19 November 2020 14:46Hits: 632

-Lead antibody expected to advance to clinical studies for treatment and prevention of COVID-19 in early 2021-

WALTHAM, MA, USA I November 18, 2020 I Adagio Therapeutics, Inc., today pre-published in vitro and in vivo data demonstrating its lead antibody candidate, ADG2, shows similar or higher potency against SARS-CoV-2 compared to monoclonal antibodies (mAbs) in clinical development, while also uniquely offering broad neutralization against a range of sarbecoviruses that pose a threat to humans. Adagio expects its half-life engineered version of ADG2, called ADG20, to enter clinical studies in early 2021. The manuscript summarizing the Adagio findings has been accepted for review by the journal Science and was made available on the bioRxiv.org pre-print server.

These studies demonstrate our lead antibody shows comparable or higher neutralization potency against SARS-CoV-2 than most leading antibodies currently in development for COVID-19, and yet maintains its ability to potently neutralize SARS-CoV and additional pre-emergent SARS-like coronaviruses currently circulating in bats, said Laura Walker, Ph.D., chief scientific officer of Adagio. All of the antibodies currently in clinical development trade-off breadth for potency. They either show broad activity against other sarbecoviruses but lack neutralization potency, or they show high neutralization potency against SARS-CoV-2 but lack activity against other coronaviruses. These data suggest that ADG20 holds the promise of being a broadly protective agent against SARS-CoV-2 as well as future SARS-like coronaviruses that are likely to emerge.

Data highlights:

Potency and breadth of coverage

Viral escape variants

Other enhanced attributes

As we look to the future, it is clear we will need potent treatment and prevention for not only COVID-19 but also for future coronaviruses, which we can now say with near certainty will continue to emerge, said Tillman Gerngross, Ph.D., chief executive officer of Adagio. Based on these data, we believe ADG20 has the potential to offer unsurpassed treatment and prevention for COVID-19 while serving as a potent and broadly protective countermeasure to protect against resistant strains of SARS-CoV-2 as well as future sarbecovirus threats. Importantly, we took our time to develop ADG20 without sacrificing duration of effect, manufacturability, and affordability. We look forward to advancing ADG20 into the clinic in 2021 to learn how it may provide protection from the greatest pandemic of our lifetime.

About Adagio Therapeutics

Adagio is developing best-in-class antibodies that can broadly neutralize SARS-CoV-2, SARS-CoV and additional pre-emergent coronaviruses. We believe our antibodies will match or exceed the potency and coverage of conventional SARS-CoV-2 antibody programs and can be used in both treatment and durable prevention. Our candidates are engineered using industry-leading antibody discovery capabilities and are designed to maximize potency and duration of effect. Our portfolio includes multiple, non-competing antibodies with distinct binding targets, enabling a strategy that can avoid viral escape. Our lead program, ADG20, is expected to enter the clinic in early 2021. ADG20 was designed to provide patients and clinicians with an unsurpassed combination of potency, breadth, durable protection (via half-life extension), manufacturability, tolerability, and affordability. For more information: http://www.adagiotx.com

SOURCE: Adagio Therapeutics

Read the rest here:
Adagio Therapeutics COVID-19 Antibody Demonstrates Best-in-Class Breadth and Potency Against a Range of Coronaviruses that Pose Human Threat |...

Recommendation and review posted by Bethany Smith

INDIANAPOLIS, Nov. 16, 2020 (GLOBE NEWSWIRE) -- Infrastructure and Energy Alternatives, Inc. (NASDAQ: IEA) (IEA or the Company), a leading infrastructure construction company with renewable energy and specialty civil expertise, today announced that the Company has formed a new Renewable Energy Services Group to expand on its portfolio of renewable construction services by offering technical maintenance and repair after construction. This group will serve as the next phase in the Companys relationship with wind project owners, developers and OEMs.

IEAs new Renewable Energy Services Group expands upon the Companys technical capabilities, field expertise, processes and tooling. Through these expanded service offerings, IEA will help its customers lower their operational costs, while still ensuring that they receive the highest quality of service and safety standards. As part of this new offering, IEA will provide extended services to wind customers, which include blade repairs, major component change-outs, repowering, life extension projects and other value-added specialized services.

Currently when a wind project is complete, infrastructure maintenance is often left to project developers and owners, said Chris Hanson, Executive Vice President of IEA. With the creation of our Renewable Energy Services Group, we will now have the opportunity to extend the relationship with our customers and provide comprehensive services throughout the lifespan of the project.

IEA has brought onboard a team of seasoned industry professionals from the renewable energy field that will spearhead the Renewable Energy Services Group. This team is led by Brant Patnode, Senior Vice President, Paul Idziak, Vice President of Business Development, Franco Repetto, Vice President of Commercial Operations, Keith Wharton, Vice President of Operations and Forrest Hach, Director of Field Operations. For additional information on the Renewable Energy Services Group please visit: iea.net.

I have worked with IEA for over a decade in the wind energy industry and have always been impressed with the quality of work they provide, said Brant Patnode, Head of IEAs Renewable Energy Services Group. It is a privilege to build an industry-leading team with an organization that shares the same values for safety, quality, innovation and customer service that have guided me throughout my career.

To date, IEA has constructed more than 2 gigawatts of wind energy across North America. The Company was recently ranked #2 for wind construction amongst Engineering News-Records (ENR) 2020 Top 400 Contractors. For more information on ENR rankings, please visit enr.com.

About IEA

Infrastructure and Energy Alternatives, Inc. is a leading infrastructure construction company with renewable energy and specialty civil expertise. Headquartered in Indianapolis, Indiana, with operations throughout the country, IEAs service offering spans the entire construction process. The Company offers a full spectrum of delivery models including full engineering, procurement, and construction, turnkey, design-build, balance of plant, and subcontracting services. IEA is one of the larger providers in the renewable energy industry and has completed more than 200 utility scale wind and solar projects across North America. In the heavy-civil space, IEA offers a number of specialty services including environmental remediation, industrial maintenance, specialty transportation infrastructure and other site development for public and private projects. For more information, please visit IEAs website at http://www.iea.net or follow IEA on Facebook, LinkedIn and Twitter for the latest company news and events.

Forward Looking Statements

This release contains forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995. The use of words such as anticipate, expect, could, may, intend, plan and believe, among others, generally identify forward-looking statements. These forward-looking statements are based on currently available operating, financial, economic and other information, and are subject to a number of risks and uncertainties. Readers are cautioned that these forward-looking statements are only predictions and may differ materially from actual future events or results. A variety of factors, many of which are beyond our control, could cause actual future results or events to differ materially from those projected in the forward-looking statements in this release. For a full description of the risks and uncertainties which could cause actual results to differ from our forward-looking statements, please refer to IEAs periodic filings with the Securities & Exchange Commission including those described as Risk Factors in IEAs annual report on Form 10-K filed on March 12, 2020 and in its quarterly reports on Form 10-Q. IEA does not undertake any obligation to update forward-looking statements whether as a result of new information, future events or otherwise, except as may be required under applicable securities laws.

Contact:

Here is the original post:
Infrastructure and Energy Alternatives, Inc. Extends Service Offering to Wind Customers Through Formation of New Renewable Energy Services Group -...

Recommendation and review posted by Bethany Smith

The family of a 10-year-old girl fighting an inoperable brain tumour have told how the pandemic has robbed them of precious memories with their daughter.

But they say the generosity of donations are helping to prolong her life.

Paul Slapa and Carran Williams were given the devastating news on New Years Eve that their daughter, Eva, had diffuse intrinsic pontine glioma (DIPG).

The tumour sits in the brain stem, making it impossible to remove.

The rare and aggressive disease only affects a small number of children each year, and as a result, little progress has been made to identify ways to treat children with the diagnosis.

The family, from Marford, Wrexham, were told the best thing to do was to go and make memories as a family.

But as the pandemic struck, not only were plans for family holidays and special days out restricted - clinical trials in the US were also put on hold.

Once they eventually reopened in July, the trials only began accepting US patients because of travel restrictions.

Evas dad, Paul, who works in finance, said: The diagnosis was hard enough.

But to then miss out on treatment and to be able to go places together and go on holiday is tough.

Youre just waiting around, and now that shes in a position where things are more difficult for her, we cant do these things anyway because shes unable to.

Were lucky to live in a rural area, but its not quite the same as doing the fun stuff.

Its those things that have been affected from a memories perspective.

Weve just missed out on this period of time, and that has been tough.

He told how Evas last scan in October revealed the tumour has progressed, meaning the ability to move her face and her balance has become worse.

There are no more treatment options in the UK - shes had her last radiotherapy in August which was just to stabilise things, Paul said.

Thats all finished now.

As a result, the family is desperate to continue raising money that will help fund private medication that is hoped will prolong Evas life until medication with a known positive effect becomes available.

After starting a fundraising campaign at the beginning of the year, they hit their initial 250,000 target.

But with ever-growing private medical costs and with the hope of finding more effective treatment, the target has now been increased to 500,000.

The worst scenario is that we get access to something, but then we cant afford to do it, Paul said.

Not having the money shouldnt be an issue - so thats why we carry on.

They are currently paying 12,000 every 12 weeks for a private German medication, which Eva has been taking since June.

They are also trying to access further medication in the hope of prolonging their daughters life at a cost of around 10,000 a month.

Its all cost that adds up because the NHS will not allow us to have them over here, which is frustrating, Paul added.

If we were to continue with the treatment over the next 12 months, were talking 160,000 euros - and that doesnt include European hospital care.

It means weve got to keep fundraising because those amounts of money are just astronomical.

Paul said they dont know if the medication is having a positive effect on Eva, but say they will continue with the treatment in the hope that it is.

The reality is there is no cure for DIPG, so life extension is your goal, he said.

We hope during that time as trials launch that something does prove to have an effect.

We have to act now because we dont know what the future holds.

Paul added: The NHS is brilliant in terms of free access to healthcare and thats fantastic - but where it doesnt work as well is when you have to pay thousands of pounds to access a drug because the NHS wont prescribe it because its not part of a trial.

My attitude is that if its potentially going to help a child whos ill to the point where they don't necessarily have that amount of time, then you should try these things.

Weve been really lucky that lots of people have supported us, but I know of other families who havent had that same success.

How is it fair that they then just dont get access to treatment?

It doesnt make sense to restrict a child from having a chance - its wrong.

But since the pandemic, Paul told how it has become very difficult to raise money with coronavirus restrictions in place.

We had all these ideas in the pipeline to hold events, but even thats been difficult because of the restrictions, so weve had to find different ways to do it.

Theres only so many times you can ask people to keep giving.

Locally so many incredible people have donated already, but how many times can you ask that same person to put their hand in their pocket for us?

Thats why Children in Need was fantastic because it raised awareness of Evas situation nationally.

Did you know we offer a free email newsletter service?

Each North Wales Live bulletin delivers the latest breaking news, what's on events and the hottest talking points straight to your inbox.

For more information about how - and why - to subscribe, click here click here.

He added: You have to try to remain focused on making things happen and moving forward, otherwise it all consumes you.

You dont think about the future, you just have to deal with the here and now.

A lot of people tell us were so strong, but what is the alternative? We cant be anything else because it doesnt help Eva.

In a bid to further raise the profile of Evas case, the family appeared on BBC's Children in Need last week, which highlighted Evas journey so far.

In an emotional video played to the nation, her parents told how she had lost the ability to smile which they said has been pretty tough.

Up until recently, shes coped well with the physical side of things, Paul said.

A lot of the frustration for Eva is the psychological side of it.

She sees the appearance change and it sparked a reaction after watching the Children in Need video.

There were pictures and videos running on the beach and pictures of her when she was younger smiling, and its that which knocked her.

She turned to Carran and said she wanted to be normal again.

Its that bit that really gets to you, because theres nothing you can do to help her.

See more here:
Family fight to make more memories with daughter after pandemic robs them of precious time - North Wales Live

Recommendation and review posted by Bethany Smith

AUSTIN, Texas, Nov. 19, 2020 (GLOBE NEWSWIRE) -- Aspira Womens Health, Inc. (Nasdaq: AWH), a bioanalytical-based womens health company, today announced it has entered into a collaborative research agreement with Baylor Genetics (Houston, TX) to co-develop a novel Ovarian Cancer early-detection test. Ovarian cancer accounts for more deaths than any other cancer of the female reproductive system and is the only gender specific cancer with an over 50 percent mortality rate impacting women of all ages and ethnicities.

Aspira has over 10 years of research and experience in early stage detection of ovarian cancer in women, and we are thrilled to accelerate our innovation and product development platform by entering into this collaborative agreement with Baylor Genetics. We look forward to combining the strengths from each respective research team, and working together on our OVA360 clinical study, specifically in our mutual goal of characterizing an Ovarian Cancer molecular profile, said Lesley Northrop, Ph.D., FACMG, Chief Scientific Officer at Aspira Womens Health. Baylor Genetics is one of the founding institutions of genomic research, collaborating on proteogenomic technology in the development of a cell-free DNA-based Ovarian Cancer risk detection test.

Dr. Brian Merritt, Medical Director at Baylor Genetics, said,Ovarian cancer is a particular cancer type in need of better early detection methods, and advances in genetic testing technologies now enable us to develop such a test for clinical use. Aligning with Aspira to co-develop this novel test will advance precision medicine for women with ovarian cancer and potentially lead to earlier intervention, more targeted treatments, and improved outcomes.

Baylor Genetics has been a leading pioneer in genetic testing, providing unmatched knowledge and experience in hereditary genetics, clinical genomics, and translational technology. Aspira is uniquely positioned to co-develop and recruit patient samples for the development of this new test. With over 10 years of experience in ovarian cancer risk assessment testing and developing multiple FDA-cleared products that are instrumental in helping providers and patients detect risk in women with pelvic masses, Aspira provides both clinical and commercialization expertise for bringing this novel test to market.

About Aspira Womens Health Inc.Aspira Womens Health, Inc. (formerly known as, Vermillion inc.,Nasdaq:VRML) is transforming womens health with the discovery, development, and commercialization of innovative testing options and bio-analytical solutions that help physicians assess risk, optimize patient management and improve gynecologic health outcomes for women. ASPIRA is particularly focused on closing the ethnic disparity gap in ovarian cancer risk assessment and developing solutions for pelvic diseases such as pelvic mass risk assessment and endometriosis.OVA1plus includes our FDA-cleared products, OVA1, and OVERAto detect risk of ovarian malignancy in women with adnexal masses. ASPIRA GenetiXTMtesting offers both targeted and comprehensive genetic testing options with a gynecologic focus. With over 10 years of expertise in ovarian cancer risk assessment, ASPIRA is delivering a portfolio of pelvic mass products over a patients lifetime with our cutting-edge research. The next generation of products in development are OVANEXTMand EndoCheckTM.Visit our website for more information at http://www.aspirawh.com.

About Baylor Genetics Baylor Genetics is a joint venture of H.U. Group Holdings, Inc. andBaylor College of Medicine, including the #1 NIH-funded Department of Molecular and Human Genetics. Located inHouston'sTexas Medical Center,Baylor Geneticsserves clients in 50 states and 16 countries.

Investor Relations Contact:Ashley R. Robinson LifeSci Advisors, LLC Tel 617-430-7577Arr@lifesciadvisors.com

Media Contact:Jaime AbrusciRX Medical DynamicsTel 646-599-8606 jabrusci@rxmedyn.com

See the original post here:
Aspira Women's Health, Inc. Announces a Collaborative Agreement with Baylor Genetics for the Co-Development of an Ovarian Cancer Early-Detection Test...

Recommendation and review posted by Bethany Smith

At research pens in Chile researchers develop strains of farmed Atlantic salmon with improved traits such as growth and health.

By Erik StokstadNov. 19, 2020 , 2:00 PM

Two years ago, off the coast of Norway, the blue-hulled Ro Fjell pulled alongside Ocean Farm 1, a steel-netted pen the size of a city block. Attaching a heavy vacuum hose to the pen, the ships crew began to pump brawny adult salmon out of the water and into a tank below deck. Later, they offloaded the fish at a shore-based processing facility owned by SalMar, a major salmon aquaculture company.

The 2018 harvest marked the debut of the worlds largest offshore fish pen, 110 meters wide. SalMars landmark facility, which dwarfs the typical pens kept in calmer, coastal waters, can hold 1.5 million fishwith 22,000 sensors monitoring their environment and behaviorthat are ultimately shipped all over the world. The fish from Ocean Farm 1 were 10% larger than average, thanks to stable, favorable temperatures. And the deep water and strong currents meant they were free of parasitic sea lice.

Just a half-century ago, the trade in Atlantic salmon was a largely regional affair that relied solely on fish caught in the wild. Now, salmon farming has become a global business that generates $18 billion in annual sales. Breeding has been key to the aquaculture boom. Ocean Farm 1s silvery inhabitants grow roughly twice as fast as their wild ancestors and have been bred for disease resistance and other traits that make them well suited for farm life. Those improvements in salmon are just a start: Advances in genomics are poised to dramatically reshape aquaculture by helping improve a multitude of species and traits.

Genetic engineering has been slow to take hold in aquaculture; only one genetically modified species, a transgenic salmon, has been commercialized. But companies and research institutions are bolstering traditional breeding with genomic insights and tools such as gene chips, which speed the identification of fish and shellfish carrying desired traits. Top targets include increasing growth rates and resistance to disease and parasites. Breeders are also improving the hardiness of some species, which could help farmers adapt to a shifting climate. And many hope to enhance traits that please consumers, by breeding fish for higher quality fillets, eye-catching colors, or increased levels of nutrients. There is a paradigm shift in taking up new technologies that can more effectively improve complex traits, says Morten Rye, director of genetics at Benchmark Genetics, an aquaculture breeding company.

After years of breeding, Atlantic salmon grow faster and larger than their wild relatives.

Aquaculture breeders can tap a rich trove of genetic material; most fish and shellfish have seen little systematic genetic improvement for farming, compared with the selective breeding that chickens, cattle, and other domesticated animals have undergone. Theres a huge amount of genetic potential out there in aquaculture species thats yet to be realized, says geneticist Ross Houston of the Roslin Institute.

Amid the enthusiasm about aquacultures future, however, there are concerns. Its not clear, for example, whether consumers will accept fish and shellfish that have been altered using technologies that rewrite genes or move them between species. And some observers worry genomic breeding efforts are neglecting species important to feeding people in the developing world. Still, expectations are high. The technology is amazing, its advancing very quickly, the costs are coming down, says Ximing Guo, a geneticist at Rutgers University, New Brunswick. Everybody in the field is excited.

Fish farmingmay not have roots as old as agriculture, but it dates back millennia. By about 3500 years ago, Egyptians were raising gilt-head sea bream in a large lagoon. The Romans cultivated oysters. And carp have been grown and selectively bred in China for thousands of years. Few aquaculture species, however, saw systematic, scientific improvement until the 20th century.

One species that has received ample attention from breeders is Atlantic salmon, which commands relatively high prices. Farming began in the late 1960s, in Norway. Within 10 years, breeding had helped boost growth rates and harvest weight. Each new generation of fishit takes salmon 3 to 4 years to maturegrows 10% to 15% faster than its forebears. My colleagues in poultry can only dream of these kinds of percentages, says Robbert Blonk, director of aquaculture R&D at Hendrix Genetics, an animal breeding firm. During the 1990s, breeders also began to select for improved disease resistance, fillet quality, delayed sexual maturation (which boosts yields), and other traits.

Another success story involves tilapia, a large group of freshwater species that doesnt typically bring high prices but plays a key role in the developing world. An international research center in Malaysia, now known as WorldFish, began a breeding program in the 1980s that quickly doubled the growth rate of one commonly raised species, Nile tilapia. Breeders also improved its disease resistance, a task that continues because of the emergence of new pathogens, such as tilapia lake virus.

Genetically improved farmed tilapia was a revolution in terms of tilapia production, says Alexandre Hilsdorf, a fish geneticist at the University of Mogi das Cruzes in Brazil. China, a global leader in aquaculture production, has capitalized on the strain, building the worlds largest tilapia hatchery. It raises billions of young fish annually.

Now, aquaculture supplies nearly half of the fish and shellfish eaten worldwide (see chart, below), and production has been growing by nearly 4.5% annually over the past decadefaster than most sectors of the farmed food sector. That expansion has come with some collateral damage, including pollution from farm waste, heavy catches of wild fish to feed to penned salmon and other species, and the destruction of coastal wetlands to build shrimp ponds. Nevertheless, aquaculture is now poised for further acceleration, thanks in large part to genomics.

Aquaculture is rivaling catches from wild fisheries and is projected to increase. Much of the growth comes from freshwater fish in Asia, such as grass carp, yet most research has focused on Atlantic salmon and other high-value species. Genomic technology is now spreading to shrimp and tilapia.

(GRAPHIC) N. DESAI/SCIENCE; (DATA, TOP TO BOTTOM) FOOD AND AGRICULTURE ORGANIZATION OF HE UNITED NATIONS; HOUSTON et al., NATURE REVIEWS GENETICS 21, 389 (2020)

Breeders are most excited about a technique called genomic selection. To grasp why, it helps to understand how breeders normally improve aquaculture species. They start by crossing two parents and then, out of hundreds or thousands of their offspring, select individuals to test for traits they want to improve. Advanced programs make hundreds of crosses in each generation and choose from the best performing families for breeding. But some tests mean the animal cant later be used for breeding; measuring fillet quality is lethal, for instance, and screening for disease resistance means the infected individual must remain quarantined. As a result, when researchers identify a promising animal, they must pick a sibling to use for breedingand hope that it performs just as well. You dont know whether theyre the best of the family or the worst,says Dean Jerry, an aquaculture geneticist at James Cook University, Townsville, who works with breeders of shrimp, oysters, and fish.

With genomic selection, researchers can identify siblings with high-performance traits based on genetic markers. All they need is a small tissue samplesuch a clipping from a finthat can be pureed and analyzed. DNA arrays, which detect base-pair changes called single nucleotide polymorphisms (SNPs), allow breeders to thoroughly evaluate many siblings for multiple traits. If the pattern of SNPs suggests that an individual carries optimal alleles, it can be selected for further breeding even if it hasnt been tested. Genomic analyses also allow breeders to minimize inbreeding.

Cattle breeders pioneered genomic selection. Salmon breeders adopted it a few years ago, followed by those working with shrimp and tilapia. There is a big race from industry to implement this technology, says geneticist Jos Yez of the University of Chile, who adds that even small-scale producers are now interested in genetic improvement. As a rough average, the technique increases selection accuracy and the amount of genetic improvement by about 25%, Houston says. It and other tools are helping researchers pursue goals such as:

This trait improves the bottom line, allowing growers to produce more frequent and bigger hauls. Growth is highly heritable and easy to measure, so traditional breeding works well. But breeders have other tactics for boosting growth, including providing farmers with fish of a single sex. Male tilapia, for example, can grow significantly faster than females. Another strategy is to hybridize species. The dominant farmed catfish in the United States, a hybrid of a female channel catfish and a male blue catfish, grows faster and is hardier.

Inducing sterility stimulates growth, too, and has helped raise yields in shellfish, particularly oysters. In the 1990s, Guo and Standish Allen, now at the Virginia Institute of Marine Science, figured out a new way to create triploid oysters, which are infertile because they have an extra copy of each chromosome. These oysters dont devote much energy to reproduction, so they reach harvest size sooner, reducing exposure to disease. (When oysters reproduce, more than half their body consists of sperm or eggs, which no one wants to eat.)

Looking ahead, researchers are exploring gene transfer or gene editing to further enhance gains. And one U.S. company, AquaBounty, is just beginning to sell the worlds first transgenic food animal, an Atlantic salmon, that it claims is 70% more productive than standard farmed salmon. But the fish is controversial and has faced consumer resistance and regulatory hurdles.

Disease is often the biggest worry and expense for aquaculture operations. In shrimp, outbreaks can slash overall yield by up to 40% annually and can wipe out entire operations. Vaccines can prevent some diseases in fish, but not invertebrates, because their adaptive immune systems are less developed. So, for all species, resistant strains are highly desirable.

To improve disease resistance, researchers need a rigorous way to test animals. Thanks to a collaboration with fish pathologists at the U.S. Department of Agriculture (USDA), Benchmark Genetics was able to screen tilapia for susceptibility to two major bacterial diseases by delivering a precise dose of the pathogen and then measuring the response. They identified genetic markers correlated with infection and used genomic selection to help develop a more resistant strain. USDA scientists have also worked with Hendrix Genetics to increase the survival of trout exposed to a different bacterial pathogen from 30% to 80% in just three generations.

The fecundity of most aquatic species, like this trout (left), helps breeding efforts. Salmon eggs, 0.7 millimeters wide (right), are robust and easy for molecular biologists to work with.

Perhaps the most celebrated success has been in salmon. After researchers discovered a genetic marker for resistance to infectious pancreatic necrosis, companies quickly bred strains that can survive this deadly disease. Oyster breeders, meanwhile, have had success in developing strains resistant to a strain of herpes that devastated the industry in France, Australia, and New Zealand.

A big problem for Atlantic salmon growers is the sea louse. The tiny parasite clings to the salmons skin, inflicting wounds that damage or kill fish and make their flesh worthless. Between fish losses and the expense of controlling the parasites, lice cost growers more than $500 million a year in Norway alone. Lice are attracted to fish pens and can jump to wild salmon that pass by.

For years farmers have relied on pesticides to fight lice, but the parasite has become resistant to many chemicals. Other techniques, such as pumping salmon into heated water, which causes the lice to drop off, can stress the fish.

Researchers have found that some Atlantic salmon are better than others at resisting lice, and breeders have been trying to improve this trait. So far, theyve had modest success. Better understanding why several species of Pacific salmon are immune to certain lice could lead to progress. Scientists are exploring whether sea lice are attracted to certain chemicals released by Atlantic salmon; if so, its possible these could be modified with gene editing.

No sex on the farm. Thats a goal with many aquaculture species, because reproduction diverts energy from growth. Moreover, fertile fish that escape from aquaculture operations can cause problems for wild relatives. When wild fish breed with their domesticated cousins, for instance, the offspring are often less successful at reproducing.

Salmon can be sterilized by making them triploid, typically by pressurizing newly fertilized embryos in a steel tank when the chromosomes are replicating. But this can have side effects, such as greater susceptibility to disease. Anna Wargelius, a molecular physiologist at Norways Institute of Marine Research, and colleagues have instead altered the genes of Atlantic salmon to make them sterile, using the genome editor CRISPR to knock out a gene calleddeadend. In 2016, they showed that these fish, though healthy, lack germ cells and dont sexually mature. Now, theyre working on developing fertile broodstock that produce these sterile offspring for hatcheries. Embryos with the knocked-out genes should develop into fertile adults if injected with messenger RNA, according to a paper the group published last month inScientific Reports. When these fish mature later in December, they will try to breed them. It looks very promising, Wargelius says.

Another approach would not involve genetic modifications. Fish reproductive physiologists Yonathan Zohar and Ten-Tsao Wong of the University of Maryland, Baltimore County, are using small molecule drugs to disrupt early reproductive development so that fish mature without sperm or eggs.

Cooks and diners hate bones. Nearly half of the top species in aquaculture are species of carp or their relatives, which are notorious for the small bones that pack their flesh. These bones cant be easily removed during processing, so you cant just get a nice, clean fillet, says Benjamin Reading, a reproductive physiologist at North Carolina State University.

Researchers are studying the biology of these fillet bones to see whether they might one day be removed through breeding or genetic engineering. A few years ago, Hilsdorf heard that a Brazilian hatchery had discovered mutant brood stock of a giant Amazonian fish, the widely farmed tambaqui, that lacked these fillet bones. After trying and failing to breed a boneless strain, hes studying tissue samples from the mutants for clues to their genetics.

Geneticist Ze-Xia Gao of Huazhong Agricultural University is focusing on blunt snout bream, a carp that is farmed in China. Guided by five genetic markers, she and colleagues are breeding the bream to have few fillet bones. It could take 8 to 10 years to achieve, she says. They have also had some success with gene editingtheyve identified and knocked out two genes that control the presence of fillet bonesand they plan to try the approach in other carp species. I think it will be feasible, Gao says.

Aquaculture projects worldwide are hustling to domesticate new speciesa kind of gold rush rare in terrestrial farming. In New Zealand, researchers are domesticating native species because they are already adapted to local conditions. The New Zealand Institute for Plant and Food Research began to breed the Australasian snapper in 2004. Early work concentrated on simply getting the fish to survive and reproduce in a tank. One decade later, researchers started to breed for improved growth, and theyve since increased juvenile growth rates by 20% to 40%.

Genomic techniques have proved critical. Snapper are mass spawners, so it was hard for breeders to identify the parents of promising offspring, which is crucial for optimizing selection and avoiding inbreeding. DNA screening solved that problem, because the markers reveal ancestry. The institute is also breeding another local fish, the silver trevally, aiming for a strain that will reproduce in captivity without hormone implants. Its a long-term effort to breed a wild species to make it suitable for aquaculture, says Maren Wellenreuther, an evolutionary geneticist at the New Zealand institute and the University of Auckland.

These breeding effortsrequire money. Despite the growth of aquaculture, the fields research funding lags the amounts invested in livestock, although some governments are boosting investments.

Looking globally, geneticist Dennis Hedgecock of Pacific Hybreed, a small U.S. company that is developing hybrid oysters, sees a huge disparity between breeding investment in developed countrieswhich produce a fraction of total harvests but have the biggest research budgetsand the rest of the world. Simply applying classical breeding techniques could rapidly improve production, especially in the developing world, he says. Yet the hundreds of species now farmed could overwhelm breeding programs, especially those aimed at enhancing disease resistance, Hedgecock adds. The growth and the production is outstripping the scientific capability of dealing with the diseases, he says, adding that a focus on fewer species would be beneficial.

For genomics to help, experts say costs must continue to come down. One promising development in SNP arrays, they note, is a technique called imputation, in which cheaper arrays that search for fewer genetic changes are combined with a handful of higher cost chips that probe the genome in more detail. Such developments suggest genomic technology is at a pivot point where youre going to see it used broadly in aquaculture, says John Buchanan, president of the Center for Aquaculture Technologies, a contract research organization.

Many companies are already planning for larger harvests. SalMar will decide next year whether it will order a companion to Ocean Farm 1. It has already drawn up plans for a successor that can operate in the open ocean and would be more than twice the size, big enough to hold 3 million to 5 million salmon at a time.

Read more:
New genetic tools will deliver improved farmed fish, oysters, and shrimp. Here's what to expect - Science Magazine

Recommendation and review posted by Bethany Smith

McBride came to the U of O for their undergraduate degree. Image: Trent Dilkie/Provided

Former University of Ottawa student Rachel McBride has been a professional triathlete for 10 years and has already established themselves as a force in the sports world.

A three time Ironman 70.3 champion, they won their first half Ironman triathlon at 32, they are a two time Ironman bike course record holder, a Canadian national champion and the seventh female over the age of 42 who qualified for KONA.

In 2019, they came in first at the Cascade Gravel Grinder and the Fort Langley 1K. In 2020, McBride came second in the Burnt Bridge Gravel Classic, losing by only 24 seconds. They came in third in the Canadian Tri Pro Championship earlier this year. They also hold two university degrees and are an accomplished cellist.

Growing up, McBride moved around a lot: from Tacoma, Wash. to Germany before they came to the U of O for their undergraduate degree.

I was a shy kid but was quite physically active even at a young age, said McBride in an email statement.

It was at the U of O where they discovered their love of biology and research. McBride ended up working for a research lab in Germany before deciding to pursue their masters in developmental genetics. They eventually found their way to their dream career as a genetic counsellor.

While they were physically active as a child, McBride dropped most sports to focus more on their creative and artistic side instead.

I got more and more into punk, goth and riot grrrl music and began expressing myself creatively through clothing, hairstyles and other art mediums like music, photos, poetry and paintings, they said.

After moving to Toronto, McBride began getting heavily involved in the music and arts scene in the city which resulted in them partying a lot and never getting more than [four to five] hours of sleep a night. Before their shift to a healthier lifestyle, McBride struggled with an eating disorder, as well as being a drinker and smoker. It wasnt until they turned 27 that they decided something had to change.

They ran their first marathon in 2005 and recognized the need to start prioritizing their health and wellbeing.

I did really well in that race so well that I qualified for the Boston Marathon and my mentor at the time suggested I could be an elite triathlete. Even though I was bordering on too old, I realized if I wanted to pursue this professionally, I would need to start taking my body, health and athletic career more seriously, they said.

A major lifestyle change McBride made was adapting a predominantly plant-based lifestyle, which has had a substantial impact on their physical and mental well-being.

Over the past decade Ive learned so much about my body becoming plant-based has had profound impacts on my wellbeing and I would say its been a prominent factor in my success as an athlete.

Turning towards a plant-based lifestyle has allowed McBride to solve digestion issues that they were not able to tackle before, saying growing up I didnt have a good handle on what my body needed to thrive.

McBride is also identifies as non-binary, a gender identity in which an individual does not identify exclusively as male or female.

Identity and authenticity are topics that are incredibly important to me and Im proud that Ive been able to be involved in modernizing the world of sport whether through having a voice in the conversation around gender in sport, or even around dietary practices as a plant-based athlete, said McBride.

McBride continues to share their story and is grateful for the fact that they have this platform and are able to inspire others. They are passionate about sports becoming more inclusive and inspiring others to be true to who they are and be proud of it.

Be yourself and be proud. Be confident that you, too, have a right to be recognized and celebrated in whatever endeavors you commit yourself to, they said.

At 42, Im fitter and faster than ever. Age is truly just a number.

Visit link:
Fitter and Faster: U of O alum Rachel McBride is breaking through barriers and championships - The Fulcrum

Recommendation and review posted by Bethany Smith

INNOVATIVE livestock farmers in Easter Ross are setting the scene for their first online breeding cattle sale in January 2021.

The Scott family at Fearn Farm, in Easter Ross, aim to follow the success of their yourbid ram sale in August, which proved an ideal solution given the current uncertainties regarding Covid-19 restrictions.

John Scott explained: At Fearn, we strive to produce high health top quality stock from forage-based diets. Our new online sale allows us to sell stock direct from farm, putting minimal stress on the animals and our staff. It will also allow buyers across the UK and further afield the opportunity to purchase stock from their farm office, tractor seat, or in person on-farm subject to government guidelines, and where social distancing measures will be adhered to."

The yourbid system was developed by David and George Giddings of Meadowslea Genetics, New Zealand. They integrated an online bidding option for their stud Angus female sale earlier this year while New Zealand was in lockdown. After seeing the success of the sale, Fearn Farm teamed up with the McGowan family of Incheoch, Blairgowrie to bring the Helmsman style online auction system to the UK for the first time in summer.

We first used yourbid earlier this year for our on-farm ram sale and found it worked really well for our system. Like a silent auction, all lots are offered for sale at the same time, said Mr Scott.The main difference is the online sale will only come to an end when there are no further bids on any lot.

Forty-two animals will be offered for sale with videos of the cattle and a detailed catalogue including performance figures, genetics and weights available from next month.

Mr Scott said: This is an exciting time for us as a business, we believe in our product and are delighted that we can use this platform once again in the UK, giving farmers and crofters the opportunity to buy the genetics they need to drive their herds forward in uncertain times.

The family currently run 100 pedigree Shorthorn cows under the Fearn prefix which was founded in 1995. John explains how the upcoming sale will give buyers the chance to purchase stock with genetics linking to some highly sought bloodlines.

Added Mr Scott: We have several bull and heifer lots sired by Fearn Godfather, who was originally sold for 10,000gns, then bought back three years later at auction for 20,000gns.

He is one of the highest performance recorded animals in the breed and is a trait leader for calving ease; 200, 400- and 600-day weights; carcass weight and rib fat.

Other sires include Fearn Elmer - who needs no introduction - with sons selling privately to 10,000gns, averaging over 5,000 for 25 sold to date and his daughters are breeding extremely well within the herd.

He is possibly the easiest fleshing bull that we have bred at Fearn, with one of his sons likely to be retained for our own use next year.

The Luing offering will see bulls and bulling heifers available from the 50-cow Scotsburn herd which is managed by the Scott family through a contract farming agreement, as well as progeny from the 50-cow Sutherland herd which is run by Scott Farming Co. Both these herds have been founded on the Cadzow Bros Luing genetics.

Mr Scott said: All of the cattle for sale have been produced on grass and forage-based diets. Stock are part of Johnes level 1 and BVD accredited herds and have been double vaccinated for BVD, with the heifers also vaccinated for Lepto. All bulls forward will be semen tested prior to the sale.

The sale will go live on January 12 and run until January 22.Potential buyers can visit the farm to view stock by arranging an appointment.

Prospective buyers can also pre-register to visit the farm on the final day of bidding and will be able to view a large screen where they can bid, using either a smart phone or bidding slips.

Mr Scott added: Bidding will be up and running online for ten days before the sale, but things should get interesting in the last hour or so on sale day.We expect that Covid-19 will encourage most bidders to operate from home but wanted to make it possible for those who want to be here to do so.

Related: Online sale hits the spot in Easter Ross with bids from Cornwall to Shetland

Fearn Farm hooks up with New Zealand firm to trailblaze new bidding system during Covid-19 crisis

Get a digital copy of the Northern Times delivered straight to your inbox every week and read the full newspaper on your desktop, phone or laptop.

Read more:
Fearn farming family to run first online breeding cattle sale at turn of year - Northern Times

Recommendation and review posted by Bethany Smith

A long-standing puzzle in evolution is why new genes ones that seem to arise out of nowhere can quickly take over functions essential for an organisms survival.

A new study in fruit flies may help solve that puzzle. It shows that some new genes quickly become crucial because they regulate a type of DNA called heterochromatin. Once considered junk DNA, heterochromatin actually performs many important jobs, including acting like a tightly guarded prison: It locks up bad actor genes, preventing them from turning on and doing damage.

Heterochromatin is also one of the fastest-changing bits of DNA in the body, so the genes that regulate it have to adapt quickly just to keep up, evolutionary biologist Harmit Malik at the Fred Hutchinson Cancer Research Center in Seattle and his colleagues report online November 10 in eLife.

The work is a milestone, said Manyuan Long, an evolutionary biologist at the University of Chicago who was not involved in the research. It is really amazing seeing such an important role the heterochromatin plays in gene evolution.

Headlines and summaries of the latest Science News articles, delivered to your inbox

Scientists have documented many cases of genes that seem to arise from scratch and give an organism a new ability. For instance, one such gene in fish makes a novel antifreeze protein; another in flies is essential for flight.

About a decade ago, researchers discovered that new genes dont just confer new functions; some may actually be necessary for survival. In the fruit fly Drosophila melanogaster, as many as 30 percent of new genes are essential, with some arising as recently as 3 million years ago a flash in evolutionary timescales. The discovery overturned a long-held belief that important genes dont really change much over the course of evolution.

Maliks team investigated a large family of genes in fruit flies that regulate other genes turning them on and off for various tasks in the cell. It found that within the family of 85 or so genes, the genes that were evolving more rapidly were more likely to control essential functions for the fly. In fact, 67 percent of rapidly evolving genes were essential compared with 20 percent in the slower-evolving group.

The dogma is completely opposite than what you would expect, said Malik.

The team found that one of the new essential genes, dubbed Nicknack, issues instructions for a protein that binds to heterochromatin, although the details remain unknown.

To see how quickly Nicknack might have taken over an essential function, the researchers replaced the Nicknack gene in D. melanogaster with the Nicknack gene in its closest evolutionary relative, D. simulans. The two species of flies split into two branches of the fruit fly tree roughly 2.5 million years ago. Scientists would typically expect the Nicknack gene of S. simulans to be basically the same as the one in D. melanogaster,because it is essential and therefore wouldnt have changed much over the short span (in evolutionary terms) of a couple million years.

They tested this theory by swapping the gene from D. simulans into the D. melanogaster fly, expecting that if the genes were the same, the trade would have no effect. But instead, the female flies survived the swap just fine, but all the males died. Malik thinks the difference between the sexes has to do with heterochromatin: The Y chromosome contains a lot of it.

Its as if [D.] simulans [Nicknack gene] comes in with its hand tied behind its back, Malik says. Its good enough to do its function in female flies, but in male flies, where there is a huge block of heterochromatin, it cant. In other words, the gene from one species is no match for its counterpart in the other.

The result suggests that in the 2.5 million years since the two species split, D. melanogaster evolved its own version of Nicknack. And because the swap adversely affected the males, with their abundance of heterochromatin in the Y chromosome, the researchers concluded that Nicknack must play some crucial role in regulating heterochromatin. And since heterochromatin evolves so rapidly, the Nicknack gene has to evolve rapidly too, so it doesnt become obsolete.

Next, Malik hopes to do more studies to understand the exact function of Nicknack. That may help shed light on heterochromatins role in shaping the speed and course of evolution. Scientists, he says, are just at the beginning of understanding the many ways this junk DNA is anything but junk.

Read more from the original source:
A key to the mystery of fast-evolving genes was found in junk DNA - Science News

Recommendation and review posted by Bethany Smith

Irene Blat, a senior director at Genuity Science, discusses how the intersection of data, engineering, genetics and more will be crucial to the future of healthcare.

The future of healthcare will need the right mix of skills and cross-disciplinary collaboration. Irene Blat, senior director of data products and analytics at Genuity Science, is particularly familiar with that. Throughout her career, she has worked with clinicians, geneticists, software engineers and more to drive progress in genomics.

Here, she discusses her passion for problem solving and why mentors have been crucial to her journey.

One of the biggest surprises has been realising the value of collaborative teamwork in tackling these different spaces IRENE BLAT

I have had a passion for life sciences since my early years. I loved experimenting in science class and being able to test, learn and improve. What really solidified my path into life sciences was an undergraduate experience I had working in an immunology lab. We would modify genetic sequences to better understand how immune cells were able to adapt their responses depending on the invaders they were fighting.

The way we measured the response was by looking at thousands of cells with a laser to see how the markers they expressed on their surface had changed based on the genetic changes to their sequence. This generated a lot of data that we then had to analyse.

One of the best aspects of experimenting was recording the data and then looking for and identifying patterns. The thrill of gaining insights into one more piece of the puzzle was what really drove me to continue my career in exploring genetics to better understand and potentially treat diseases.

My interest in genetics was what led me to my first job working at the Broad Institute in Cambridge, Massachusetts. At the time, it was an early data revolution in the life sciences where the human genome had just been sequenced a few years earlier and we were learning a wealth of information about healthy and disease states.

My role was to generate thousands of gene expression profiles of cells that had been treated with different drugs and then look for patterns in the cells responses to the drugs. We were looking for ways to link these genetic patterns to diseases to match them to a potential therapeutic compound. Here, I learned that the human cell is a very complex system and requires combing through lots of data to better understand how all the subtle changes in a cell work together to produce altered states.

Working with these large datasets put me on a path to look for opportunities where I could leverage the power of data to better understand complex biological systems.

For me, my career path has not been linear. I have taken risks and explored new opportunities to expand my experience where I could be impactful. Since joining Genuity, I have been fortunate to contribute to the R&D, product management and commercial aspects of the business with, at times, steep learning curves that have taken me out of my comfort zone.

What I have learned about myself is that I enjoy the challenge of learning something new and being able to leverage previous experiences to bring an original perspective to the company needs. While the subject matter might change, the concepts and learnings are still applicable across the organisation.

One of the biggest surprises has been realising the value of collaborative teamwork in tackling these different spaces. In graduate school, my work was focused on a very specific topic and in my career Ive been hired into very specific roles. But what has enabled me to move between different fields has really been collaborating and learning from other people.

Ive learned not to be afraid to ask questions and really take the opportunity to learn from others in the field. Then I have to take time to synthesise all these learnings to put forward a hypothesis that I can share with my colleagues for feedback and input. Basically, its a team effort and the more diverse the team the better the ideas.

I have had the good fortune of having many outstanding mentors throughout my career who see potential in me through my work ethic and dedication. I am grateful for having mentors who have encouraged me to take on bigger risks by giving me their vote of confidence. In particular, I have had strong female mentors who are excellent leaders and have leaned in throughout their careers.

Being able to learn from their experiences and listening to their guidance has been valuable in helping me decide where to go next in my career. The best mentors are the ones that give the gift of their time and my career has been shaped by the time of several great mentors in my life.

I really enjoy problem solving. In this role, I spend a lot of time thinking of creative ways to solve new problems. I also enjoy working through these problems in collaboration with our talented team. I have a deep appreciation for the value of sharing ideas and approaches with others from different backgrounds.

At Genuity Science, I have worked in teams with clinicians, geneticists, software engineers, bioinformaticians and data scientists who each bring their own expertise to the table. These types of cross-functional teams enable problem solving in a way that would not be possible if we all worked in silos.

What is even more exciting is that our team grows when we engage in collaborations with our customers. Our customers bring strong experiences in drug development that nicely complement our internal expertise in genomics discovery to help advance new therapies to the clinic. There are so many people to learn from both internal and external to our organisation and thats what makes my job exciting Im always learning!

I am a passionate learner. As I look back on how I landed at Genuity Science, the common thread is that every role I have had provided me the opportunity to learn. In this role, we are working at the cutting edge of how to analyse large clinical and genomic datasets. We have to iterate and adapt our analytical tools to solve increasingly complex biological problems.

My flexibility in adapting with the needs of the problem has also helped me in looking at problems in different ways. Since my early days in the lab, I recognised I had a lot of perseverance and grit. Sometimes you have to try multiple approaches before you find a path forward, but it is incredibly rewarding when you gain a new insight into a problem that was unsolved. Thats what keeps me motivated to continue trying.

At Genuity Science, the leadership team has encouraged me to explore the commercial boundaries which are well outside my original scientific training. Being able to inform commercial engagements with my deep scientific understanding has significantly broadened my skillset and resulted in exciting partnerships for the company.

Genuity has supported me in attending trainings and conferences where I was able to learn more about the commercial space as well as gain the opportunity to observe others in action. This has been a great development opportunity for me.

If you enjoy a challenge and like to learn, then a career in data analytics will not disappoint you. You have to be willing to take risks and fail but also learn from the failures and apply the lessons to the next challenge. The greatest reward is seeing how this work can ultimately have an impact on patient lives.

Excerpt from:
The role of a data-analytics director in genomic discovery - Siliconrepublic.com

Recommendation and review posted by Bethany Smith

WRAL TechWire keeps tabs on the latest and greatest meetups, panels, workshops, conferences, application deadlines and all things happening in the North Carolina startup/tech world. The Headliners is a multi-part weekly roundup of upcoming events to add to your calendar.

Following is a list of November events in Raleigh, Durham, Chapel Hill and the greater Triangle area. To find out whats happening this month in cities outside of the Triangle, check out part two of the Headliners column. Another post highlights December events. Meetups that occur regularly are listed here.

If youd like your event to be included, feel free to send me an email.

Also, check out a full range of events on TechWires interactive calendar, along with our comprehensive resource guide for startups in the Triangle.

Note: The following list is our lineup of Triangle events through the end of Novembermost have been switched to a virtual format due to COVID-19 social distancing requirements.

NC State Entrepreneurship is hosting a virtual open house every Monday to meet with students and answer any questions they have about entrepreneurship and launching a venture at NC State University.

This years Gig East Digital Summit will include talks and panels featuring both local and national leaders in innovation, business, entrepreneurship and arts. The event will premiere on YouTube in three parts, on November 16, November 18 and November 20.

This online forum will cover how animal models can offer useful insights into the vaccine development pathway.

Raleigh Chambers monthly virtual Business After Hours is an opportunity for people to make connections and build business relationships.

Wake Tech Community Colleges Contractors Academy is an eight-week training program designed for minority and women-owned small businesses in Wake County interested in pursuing contracting opportunities with state and local government. Applications are open now.

NC IDEAs second annual Entrepreneurial Ecosystem Summit will feature keynotes and breakout sessions with both local and national experts, leaders and entrepreneurs. Discussions will center around how North Carolinas entrepreneurial ecosystem can shift priorities amid new economic challenges. More TechWire coverage here.

This half-day virtual conference will feature keynotes and breakout sessions about leadership development, advocacy, mentorship and personal wellness for women in the workplace.

In this online event, Raleigh Chamber will host executives from major healthcare systems for discussions on the future of healthcare in Raleigh and its impact on the local economy.

Launch Chapel Hill is hosting a discussion on workplace inclusion, led by Pacific Western Bank Senior Vice President of Diversity & Inclusion Dee McDougal.

In this five-week virtual course, participants will craft and implement a sales plan that guides them through the process of bringing a product or service to market.

In this live Q&A session, TheeDigitals experts will answer common questions about a range of ecommerce topics, such as improving sales, couponing, payment gateways, and more.

The North Carolina Sustainable Energy Association is hosting a monthly webinar serieswith local and national experts covering clean energy trends.

Join the Code for Chapel Hill meetup to network with like-minded individuals and work on civic hacking projects. Meetings are held every two weeks on Tuesdays.

This webinar, hosted by the Wake Tech Small Business Center, will show participants how to engage customers and increase sales through email marketing.

NC TECHs annual awards program honors top leaders and companies in North Carolinas tech sector. This years event will be a three-day, virtual occasion.

1 Million Cups, presented by Kauffman, is a weekly informal pitch event for the startup community. Join for free coffee and entrepreneurial support as local startups deliver their presentations.

The Council for Entrepreneurial Development (CED) is hosting a virtual fireside chat with Pendo Founder Todd Olson and The Profile Founder Polina Marinova.

In this webinar, small businesses will learn about their sales and use tax obligations and how to prepare tax returns.

In this virtual event, RTPs Sustainability Team will host Leigh-Kathryn Bonner of BeeDowntown for a discussion on the importance of protecting bees, the hive management process and BeeDowntowns offerings. A Q&A session will follow.

In this webinar, small business attorney Kristy Cook of Mod Law Firm will present the basics of contract law, including the types of contracts common to small businesses, contract breaches, negotiation strategies, and more.

In this virtual lunch and learn, Cherry Bekaert Principal Bryce Gartner will discuss the process of applying a data-centric approach to operations and supply chain management.

This years Gig East Digital Summit will include talks and panels featuring both local and national leaders in innovation, business, entrepreneurship and arts. The event will premiere on YouTube in three parts, on November 16, November 18 and November 20.

The fourth annual event of its kind, the 2020 Sustainable Fleet Technology Conference will feature the latest trends and tech in sustainable fleet operations and implementation. This years program will be presented in a series of 12 webinar sessions, held from July to December. See the list of dates here.

This year, The Launch Place is hosting a lite version of its annual Big Launch Challenge pitch competition. Ten startups will pitch to a panel of five investors representing groups across the U.S.

Duke Applied Machine Learning (DAML) is accepting applications for the inaugural cohort of its new student-run tech incubator, Innovation Studio.

This virtual event will feature an interactive discussion with Raleigh Chamber CEO Adrienne Cole and Raleigh Chamber Young Professionals Network Chair Ashley Stallings.

This virtual conference will focus on rural women health workers, global leaders, artists, students and policymakers, and the effort to engage rural women in building sustainable health systems.

The Regional Transportation Alliances 19th annual meeting will cover new and potential transportation investments and innovative ideas for mobility and prosperity.

The Diversity Movement is hosting a free online event to share tips on how to have difficult, but civil conversations with relatives about current events over the holidays.

In this event, a panel of Momentum code school graduate moms will discuss their careers as software developers.

Cary Chambers next Business of Women event will feature Momentum Learning Co-founder and CEO Jessica Mitsch. Attendees can join the event in person at a limited capacity with safety precautions in place; those who would prefer to attend virtually can tune in online.

NCBIO is hosting a panel discussion focused on COVID-19s impact on the clinical trial process, as trials are successfully going virtual.

In this six-week course hosted by UNC-Chapel Hills Entrepreneurship Center, participants will learn ways to scale their companies by building practical plans for revenue, product, staffing, leadership and capital.

The City of Raleigh is hosting monthly virtual workshops on the benefits of the HUB (Historically Underutilized Business) and DBE (Disadvantaged Business Enterprise) certification programs.

xElle Ventures is hosting a pitch competition featuring female founders from universities around the RTP area.

This months virtual RTP180 event will feature five experts on genetics discussing related topics such as newborn check screenings, genome editing, applications in developing worlds, and more.

Raleigh SCORE is hosting a virtual workshop covering both sides of buying and selling a businessand all of the processes involved with both.

This free bi-monthly event offers a space for local tech professionals to build connections and find potential job opportunities.

DHITs Frequency Webinar Series features executives and thought leaders from healthcare, life sciences, social sciences, technology and innovation to discuss the latest trends, opportunities and challenges in digital health. Episodes are released through a series of bi-weekly virtual events.

The spring 2021 RIoT Accelerator Program (RAP) cohort will run from February 17 to May 5 in Wilson. Join this information session to learn more about the 12-week program and how to apply. Applications are due on December 21.

This years Gig East Digital Summit will include talks and panels featuring both local and national leaders in innovation, business, entrepreneurship and arts. The event will premiere on YouTube in three parts, on November 16, November 18 and November 20.

This weekly meetup brings together developers, IT professionals and tech enthusiasts who are interested in the Google Cloud Platform.

NC State Entrepreneurship is hosting a virtual open house every Monday to meet with students and answer any questions they have about entrepreneurship and launching a venture at NC State University.

Launch Chapel Hill, a startup incubator located in downtown Chapel Hill, is accepting applications for its new Launch Microgrant Fund, which provides $1,000 in equity-free funding to alumni companies at any stage.

Raleigh Chamber is hosting a discussion with Lindsay Rice, owner of Vita Vite, who will share how she and her team are navigating the pandemic.

Bring your ideas and opinions to the next Midtown Techies meetup. Events are held on the last Tuesday of every month.

Code for Durham brings together technologists, designers, developers, data scientists, map makers and activists to collaborate on civic technology projects. Meetings are held every two weeks on Tuesdays.

1 Million Cups, presented by Kauffman, is a weekly informal pitch event for the startup community. Join for free coffee and entrepreneurial support as local startups deliver their presentations.

This weekly meetup brings together developers, IT professionals and tech enthusiasts who are interested in the Google Cloud Platform.

NC State Entrepreneurship is hosting a virtual open house every Monday to meet with students and answer any questions they have about entrepreneurship and launching a venture at NC State University.

Read the original post:
Triangle headliners: Previewing 50 webinars & events coming up rest of this month - WRAL Tech Wire

Recommendation and review posted by Bethany Smith

Women who experience early menopause may be more likely to face an early onset of progressive multiple sclerosis (MS). That is the finding of a Mayo Clinic study recently published in Brain Communications.

Researchers also discovered that the fewer pregnancies a woman had, the more likely an earlier onset of progressive MS. These results highlight the key role sex hormones may play for women with MS.

It is already well-known that multiple sclerosis affects men and women differently. Women are two to three times more likely to be diagnosed with MS, an autoimmune disease in which the body's immune system attacks the protective sheath that covers nerve cells in the brain and spinal cord. Researchers previously had discovered that women are more likely to developing the relapsing-remitting phase of multiple sclerosis at an earlier age than men, and women have more frequent relapses than men. Meanwhile, men's symptoms tend to worsen faster than women, causing them to enter the progressive phase of the disease more quickly.

Delaying the onset of the progressive phase of MS is important in helping prevent or limit severe disability in the future. That is one of the reasons Mayo Clinic researchers wanted to understand the role women's reproductive histories could play in delaying the onset of progressive MS, says Dr. Burcu Zeydan, a Mayo Clinic researcher and the study's lead author.

The study compared the cases of 137 postmenopausal women with MS seen at Mayo Clinic to 396 postmenopausal women without MS. To identify participants without MS, the researchers relied on the Rochester Epidemiology Project, a unique medical records linkage system, to gather the necessary patient data. They found that women who underwent menopause before 46 were more likely to experience an early onset of progressive MS. Meanwhile, pregnancies appeared to have a positive effect when it came to delaying progressive MS.

"There seems to be an association between the number of pregnancies and the onset of progressive MS," Zeydan says. "The higher the number of pregnancies, the later the progressive MS onset."

That is good news for women with MS who may have avoided pregnancy due to concerns about negatively affecting the disease's progression. Indeed, it is the opposite.

Regarding their findings on the association between menopause and progression, Zeydan cautions that more research is needed to truly understand the potential benefits of perimenopausal hormone therapy. But for patients with MS who are already mulling hormone therapy, this study is worth considering.

"Our findings would be another reason to encourage patients to use hormone therapy," Zeydan says.

Continued here:
Earlier menopause, fewer pregnancies linked to early onset of progressive MS - West Central Tribune

Recommendation and review posted by Bethany Smith

Are you sick and tired of feeling sick and tired? Are you gaining weight without any major diet changes, feeling sluggish, depressed, constipated, weak and aching muscles, dry skin and cant get the heat into you no matter how warm the weather is?

If the answer is yes then it might be worth visiting your GP to get your thyroid checked as you may be suffering from an underactive thyroid know as hypothyroidism.

Hypothyroidism is a condition in which the body doesnt make enough of the thyroid hormone thyroxine. Thyroid hormones help control growth, cell repair, and metabolism.

As a result, people with hypothyroidism may experience the symptoms above, among many others. However many of the symptoms can easily be confused for other conditions and as the symptoms generally appear slowly, sometimes over many years, you may just think your symptoms are a result of growing older.

If hypothyroidism is left untreated more serious symptoms may start to appear, such as a change in voice (hoarseness) a slow heart rate, anaemia and hearing loss to name a few.

Diet and nutrition alone wont cure hypothyroidism and medication alone may not restore your health and energy fully. However, a combination of the right nutrients and medication can help restore thyroid function and minimise your symptoms.

What exactly is hypothyroidism?

The thyroid gland is a small, butterfly-shaped gland that sits near the base of your neck and it makes and stores thyroid hormones that affect nearly every cell in your body.

When thyroid levels are low the thyroid gland receives a signal from the pituitary gland, called thyroid-stimulating hormone (TSH), it then releases thyroid hormones into the bloodstream.

Occasionally, the thyroid gland doesnt release thyroid hormones, even when there is plenty of TSH. This is called primary hypothyroidism and the most common type.

When the pituitary gland is not working properly, the thyroid gland does not receive enough thyroid stimulating hormone in order to make hormones. This is called secondary hypothyroidism.

The thyroid gland may be very small but thyroid hormones are very important. They help control growth, cell repair, and metabolism, this is the process by which your body converts what you eat into energy.

Your metabolism affects your body temperature and at what rate you burn calories. Thats why people with hypothyroidism often feel cold and tired and may gain weight easily and find it hard to lose weight no matter how hard they try.

How does hypothyroidism affect your metabolism?

The thyroid hormone helps control the speed of your metabolism. The faster your metabolism, the more calories your body burns at rest. So as people with hypothyroidism make less thyroid hormone, the result of this is they have a slower metabolism and burn fewer calories at rest.

Having a slow metabolism comes with several health risks. Low levels of thyroid producing hormones, such as T3 and T4, can change the way the body processes fat.

This can lead to high cholesterol and clogging of the arteries, both of which can potentially lead to serious heart related problems.

If you find it difficult to maintain your weight with hypothyroidism, try doing moderate or high intensity cardio.

Which nutrients are important for thyroid health?

Several nutrients are important for optimal thyroid health.

Iodine

Iodine is an essential mineral thats needed to make thyroid hormones. Therefore, people with iodine deficiency might be at risk of hypothyroidism. consider adding iodized salt to your meals or eating more iodine rich foods like seaweed, fish, dairy, and eggs.

Selenium

Selenium helps activate thyroid hormones so they can be used by the body. This essential mineral also has antioxidant benefits, which means it may protect the thyroid gland from damage by molecules called free radicals. Adding selenium rich foods to your diet is a great way to boost your selenium levels. This includes Brazil nuts, tuna, sardines, eggs, and legumes.

Zinc

Like selenium, zinc helps the body activate thyroid hormones. It has been shown that zinc may help the body regulate TSH, the hormone that tells the thyroid gland to release thyroid hormones. Although zinc deficiencies are rare, if you have hypothyroidism, you should aim to eat more zinc rich foods like oysters and other shellfish, beef, and chicken.

Foods to avoid

Foods that contain goitrogens should be eaten in moderation and ideally cooked first.

You should also avoid eating highly processed foods, as they usually contain a lot of calories, sugar and trans-fats. This can be a problem if you have hypothyroidism, as you may gain weight easily and a diet high in processed foods may lead to fatigue.

Here is a list of foods you can eat in moderation. These foods contain goitrogens or are known irritants if consumed in large amounts.

* soy-based foods:tofu, tempeh edamame beans, soy milk, etc.

* cruciferous vegetables:broccoli, kale, spinach, cabbage, etc.

* certain fruits:peaches, pears, and strawberries

* beverages:coffee, green tea, and alcohol these beverages may irritate your thyroid gland

Foods to eat

There are plenty of food options for people with hypothyroidism, including:

* eggs:whole eggs are best, as much of their iodine and selenium are found in the yolk, while the whites are full of protein

* meat:all meats, including lamb, beef, chicken, etc.

* fish:all seafood, including salmon, tuna, halibut, etc.

* vegetables:all vegetables cruciferous vegetables are fine to eat in moderate amounts, especially when cooked

* fruits:all other fruits, including berries, bananas, tomatoes, etc.

* gluten-free grains and seeds:rice, buckwheat, quinoa, chia seeds, and flax seeds

* dairy:all dairy products,

* beverages:water and other non-caffeinated beverages

People with hypothyroidism should aim to eat a balanced diet based around vegetables, fruits, and lean meats.

If you think you have symptoms of an underactive thyroid, your first port of call would be to make an appointment with your GP to have a thyroid blood test done.

If you have an underactive thyroid and need support around dietary changes, why not schedule in an appointment with The Nutri Coach! There is no time like the present My clinic is back open and I am taking bookings for new and existing clients, so just pop me a message if you would like to schedule an appointment. contact details below.

Debbie Devane from The Nutri Coach is a qualified Nutritional Therapist and health & lifestyle coach, Debbie runs her clinic from the Glenard Clinic in Mountmellick and also offers one to one and group online consultations. Debbie is also Nutritionist to the Offaly GAA senior footballers.

For more information or to make an appointment email Debbie at

info@thenutricoach.ie

Ph: 086-1720055

Facebook: The Nutri Coach @debbiedevanethenutricoach

Instagram: the_nutricoach

For more information go to http://www.thenutricoach.ie

See the rest here:
Healthy Living: Are you sick and tired of feeling sick and tired? - Leinster Leader

Recommendation and review posted by Bethany Smith

I think for sheer exuberance the best day of my life was my last on Everest, she wrote in Conundrum. The mountain had been climbed, and I had already begun my race down the glacier toward Katmandu, leaving the expedition to pack its gear behind me.

She continued: I heard from the radio that my news had reached London providentially on the eve of Queen Elizabeths coronation. I felt as though I had been crowned myself. For a Britain that was fast losing its empire, the conquest of Everest was greeted with nationalistic euphoria.

As a correspondent with The Times and later with The Guardian, Ms. Morris wrote about wars, famines and earthquakes and reported on the trial in Israel of Adolph Eichmann, the Nazi war criminal who was convicted and executed for his leading role in the extermination of millions of Jews.

She also covered the trial in Moscow of Francis Gary Powers, the United States spy plane pilot who was shot down over the Soviet Union. She traveled to Havana to interview Che Guevara, the revolutionary leader, who was described in Conundrum as sharp as a cat, and to Moscow again to meet with the British intelligence defector Guy Burgess, who was swollen with drink and self-reproach.

It was in the early 1960s that Ms. Morris met with a prominent New York endocrinologist, Dr. Harry Benjamin, an early researcher on transgender people.

He advised her on a slow process of transition that began with heavy doses of female hormones some 12,000 pills from 1964 to 1972, according to the writers own calculations. Ms. Morris wrote, I was about to change my form and apparency my status, too, perhaps my place among my peers, my attitudes no doubt, the reactions I would evoke, my reputation, my manner of life, my prospects, my emotions, possibly my abilities.

From the very beginning of her marriage, Ms. Morris had confided her feelings about her gender identity to her wife, Elizabeth Tuckniss, the daughter of a tea planter.

Continue reading here:
Jan Morris, Celebrated Writer of Place and History, Is Dead at 94 - The New York Times

Recommendation and review posted by Bethany Smith

The abortion pill is a simple way to end a pregnancy up to 11 weeks after the first day of your last period.

You can usually carry out part of the procedure at home, which can be more comfortable for some people.

But that can lead to anxiety about whether the pill has worked.

Although a follow-up appointment is the best way to get reassurance, there are a number of signs to look out for that point to abortion pill success.

Most people experience cramping and bleeding within a few hours of taking the second pill, misoprostol.

This is a good indicator that the abortion pill has worked.

Bleeding, or the passing of large blood clots, shows that the fetal tissue is exiting the body. Cramping helps the uterus return to its usual state.

Your healthcare provider will also schedule a follow-up appointment a couple of weeks later to check that the abortion pill worked.

The abortion pill comes in two separate doses. The process usually takes 1 to 2 days to complete.

You may experience symptoms for a few weeks after taking both pills.

Youll first have an appointment with a nurse or doctor who will ask about your medical history and explain how the process works.

If you havent had a recent ultrasound, they will perform one to see how far along the pregnancy is.

At this appointment, the healthcare staff will give you the first pill, mifepristone. In many cases, they will ask you to take it there and then.

The second pill, misoprostol, can be taken between 24 and 48 hours after the first one.

You may be given an oral dose or a slowly dissolving tablet thats placed in your vagina, under your tongue, or between your teeth and cheek.

Some people return to their healthcare provider to take misoprostol, while others take it at home.

Within 1 to 4 hours of taking the second pill, your body should begin to cramp and bleed.

Its common to pass the pregnancy within 4 hours, but it can take a few days for some people.

You may also experience lighter bleeding and cramping for a few weeks afterward.

A follow-up appointment with your healthcare provider usually takes place around 2 weeks after taking the pills.

A medical abortion uses two medications in the form of a pill to end a pregnancy.

Mifepristone is the first pill.

It blocks an important pregnancy hormone called progesterone. This results in the breakdown of the uterine lining and stopping the growth of the embryo.

The body soon realizes that the pregnancy cant continue, so the second medication, misoprostol, helps the body push out the embryo through the vagina.

The body does this by causing the uterus to contract, which leads to a similar level of cramping and bleeding as a miscarriage.

The abortion pill is highly effective, but its effectiveness does decrease the further along the pregnancy is.

For example, the medication works for 94 to 98 percent of people who are 8 weeks pregnant or less.

This reduces to 91 to 93 percent effectiveness for those who are between 9 and 10 weeks pregnant.

A 2011 research review found no evidence of a difference between the effectiveness of medical abortions and surgical procedures.

And, according to the University of California, San Francisco, only around 3 to 5 percent of people need a surgical abortion after a medical one.

But certain factors can change effectiveness.

An abortion pill wont work if you have an ectopic pregnancy or dont take both medications correctly.

Similarly, you shouldnt have a medical abortion if you have an IUD or certain medical conditions, like a bleeding disorder.

Healthcare staff will check all of the above and provide clear instructions before giving you any abortion medication.

Many liken the feeling of a medical abortion to an early miscarriage.

After taking the second pill, youll likely experience abdominal cramps and heavy bleeding for a few hours.

Depending how far along the pregnancy is, you may pass larger tissues that are brown or red in color, and may be able to see the white pregnancy sac.

Misoprostol can also cause:

Look after yourself by staying in a comfortable place, whether thats your own home or the home of family or friends.

If you can, take a couple of days off work so you can rest.

Lying down with a hot-water bottle on your abdomen can help relieve any pain. Some find sitting on the toilet to be a more comfortable position.

Youll also need highly absorbent menstrual pads for the bleeding.

If you need pain medication, avoid aspirin, as it can worsen bleeding. Instead, take ibuprofen (Advil, Motrin). It may help to take pain medication around 30 minutes before the misoprostol.

If you feel that something isnt right especially if youre soaking two or more pads an hour for a few hours or have a fever that lasts longer than a day seek medical advice.

Hospitals and clinics dont need to know youve taken the abortion pill if you feel unsafe telling them. Your symptoms mimic a natural miscarriage, so staff wont be able to tell the difference.

As soon as your abortion is complete, your symptoms should begin to reduce.

Bleeding may be lighter, while cramping may not feel so severe. Other side effects like fever or nausea should also disappear.

It may take a couple of days for you to get back into your normal routine, as the process can make you tired.

Its normal to experience lighter bleeding for a few weeks after taking the abortion pill, so dont worry if youre still spotting after your follow-up appointment.

Before the appointment, try to keep track of how much youre bleeding. Be sure to tell your healthcare provider any concerns you have.

Around 4 to 6 weeks after your abortion, your period should return.

Be aware that your body can start to ovulate around 3 weeks after taking the medication, meaning you can become pregnant once again.

Your follow-up appointment may take place over the phone or in person, depending on your and your providers preference.

Its important to attend this so your healthcare provider can check that your body is healing properly. Theyll also look for any signs of infection.

Your healthcare provider will ask you about the process, including:

Your healthcare provider may also physically check the cervix and uterus, perform lab tests to check for the pregnancy hormone, and perform an ultrasound to determine whether the abortion pill worked.

If you opted for a phone appointment, youll often be given a pregnancy test to take at home.

Avoid taking an at-home test too soon after an abortion, as the pregnancy hormone may still linger in your body. Its best to wait 4 weeks to avoid a false-positive result.

Although the abortion pill is effective in the vast majority of cases, theres a small chance that it may not work.

Your healthcare provider will be able to determine this at your follow-up appointment.

If youre still pregnant, your healthcare provider will discuss other abortion options.

You may be able to take another dose of the abortion pill, or you may need a surgical abortion instead.

If youre having trouble finding a clinic in your state or want more information about the abortion process, the following organizations can help:

Remember that its perfectly normal to experience a wide range of emotions after an abortion.

If you need to speak to someone about how youre feeling, consider a post-abortion counselor.

All-Options and Exhale offer various forms of free support, including over-the-phone counseling and a confidential text line.

Lauren Sharkey is a U.K.-based journalist and author specializing in womens issues. When she isnt trying to discover a way to banish migraine, she can be found uncovering the answers to your lurking health questions. She has also written a book profiling young female activists across the globe and is currently building a community of such resisters. Catch her on Twitter.

Read the rest here:
How to Know If the Abortion Pill Worked and What to Do Next - Healthline

Recommendation and review posted by Bethany Smith

DEIR AL-BALAH, Gaza Strip, Palestine I always encourage the women I know to do a self-examination and regular screenings, Intisar, 55, told UNFPA. She is a breast cancer survivor from Deir al-Balah in the Gaza Strip, and her outspokenness about the topic is a rarity in her community.

The incidence of breast cancer has been increasing in Palestine in recent years partly due to growing awareness and detection, but also because of lifestyle and dietary habits related to poverty. It is the most prevalent cancer among Palestinian women, accounting for 32 per cent of cancer diagnoses in the West Bank and 18 per cent of those in the Gaza Strip.

Breast cancer is most treatable when detected early. Unfortunately, more than 60 per cent of breast cancer cases in Palestine are found at a late stage, reducing the chance of survival.

Women with breast cancer also face serious stigma.

In Palestine, it is widely understood that vulnerability to breast cancer can be hereditary. As a result, some women avoid getting screened because they fear a breast cancer diagnosis could affect their daughters marriage prospects. Women with breast cancer have also faced gender-based violence and abandonment. A recent UNFPA study showed that breast cancer stigma is a major cause of delayed detection and treatment.

Advocates for breast cancer awareness speak to women at the Islamic University in Gaza. Image courtesy of Culture and Free Thought Association

Intisar was fortunate to have the support of her family when she received her breast cancer diagnosis in 2016. But the social stigma left her feeling depressed and isolated.

UNFPA works with the Ministry of Health to improve detection and treatment efforts, and coordinates a breast cancer working group.

Working with Augusta Victoria Hospital and the Palestinian Medical Relief Society, and with funding from the Government of Japan, UNFPA has deployed a mobile breast cancer screening clinic to marginalized communities in the West Bank.

UNFPA also works closely with the Culture and Free Thought Association (CFTA) and the Campaign for the Children of Palestine to support breast cancer patients in Gaza. After Intisar received chemotherapy, she started to visit the CFTA for services.

There, she received a wig, dignity kits with hygiene products, hormone therapy, vitamins, medication and financial assistance. The association also helped her receive a mastectomy operation and prostheses. CFTA also provided psychosocial support, recreational activities and group outings.

I met women who became my real friends, Intisar recalled.

These services, as well as community awareness sessions, are supported by UNFPA with funding from the Government of Japan. Awareness is essential, experts say.

The aim is to increase awareness on the importance of early diagnosis for breast cancer for both women and men, said Firyal Thabet, director of the Women Health Centre at CFTA.

We do this by online campaigns, radio coverage, and by involving mosques, hair salons and taxi companies. Now we see more and more women and men coming to our centre for screening.

CFTA holds a recreation day for women at Al-Gouna Resort. Image courtesy of Culture and Free Thought Association.

Swift access to treatment services is also crucial. A recent evaluation of UNFPAs projects on breast cancer found that, among the projects clients, the average time from diagnosis to initiation of treatment fell from 6 months to 7 days between 2016 and 2018.

Still, some treatment options remain out of reach.

Intisar needed to receive radiotherapy, but no such services were available in Gaza. CFTA helped her obtain a permit from the Israeli authorities to receive treatment at Augusta Victoria Hospital in East Jerusalem, but her permit application was rejected five times before she was finally granted permission.

In 2018, almost 40 per cent of Israeli permit applications for Palestinian patients to exit the Gaza Strip to receive treatment in the West Bank or Jerusalem were rejected or delayed. About a quarter of these applications were for cancer care.

Today, Intisar is a leading advocate for early detection and a peer supporter at CFTA. She also counsels women and girls about the topic in her community. Breast cancer is a start of a new life and not the end of your life, she tells them. Do not give up.

She is also refusing to give up.

A year ago, doctors found a small cancerous tumour on her lung. She is again undergoing chemotherapy.

I am hopeful that I will recover again, she said, with the help of God and those around me.

View post:
For one breast cancer survivor in Gaza Strip, a journey of hardship and hope - UNFPA News

Recommendation and review posted by Bethany Smith

Tossing and turning between the sheets could be the cause of your excessive gas.

Image Credit: KrisCole/iStock/GettyImages

There are a few foods you know are going to give you gas. That's why, before you sit down to a loaded bean chili or try that recipe for cabbage rolls (because, hey, it's a pandemic, so why not), you make sure you don't have anywhere to be.

"Flatulence is normal," says Monica Borkar, MD, a gastroenterologist with NorthShore University HealthSystem in Glenview, Illinois. In fact, you (and everyone else) probably do it around 20 times a day, notes the Cleveland Clinic.

Your diet is a big culprit in creating gas. As you eat, you swallow air, and bacteria in the gut break down food, a process that also leads to flatulence. But did you know there are other things going on in your life that you'd probably never connect to a troubling case of tooting that could do it, too?

Here are seven sneaky causes of excessive gas and what you can do about them.

The stress of the pandemic, your job, caring for kids during e-learning (and the list goes on) could be weighing on your mind and your digestive system. Your gut and brain are in constant communication, and when you're lacking ways to offload stress, your digestion can pay the price, Dr. Borkar says.

Stress may also inadvertently cause you to make less-healthy choices. "We may drink more coffee, eat more sweets, smoke, consume alcohol or chew more gum," Dr. Borkar says. "All of those factors may lead to even more flatulence."

Your fart-free plan: If you're in a time of high stress, it's even more critical to take care of yourself (even if that feels like your last priority). Dr. Borkar recommends focusing on eating a well-balanced diet, which will not only limit your consumption of the culprits above, but will also help keep you regular in the bathroom. "Staying regular often leads to less bloating and gas," she says.

Drink plenty of water and eat fiber-rich foods like fruits, vegetables and whole grains.

2. Youre Taking in a Lot of Air When You Eat

Eating quickly or mindlessly may mean you're gulping more air than normal when you eat, per the Mayo Clinic.

Your fart-free plan: Slow down at meals and snacks. Eat without distractions like the TV or your phone, take small bites and chew thoroughly.

Each time you take a puff, you swallow more air, according to Harvard Health Publishing.

Your fart-free plan: Count this as a bonus benefit of quitting for good.

4. Youre Getting Your Period

Experiencing GI issues during PMS is common. "Fluctuations in the hormones estrogen and progesterone can cause these symptoms," Dr. Borkar says.

Your fart-free plan: Exercising, drinking water and eating a diet low in sodium and with fewer processed foods can help ease PMS, she says.

5. Youre Not Sleeping Well

Whether its due to stress, busyness or too many new shows on Netflix, cutting shut-eye short may be behind your farts.

"Since lack of sleep simulates a stressful situation, our bodies release a stress hormone called cortisol, which can cause bloating and flatulence," Dr. Borkar says.

Your fart-free plan: The National Sleep Foundation recommends adults get seven to nine hours of sleep per night. If you're not getting that many hours in before your alarm goes off, try moving your bedtime earlier by 15-minute increments each night (and stay consistent with when you tuck in, even on the weekends).

6. Its Your Medication

Both over-the-counter and prescription medications, as well as supplements, can cause gas. One common example is NSAIDs (like ibuprofen and aspirin), which you might take to relieve headaches, reduce muscle pain or ease PMS. These might cause gas and bloating as well as diarrhea or constipation, according to the Cleveland Clinic.

Metformin, a common prescription drug to treat diabetes, is linked to flatulence, too, per an April 2017 review in Diabetes, Obesity and Metabolism.

And iron supplements that treat anemia have been found to double the risk of GI side effects, including flatulence, according to February 2015 research in PLOS One.

Your fart-free plan: Take NSAIDs with food or along with an antacid, advises the Cleveland Clinic. If you're on a prescription medication, talk to your doctor about switching, as there may be certain formulations that are better suited for your system (it's important not to stop taking a prescription med without first talking to your doc).

7. You Have a Digestive Condition

There are several conditions that count abdominal discomfort, bloating and gas as symptoms, Dr. Borkar says, including constipation and inflammatory bowel disease (IBD) as well as bacterial or viral infections.

Your fart-free plan: Farting is normal, but if you feel like it's over the top and is accompanied by other symptoms (such as abdominal pain or changes in bowel habits), talk to your doctor.

Here is the original post:
7 Causes of Excessive Gas That Aren't Food - LIVESTRONG.COM

Recommendation and review posted by Bethany Smith

Abstract

Harnessing CRISPR-Cas9 technology for cancer therapeutics has been hampered by low editing efficiency in tumors and potential toxicity of existing delivery systems. Here, we describe a safe and efficient lipid nanoparticle (LNP) for the delivery of Cas9 mRNA and sgRNAs that use a novel amino-ionizable lipid. A single intracerebral injection of CRISPR-LNPs against PLK1 (sgPLK1-cLNPs) into aggressive orthotopic glioblastoma enabled up to ~70% gene editing in vivo, which caused tumor cell apoptosis, inhibited tumor growth by 50%, and improved survival by 30%. To reach disseminated tumors, cLNPs were also engineered for antibody-targeted delivery. Intraperitoneal injections of EGFR-targeted sgPLK1-cLNPs caused their selective uptake into disseminated ovarian tumors, enabled up to ~80% gene editing in vivo, inhibited tumor growth, and increased survival by 80%. The ability to disrupt gene expression in vivo in tumors opens new avenues for cancer treatment and research and potential applications for targeted gene editing of noncancerous tissues.

In recent years, molecularly targeted inhibitors and immunotherapy have greatly improved cancer responses with reduced toxicity and adverse reactions. However, the high recurrence rate and the development of drug resistance for most types of cancers highlight the need for new therapeutic modalities. Most cancer drugs require repeated administration, which increases treatment-related toxicity and treatment cost and severely reduces patient quality of life. CRISPR-Cas9 gene editing has the potential to permanently disrupt tumor survival genes, which could overcome the repeated dosing limitations of traditional cancer therapies, improve treatment efficacy, and require fewer treatments (1, 2). The Cas9 nuclease is directed by a single-guide RNA (sgRNA) to modify a specific chromosomal DNA sequence by inducing a sequence-specific double-strand break (DSB) (3, 4). DSBs are predominantly resolved via the error-prone nonhomologous end-joining repair mechanism, which can induce insertions or deletions that result in gene disruption. However, the large size of Cas9 (160 kDa, 4300 bases) and sgRNA (~31 kDa, 130 bases) is an obstacle for conventional viral and nonviral delivery systems. Moreover, current delivery systems for nonliver tissues and tumors only result in relatively low gene editing percentages (5, 6). For an effective cancer therapy, substantially higher editing efficiencies would be needed.

Lipid nanoparticles (LNPs) are clinically approved nonviral nucleic acid delivery systems capable of delivering potentially such large payloads. Cationic ionizable lipids are the key component of LNPs that enables efficient nucleic acid encapsulation, cellular delivery, and endosomal release. However, LNP formulations that were optimized for small interfering RNA (siRNA) delivery do not efficiently deliver large nucleic acids (e.g., mRNAs and plasmids) (7, 8). Most in vivo studies of gene editing have relied on adeno-associated virus (AAV) to deliver CRISPR components locally to the retina or skeletal muscle or to the liver. Nevertheless, AAV applications are limited by its small carrying capacity, immune responses, hepatoxicity at high doses, and the lack of cellular targeting (9, 10). Several nonviral delivery vehicles for CRISPR components have been reported in recent years (5, 11). These systems were evaluated for liver-associated genetic diseases, demonstrated gene editing of up to 60% in mice and rat livers, and almost a complete reduction of target protein in the blood. However, formulations designed for other tissues were less efficient (i.e., up to ~15% in the lung and ~3% in melanoma) (5, 6). Therefore, the development of efficient and safe delivery systems for nonliver tissues remains an important missing link for therapeutic translation of CRISPR editing.

Here, we report the development of a targeted nonviral LNP delivery system for therapeutic genome editing and evaluate it in two aggressive and incurable cancer models.

To overcome the cargo limitation of currently available LNP formulations, LNPs were designed to coencapsulate Cas9 mRNA and sgRNA, using ionizable cationic lipids from a novel ionizable amino lipid library (Fig. 1A) (12). This library was constructed using a novel class of ionizable amino lipids based on hydrazine, hydroxylamine, and ethanolamine linkers with a linoleic fatty acid chain and amine head groups (12). Lipids 1, 6, 8, and 10 were the top hits of the screen and were chosen for further evaluation for CRISPR-Cas9 gene editing (Fig. 1B). Cas9 mRNA was chosen, instead of plasmid DNA, to reduce long-term exposure to the nuclease to minimize off-target gene modifications (13, 14). To enhance RNA stability and minimize immunogenicity, Cas9 mRNA was chemically modified with 5-methoxyuridine, and highly modified sgRNAs were used (IDT sgRNA XT) (15, 16). CRISPR-LNP (cLNP) formulations containing Cas9 mRNA and an sgRNA were compared to Cas9 mRNA and sgRNAs encapsulated with the clinically approved LNP formulation, used for siRNA therapeutics, based on DLin-MC3-DMA as the ionizable cationic lipid (MC3-cLNPs). cLNPs were uniform in size with a diameter of 71 to 80 nm, polydispersity index of 0.024 to 0.103, and potential of 3 to 18.6 mV as measured by dynamic light scattering (Fig. 1C). The biophysical properties and transmission electron microscopy micrographs of L8-cLNPs were similar to those of MC3-cLNPs (Fig. 1C and fig. S1A). The encapsulation efficiency of Cas9 mRNA and sgRNA in L6, L8, L10, and MC3-LNPs was similarly high (>90%) but lower in L1-cLNPs (~65%) (Fig. 1D). Next, we evaluated the in vitro gene disruption efficiency of the cLNP formulations encapsulating a GFP sgRNA by measuring the loss of green fluorescent protein (GFP) fluorescence in human embryonic kidney (HEK) 293 cells stably expressing GFP (HEK293/GFP) (Fig. 1E) (17). L1-, L8-, and L10-cLNPs all disrupted GFP in a concentration-dependent manner, and L8 was the most efficient. GFP fluorescence was detected in only 4% of L8-cLNPtreated cells after incubation with cLNPs containing total RNA (1.0 g/ml). Although Cy5.5-labeled MC3-cLNPs were taken up more efficiently than L8-cLNPs into HEK293/GFP cells as measured by flow cytometry (fig. S1B), MC3-cLNPs did not reduce GFP expression at any concentration (0.1 to 1.0 g/ml total RNA, 0.7 to 7 nM total RNA). On the basis of these data, L8-cLNPs were chosen for further study.

(A) Schematic illustration of cLNP preparation. A microfluidic-based mixing of lipids to construct cLNPs encapsulating Cas9 mRNA and sgRNA. (B) Chemical structures of the selected ionizable amino lipids from the library screen. (C) Physicochemical characterization of cLNP by dynamic light scattering and sizer. Data are means SD of five independent preparations. (D) Encapsulation efficiency as measured using a RiboGreen assay. (E) GFP disruption assay: HEK293 cells were transfected with cLNPs at different concentrations (0.1 to 1 g/ml, 0.7 to 7 nM total RNA), and 72 hours after transfection, the percentage of GFP+ cells were analyzed by flow cytometry. Data are means SD of three independent experiments. (F and G) Percentage of gene editing events upon either GFP or PLK1-cLNP transfection (F) and allelic frequencies (G) in the GFP loci as determined by NGS analysis (allelic frequencies of >2% are presented). (H) GFP disruption assay in multiple cancer cell lines compared to mock-treated cells. Cells were transfected with L8-cLNPs, and 72 hours after transfection, the percentage of GFP+ cells were analyzed by flow cytometry. Data are means SD of three independent experiments.

The efficiency and specificity of gene disruption by L8-cLNPs encapsulating GFP sgRNAs (sgGFP-cLNPs) in HEK293/GFP were assessed by quantifying the percent of gene-edited GFP genomic sequences by next-generation sequencing (NGS). Ninety-four percent of GFP genomic DNA was modified, but <0.1% was edited at a nontargeted locus (PLK1) (Fig. 1, F and G). sgGFP-cLNPs did not significantly affect cell viability at all tested concentrations (up to 1 g/ml; fig. S2). Next, we evaluated gene disruption using L8-cLNPs in multiple GFP-expressing, aggressive cancer cell lines [005 murine glioblastoma multiforme (GBM), human serous ovarian adenocarcinomas Ovcar8 (OV8) and NCI-ADR (NAR), human colon carcinoma HCT116, and human lung adenocarcinoma A549]. After incubation with sgGFP-cLNPs (1 g/ml; 7 nM of total RNA), GFP fluorescence was only detected in 3 to 18% of these cancer cells (Fig. 1H). Thus, L8-cLNPs cause efficient and specific gene editing in vitro with low toxicity in multiple cancer cell lines.

To explore the potential of therapeutic genome editing, as proof of concept, we evaluated L8-cLNPs containing PLK1 sgRNA (sgPLK1-cLNPs) or sgGFP-cLNPs as control. PLK1 is a kinase required for mitosis; lack of it leads to G2-M phase cell cycle arrest and cell death in dividing cells. Treating HEK293/GFP with sgPLK1-cLNPs (0.5 g/ml) caused 98% PLK1 gene editing, while <0.1% was edited at the nontargeted GFP locus by NGS (Fig. 2, A and B). PLK1 gene editing caused potent G2-M arrest 48 hours later, while control sgGFP-cLNPs had no effect on cell cycle profile (Fig. 2, C and D). Treatment with sgPLK1-cLNP resulted in a fivefold decrease in cell viability compared to untreated or sgGFP-cLNPtreated cultures, as analyzed by 4,6-diamidino-2-phenylindole (DAPI)/annexin V staining and by XTT assay, 96 hours after treatment (Fig. 2, E to G). Preserved cell viability after treatment with sgGFP-cLNPs suggests that cLNPs may have low toxicity at therapeutically relevant doses.

(A and B) Percentage of gene editing events (A) and allelic frequencies (B) in the PLK1 loci as determined by NGS analysis (allelic frequencies of >2% are presented). (C and D) Cell cycle analysis of HEK293 cells treated with mock, sgGFP, or sgPLK1-cLNPs (0.5 g/ml, 3.5 nM of total RNA) for 48 hours and analyzed by flow cytometry. (C) Bar charts representing the percentage of G1-S and G2-M cell cycle phases. Data are means SD of three independent experiments. (D) Representative cell cycle analysis diagram. (E and F) DAPI/annexin V assay of HEK293 cells treated with mock, sgGFP, or sgPLK1-cLNPs (0.5 g/ml, 3.5 nM total RNA) for 96 hours and analyzed by flow cytometry. (E) Bar charts representing the percentage of live cells normalized to mock-treated cells. Data are means SD of three independent experiments. (F) Representative DAPI/annexin assay diagram. (G) XTT cell viability assay of HEK293 cells treated with mock, sgGFP, or sgPLK1-cLNPs (0.5 g/ml, 3.5 nM total RNA) 96 hours after treatment. Bar charts representing the % of cell viability normalized to mock-treated cells. Data are means SD of three independent experiments. (E and G) One-way analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****P < 0.0001.

To explore the potential of cLNPs for therapeutic genome editing in cancer, we evaluated cancer cell lines of two aggressive and difficult to treat cancersthe murine GBM stem celllike 005 cell line isolated from gliomas that formed in Tp53+/ mice after intracerebral lentiviral transduction of activated H-Ras and Akt (18, 19) and human OV8, a high-grade serous ovarian adenocarcinoma cell line that is highly drug resistant and metastasizes to form ascites (20, 21). GBM 005 cells resemble almost uniformly fatal human GBM, in that they are highly invasive, neovascularized, pleomorphic, and infiltrated by immune cells (18, 19). Intraperitoneally injected OV8 form chemoresistant, metastatic, high-grade ovarian cancer xenografts, like most human ovarian cancers. In vitro incubation of GBM 005 or OV8 with sgPLK1, but not sgGFP, cLNPs efficiently disrupted the PLK1 gene, causing 84 and 91% genomic editing, respectively (Fig. 3, A and F, and fig. S3). Disruption of PLK1 also strongly caused G2-M cell cycle arrest 48 hours after treatment (Fig. 3, B, C, G, and H, and fig. S4, A and C) and reduced cell viability 96 hours after treatment by 5-fold in GBM 005 and 10-fold in OV8, respectively (Fig. 3, D and I). Similarly, DAPI and/or annexin V staining increased after incubation with sgPLK1, but not sgGFP-cLNPs (Fig. 3, E and J, and fig. S4, B and D). Thus, sgPLK1-cLNPs efficiently disrupted the targeted gene and caused cell cycle arrest and death of GBM 005 and OV8 in vitro.

(A and F) Percentage of gene editing events in the PLK1 loci in 005 and OV8 as determined by NGS analysis. (B and G) Bright-field microscopy representative images of 005 and OV8 cells treated with mock, sgGFP, or sgPLK1-cLNPs [005: 0.5 g/ml (3.5 nM total RNA); OV8: 1 g/ml (7 nM total RNA)], 72 hours after treatment. (C and H) Cell cycle analysis of 005 and OV8 cells, treated with mock, sgGFP, or sgPLK1-cLNPs [005: 0.5 g/ml (3.5 nM total RNA); OV8: 1 g/ml (7 nM total RNA)] for 48 hours and analyzed by flow cytometry. Bar charts representing the % of G1, S, and G2-M cell cycle phases. Data are means SD of three independent experiments. (D and I) XTT cell viability assay of 005 and OV8 cells treated with mock, sgGFP, or sgPLK1-cLNPs [005: 0.5 g/ml (3.5 nM total RNA), OV8: 1 g/ml (7 nM total RNA)] for 96 hours. Bar charts representing the % of cell viability normalized to mock-treated cells. Data are means SD of three independent experiments. (E and J) DAPI/annexin V apoptosis analysis of 005 or OV8 cells treated with mock, sgGFP, or sgPLK1-cLNPs [005: 0.5 g/ml (3.5 nM total RNA); OV8: 1 g/ml (7 nM total RNA)] for 96 hours and analyzed by flow cytometry. Bar charts representing the percentage of live cells normalized to mock-treated cells. Data are means SD of three independent experiments. (C, E, and H to J) One-way ANOVA with Tukey multiple comparison test was used to assess the significance. ***P < 0.001 and ****P < 0.0001.

To evaluate the therapeutic potential of cLNPs for cancer, we needed to address two major concerns about CRISPR-Cas9 therapeutics: potential toxicity and immunogenicity. An initial study evaluated liver toxicity, blood counts, and serum inflammatory cytokines 24 hours after intravenous injection of sgGFP-cLNPs (1 mg/kg) into C57BL/6 mice. There were no apparent clinical signs of toxicity and no significant difference in liver enzyme (alanine transaminase, aspartate aminotransferase, and alkaline phosphatase) levels (fig. S5A) or blood counts (fig. S5B). A plasma cytokine panel [interleukin-1 (IL-1), IL-2, tumor necrosis factor (TNF-), interferon- (IFN-), and IL-10] also showed no significant differences (fig. S5C). Although more extensive evaluation of potential toxicity is needed for preclinical development, these results suggest that L8-cLNPs are not toxic or immunogenic when administered systemically at therapeutically relevant doses (see below).

Next, we evaluated whether the high genome editing efficacy observed in vitro could be translated to therapeutic efficacy in vivo. GBM 005 cells expressing GFP, mCherry, and luciferase were injected stereotactically into the mouse hippocampus. (Fig. 4A). Ten days later, Cy5.5-labeled sgGFP-cLNPs or phosphate-buffered saline (PBS) was injected intratumorally, and mice were euthanized 6 hours later to evaluate the tumor distribution by fluorescence microscopy. The Cy5.5-labeled cLNPs distributed throughout the tumor (Fig. 4B). To evaluate in vivo gene editing, sgGFP-cLNPs (0.05 mg/kg) were injected stereotactically into established tumors, mice were euthanized 2 days later, and single-cell tumor suspensions were analyzed by NGS for GFP gene editing. A single intracerebral injection facilitated ~72% of editing in the GFP locus in tumor cells (fig. S6A). To validate whether gene editing will translate to a loss of GFP fluorescence, sgGFP-cLNPs (0.05 mg/kg) were injected stereotactically into established tumors, mice were euthanized 7 days later, and single-cell tumor suspensions were analyzed by flow cytometry for GFP expression. GFP fluorescence in tumor cells was reduced by about twofold, demonstrating in vivo gene disruption (fig. S6, B and C). Next, to evaluate PLK1 gene disruption in vivo, either sgPLK1 or sgGFP-cLNPs (0.05 mg/kg) were injected stereotactically into established tumors, mice were euthanized 2 days later, and single-cell tumor suspensions were analyzed by NGS for PLK1 gene editing. sgPLK1-cLNPs facilitated ~68% editing in the PLK1 locus in tumor cells (Fig. 4C). To evaluate in vivo apoptosis caused by PLK1 gene disruption, either sgPLK1 or sgGFP-cLNPs (0.05 mg/kg) were injected stereotactically into established tumors. Mice were euthanized 3 days later, and tumor sections were analyzed by fluorescence microscopy for caspase-3 activation. Activated caspase-3 was only present in sgPLK1-cLNPtreated tumors, while no apparent staining was visualized in tumors treated with sgGFP-cLNPs, demonstrating PLK1-dependent apoptosis (Fig. 4D). Adjacent normal GFP tissue also did not show any evidence of caspase-3 activation. Because neurons are terminally differentiated nondividing cells, normal brain tissue has minimal expression of PLK1; therefore, it is not expected to undergo apoptosis. Next, we evaluated whether sgPLK1-cLNPs can inhibit tumor growth. GBM 005bearing mice were injected stereotactically once with sgPLK1 or sgGFP-cLNPs (0.05 mg/kg) (Fig. 4E). A single intratumoral injection of sgPLK1-cLNPs significantly reduced tumor growth compared to control groups as quantified by live animal luciferase activity (Fig. 4, F and G) and increased median survival from 32.5 to >48 days (Fig. 4H). Thirty percent of sgPLK1-cLNPtreated mice survived for 60 days when the experiment was terminated, while all the control mice died by 40 days. sgGFP-cLNPs had no significant effect on tumor growth or survival. As far as we are aware, these findings represent the highest survival improvement in this aggressive tumor after a single treatment.

(A) Schematic illustration of intracerebral injection to mouse brain. (B) cLNP dispersion through the tumor lesion upon intracerebral injection of Cy5.5-cLNPs to the tumor bed of 005 GBMbearing mice. Brain sections were analyzed by confocal microscopy, 6 hours after injection. Blue, DAPI; green, 005 GFP cells; yellow, Cy5.5 cLNPs. Scale bars, 50 m. (C) Percentage of gene editing events in the PLK1 locus as determined by NGS analysis, 48 hours after injection of PBS or 0.05 mg/kg of sgGFP-cLNPs or sgPLK1-cLNPs. (D) In vivo apoptosis induction using activated caspase 3 staining upon injection of either PBS or 0.05 mg/kg of sgGFP-cLNPs or sgPLK1-cLNPs. Brain sections were analyzed by confocal microscopy 3 days after injection. Blue, DAPI; green, 005 GFP cells; red, cleaved caspase 3. Scale bars, 50 m. (E) Experimental design. Ten days after tumor inoculation, sgGFP-cLNPs, sgPLK1-cLNPs, or PBS (0.05 mg/kg) was injected into the tumor bed. Tumor growth was monitored using bioluminescence of 005-GFP-Luc cells by the IVIS in vivo imaging system. (F and G) Tumor growth inhibition by single-dose treatment with cLNPs. (F) Representative bioluminescence imaging of 005 GBMbearing mice. (G) 005 tumor growth curve quantification. Data are presented in total flux (p/s) SEM; n = 15 animals per treatment group and n = 8 animals in the PBS group; ****P < 0.0001. One-way ANOVA was used to assess the significance at day 41. (H) Survival curves of 005 GBMbearing mice. n = 30 animals per treatment group and n = 8 animals in the PBS group. ****P < 0.0001. Log-rank (Mantel-Cox) test was used for curve comparison.

Therapeutic strategies for most tumors, especially metastatic or hematological tumors, require systemic rather than local administration. However, most LNPs get trapped in the liver and other central organs and are not efficiently taken up by tumor cells after systemic injection. A strategy for cell-targeted gene editing could enhance gene editing of tumor cells and reduce toxicity and editing of nontransformed cells. We recently reported a flexible method for antibody-targeted cell-specific delivery of siRNAs and mRNAs using systemically injected LNPs (22, 23). These targeted LNPs are coated with cell-targeting antibodies by binding to a lipid-anchored single-chain antibody linker that recognizes the Fc region of rat immunoglobulin G2a [IgG2A; Anchored Secondary scFv Enabling Targeting (ASSET)] (Fig. 5A) and reduce the recognition of the targeting antibody by Fc receptors (23). To evaluate the in vivo therapeutic potential of targeted L8-cLNPs (T-cLNP) against human OV8 peritoneal xenografts, we used the fact that these tumors highly express the epidermal growth factor receptor (EGFR) (24) to target cLNPs to OV8 by coating them with anti-EGFR. Mice bearing disseminated peritoneal OV8-mCherry tumors were injected intraperitoneally 10 days after tumor inoculation with Cy5.5-labeled sgGFP-cLNPs (0.75 mg/kg) conjugated to anti-hEGFR (T) or IgG isotype control (I) antibody (T or ICy5.5-cLNPs, respectively) to explore tumor targeting and accumulation. Four hours later, tumors were collected, and the Cy5.5 signal in the tumors was measured by live animal fluorescent imaging. Cy5.5 signal in the tumor was three times higher in T-Cy5.5-cLNPtreated mice rather than in I-Cy5.5-cLNPtreated mice, demonstrating specific targeting and accumulation in the tumor of T-cLNPs (Fig. 5, B and C). Next, to evaluate in vivo PLK1 gene disruption, mice bearing metastatic OV8-mCherry tumors were injected intraperitoneally 10 days after tumor inoculation with sgPLK1 or sgGFP-cLNPs (0.75 mg/kg) conjugated to anti-hEGFR (T) or IgG isotype control (I) antibody (T- or I-cLNPs). Mice were euthanized 2 days later, tumors were collected, and single-cell tumor suspensions were analyzed by NGS for PLK1 gene editing. T-sgPLK1-cLNPs facilitated ~82% of editing in the PLK1 locus in tumor cells, but <1% was detected in control groups (Fig. 5D). To evaluate antitumor effectiveness, mice bearing metastatic OV8-mCherry tumors were injected intraperitoneally on days 10 and 17 after tumor inoculation with either T-sgPLK1-cLNPs, I-sgPLK1-cLNPs, T- sgGFP-cLNPs, or I-sgGFP-cLNPs (0.75 mg/kg) (Fig. 5E). Tumor growth, monitored using mCherry live animal fluorescent imaging, was strongly inhibited only by T-sgPLK1-cLNPs (Fig. 5, F and G) and increased overall survival by ~80% (Fig. 5H). No significant difference in tumor growth or survival was observed in control mice treated with either T-sgGFP-cLNPs, I-sgGFP-cLNPs, or I-sgPLK1-cLNPs (Fig. 5G). These findings suggest that targeted cLNPs may be useful for targeted treatment of disseminated tumors.

(A) Schematic illustration of targeted cLNP production using ASSET (23). (B and C) Tumor targeting and accumulation of Cy5.5-cLNPs in OV8 tumorbearing mice as analyzed by the IVIS in vivo imaging system, 4 hours after injection. (B) Representative fluorescence imaging of tumors extracted from mCherry-OV8bearing mice. Top, mCherry OV8 tumors; bottom, Cy5.5-cLNP signal accumulation. (C) Quantification of mean fluorescence intensity of Cy5.5-cLNP accumulation in mCherry-OV8 tumors. Data are means SD of three independent experiments. One-way ANOVA was used to assess the significance, *P < 0.05. (D) Percentage of gene editing events in the PLK1 locus as determined by NGS analysis, 48 hours after injection of I-sgGFP, T-sgGFP, I-sgPLK1, or T-sgPLK1 cLNPs (0.75 mg/kg). (E) Experimental design. Ten and 17 days after tumor inoculation, I-sgGFP, T-sgGFP, I-sgPLK1, or T-sgPLK1 cLNPs (0.75 mg/kg) were injected intraperitoneally. Tumor growth was monitored using mCherry fluorescence of OV8-mCherry cells by the IVIS in vivo imaging system. (F and G) Tumor growth inhibition by dual-dose treatment with cLNPs. (F) Representative fluorescence imaging of OV8-bearing mice. (G) OV8 tumor growth curve quantification. Data are presented in total flux (p/s) SEM; n = 10 per group. One-way ANOVA was used to assess the significance at day 49; ****P < 0.0001. (H) Survival curves of OV8-bearing mice. n = 10 animals per treatment group. ***P < 0.0001. Log-rank (Mantel-Cox) test was used for curve comparison.

Remarkable progress has been made to improve the efficacy and safety of CRISPR-Cas9 gene editing (4, 2528). However, broad clinical translation will be enhanced by safe delivery systems able to edit efficiently specific diseased tissues in vivo (3, 2931). Because of the large size of the Cas9 nuclease, its encapsulation in both viral and nonviral delivery systems remains a challenge. Several approaches have been used to overcome the obstacle of delivering the large Cas9 nuclease as nucleic acid or protein for gene editing in the liver or locally for treating genetic disorders (5, 3235). These approaches achieved about 60% gene editing in the liver, resulting in reduced protein or cholesterol levels in the serum and alleviating disease symptoms in models of hemophilia, hypercholesterolemia, or TTR (transthyretin) amyloidosis (5, 11, 36). To date, systemic administration results in low editing efficiencies in extrahepatic tissues, partly due to the lack of specific targeting of current delivery vehicles. To achieve therapeutic effects for nonliver diseases or disseminated diseases, such as cancer, higher tissue-specific targeting with sufficient editing efficiencies is needed. Other genetic therapies, such as those based on RNA interference (RNAi), are transient and, therefore, would require repeated dosing, especially for rapidly dividing cancer cells. The permanent nature of genome editing should have a therapeutic impact even after one or a few doses, which could strongly affect toxicity, development of adverse reactions, compliance, and cost. Furthermore, the bacterial origin of the Cas9 nuclease renders it to be recognized by the host immune system and elicits an immune response (37, 38). Long exposure time to the Cas9 nuclease, as well as repeating dosing, might increase the risk for Cas9-related immune responses following by immune-related adverse reactions and treatment failure. Therefore, to minimize this risk, delivery systems that could achieve therapeutic relevant genome editing with a limited number of administrations and short Cas9 exposure time must be developed.

In this study, we developed and tested an efficient nonviral LNP system for CRISPR-Cas9 gene editing, which showed gene editing of up to 98% in vitro in multiple cancer cell types and up to ~80% gene editing in vivo. cLNPs targeting PLK1 were able to inhibit tumor growth and improve survival in two aggressive cancer models in mice following single or double cLNP administrations. A single dose of sgPLK1-cLNPs to the tumor bed of a murine GBM model resulted in ~70% gene editing of the PLK1 gene, induced in vivo apoptosis as assessed by activated caspase 3 staining, prolonged median survival by ~50%, and improved overall survival of 005 GBMbearing mice by 30%. The blood-brain barrier (BBB) is a highly restrictive barrier for most therapeutic modalities. The clinical course of this devastating disease has not changed for over a decade, partly due to the limitation presented by the low BBB permeability to standard chemo- and immunotherapies. In recent years, multiple clinical trials have been conducted using local intracerebral administration with or without tumor resection to bypass the BBB; however, the success of these clinical trials was hampered by the low diffusion of the tested drugs and severe damages to the healthy brain parenchyma (3941). Our results highlight the potential of cLNPs to overcome the limitations of current therapies in a clinically relevant tumor model.

To reach disseminated tumors, we also constructed cell-targeted cLNPs, decorated with an antibody to an overexpressed receptor on ovarian cancer cells. EGFR-targeted cLNPs accumulated in disseminated tumors significantly more than IgG control cLNPs, demonstrating the advantage of a cell-targeted approach for disseminated tumors. Furthermore, a single administration of EGFR-targeted cLNPs facilitated up to ~80% PLK1 gene editing in vivo. Two intraperitoneal injections of EGFR-targeted sgPLK1-cLNPs greatly reduce tumor growth and increased overall survival by ~80% of mice with high-grade ovarian cancer malignant ascites. The majority of ovarian cancers are diagnosed at late stages when tumor metastasizes throughout the peritoneal cavity (42, 43). Recent clinical studies have demonstrated an improved pharmacokinetic profile of intraperitoneally injected chemotherapy resulting in higher drug concentration in the abdominal cavity and improved progression-free survival and overall survival. Furthermore, the partial systemic restriction of intraperitoneal administration resulted in reduced toxicity and treatment-related complications (4446). The targeting strategy we designed, using the ASSET linker system (22, 23), is, to our knowledge, the first example of targeted CRISPR-Cas9 therapeutic gene editing for treating metastatic tumors. It provides a highly flexible and efficient strategy for targeted gene editing that could be used by changing the antibody, for targeting either tumor cells via tumor-specific cell surface receptors (such as EpCAM or PSMA) or shared tumor and normal cell receptors (such as CD19 on B cell lymphomas), or for targeting nontransformed cells in diseased tissues. Targeting provides a way of overcoming the limitations of most LNP and nanoparticle delivery systems, whose therapeutic effect is largely limited to the liver and other central organs, where particles get trapped. Moreover, targeted LNPs can be administered systemically to target both localized and disseminated (such as metastatic and/or hematopoietic) cells (22, 23).

In this study, we edited PLK1 as proof of concept, but this cancer therapeutic strategy could be extended to edit tumor dependency genes that are not vital for normal tissues and to edit specific tumor dependency genes (such as BCR-ABL) or patient- and tumor-specific oncogene mutations (such as RAS). The Cas9 isolated from Streptococcus pyogenes was used for this proof-of-concept study but could be substituted with other CRISPR-associated nucleases to favor homologous recombination (HR) events or reduce off-target gene editing. Additional safety concern of translating CRISPR technologies to the clinic resides in off-target gene editing of bystander cells. This risk can be mitigated by the addition of tissue- or cell-specific miR binding sites to the mRNA sequence, which results in tissue-specific suppression of mRNA translation (47, 48). The main off-target site of LNP-based platforms is the liver, more specifically hepatocytes and Kupffer cells (49, 50), and suppression of mRNAs in these cell types can be achieved by inserting miR122 and miR142 binding sites, respectively. Using these tissue-specific mRNA suppression approaches is crucial for further clinical development of gene editing technologies. For noncancer applications, we could envision using targeted cLNPs for patient-tailored applications to correct genes associated with genetic deficiencies. Another application would be to disrupt a nonessential gene, whose knockout has no deleterious consequences but whose expression contributes to disease pathogenesis. One example is CCR5, whose knockout could potentially be used to prevent HIV transmission and cure HIV. Thus, this therapeutic strategy opens new avenues for using genome editing as a novel modality for treating various diseases and bringing CRISPR-Cas9 editing technology to the clinic.

HEK293 [American Type Culture Collection (ATCC) CRL-1573], HCT116 (ATCC CCL-247), and A549 (ATCC CCL-185) cells were purchased from ATCC, and OV8 and NCI/ADR-RES (NAR) were supplied by R. Margalit and maintained in Dulbeccos modified Eagles medium (DMEM) or RPMI 1640 (Gibco, Thermo Fisher Scientific Inc.) supplemented with 10% fetal bovine serum (Biological Industries, Israel), 1% l-glutamine (Gibco, Thermo Fisher Scientific Inc.), and 1% penicillin-streptomycin-nystatin (Biological Industries, Israel). The 005 cells (supplied by D. Friedman-Morvinski) were maintained in stem cell medium, as previously described (15). GFP-expressing cells (HEK293 and NAR) were stably transfected with pQCXIP-GFP/d2. All cells were routinely checked every 2 months for mycoplasma contamination using the EZ-PCR Mycoplasma Test Kit (Biological Industries, Israel).

DLin-MC3-DMA (MC3) and Lipid 8 were synthesized according to a previously described method (12, 23). Cholesterol, DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), polyethylene glycol (PEG)DMG (1,2-dimyristoyl-rac-glycerol), and DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanolamine)PEG were purchased from Avanti Polar Lipids Inc. Briefly, one volume of lipid mixture (ionizable lipid, DSPC, cholesterol, DMG-PEG, and DSPE-PEG at 50:10.5:38:1.4:0.1 molar ratio) in ethanol and three volumes of mCas9/sgRNA (mCas9:sgRNA 3:1 weight ratio, 1:10 molar ratio RNA to ionizable lipid) in a citrate buffer were injected into a NanoAssemblr microfluidic mixing device (Precision Nanosystems Inc.) at a combined flow rate of 12 ml min1. The formed LNPs were dialyzed twice against PBS (pH 7.4) for 16 hours to remove ethanol.

cLNP size distribution and potential were determined by dynamic light scattering using a Malvern Nano ZS sizer (Malvern Instruments). For size measurements, cLNPs were diluted 1:20 in PBS. All used samples showed a PDI (polydispersity index) lower than 0.2. For potential measurements, cLNPs were diluted 1:200 in double-distilled water.

A drop of an aqueous solution containing LNPs was placed on a carbon-coated copper grid and dried and analyzed using a JEOL 1200 EX transmission electron microscope.

To incorporate ASSET into LNPs, ASSET was incubated with LNPs for 48 hours at 4C (1:36, ASSET:RNA weight ratio), as previously described (21). Anti-human EGFR antibody (Bio-Rad Laboratories Inc., clone ICR10) or rat IgG2a isotype control (Bio X Cell, NH, USA, clone 2A3) were used.

To quantify the RNA in LNPs and to determine the RNA encapsulation efficiency, the Quant-iT RiboGreen RNA assay (Life Technologies) was used as previously described (21, 22). Briefly, 2 l of LNPs or dilutions of ribosomal RNA at known concentrations were diluted in a final volume of 100 l of TE buffer (10 mM tris-HCl and 20 mM EDTA) in the presence or absence of 0.5% Triton X-100 (Sigma-Aldrich) in a 96-well fluorescent plate (Costar, Corning). The plate was incubated for 10 min at 40C to allow particles to become permeabilized before adding 99 l of TE buffer and 1 l of RiboGreen reagent to each well. Plates were shaken at room temperature for 5 min, and fluorescence (excitation wavelength of 485 nm and emission wavelength of 528 nm) was measured using a plate reader (BioTek Industries) according to the manufacturers protocol.

Cells were counted using trypan blue (Biological Industries), and 0.1 106 cells were placed in tissue culture 12-well plates (Greiner Bio-One, Germany) with 1 ml of growing medium. MC3 or c-LNPs were added to the wells at RNA amounts of 0.1 to 2 g. Cells were incubated with the treatments in standard culture conditions for 24 to 120 hours. Then, cells were washed three times, incubated in a fresh culture medium, and collected for flow cytometry (72 to 96 hours) or cell cycle assays (24 to 48 hours), as described below. For 005 cells, cLNPs were preincubated with ApoE3 (0.001 mg/ml; PeproTech, USA) before the addition to the cells.

sgRNAs were designed and synthesized by Integrated DNA Technologies: GFP, GACCAGGAUGGGCACCACCC/sgRNA core; MmPLK1, CTAGCACACCAACACGTCGT/sgRNA core; HsPLK1, AATTACATAGCTCCCGAGGT/sgRNA core. CleanCap Cas9 mRNA (modified) was purchased from TriLink BioTechnologies Inc.

Seventy-two hours after transfection, cells were collected and the percentage of GFP cells was evaluated using CytoFLEX and analyzed using the CytExpert software (Beckman Coulter, USA).

For in vitro uptake experiments, 20% of the total RNA content of cLNPs was replaced with an equal amount of short Cy5.5-labeled DNA oligo (Cy5.5: AGCTCTGTTTACGTCCCAGC). Binding of the labeled cLNPs was assessed by flow cytometry (CytoFLEX and the CytExpert software, Beckman Coulter, USA). Analyses were done with FlowJo software (FlowJo LLC, USA). To determine the uptake of MC3-cLNPs or L8-cLNPs, 0.5 106 cells were incubated with cLNPs (0.1 to 1 g/ml) at 37C for 2 hours. Cells were collected for flow cytometry analysis after three rounds of PBS wash.

Percentage of gene editing was evaluated in cell lines or sorted tumor cells extracted from tumors (GFP+ 005 cells or mCherry+ OV8 cells) as described below (single-cell suspension sections). Genomic DNA was extracted with QuickExtract DNA Extraction Solution (Lucigen Inc.) using the manufacturers protocol, and amplification was performed using locus-specific primers containing universal tails to add sample-unique P5 and P7 indexes for Illumina sequencing in two rounds of polymerase chain reaction (PCR). Following PCR, a 1 SPRI (Solid Phase Reversible Immobilization) bead cleanup and library quantification by quantitative PCR (IDT) were performed before sequencing. PCR amplicons were sequenced on an Illumina MiSeq instrument [v2 chemistry; 150base pair (bp) paired-end reads; Illumina, San Diego, CA, USA]. Data were analyzed using a custom-built pipeline. Data were demultiplexed (Picard tools v2.9; https://github.com/broadinstitute/picard); forward and reverse reads were merged into extended amplicons (flash v1.2.11); reads were aligned against the GRCh38 genomic reference (bwa mem v0.7.15), assigned to targets (bedtools tags v2.25). Reads, with more than 30% of bases with quality scores less than 15, were filtered out. At each target, custom python code identified INDELs based on gapped alignments between reads and targets, and editing was calculated as the percentage of total reads containing an INDEL within an 8-bp window of the cut site.

For cell cycle analysis, 5 105 cells were collected 48 hours after LNP transfection. The cells were washed with ice-cold PBS and fixed with 70% ethanol for 1 hour. Then, the cells were washed twice with cold PBS and incubated for 10 min at 37C in 300 l of PBS with 2-(4-amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI; 15 g/ml; Merck KGaA, Darmstadt, Germany). Fluorescence was measured by flow cytometry. Cell viability was evaluated by flow cytometry using APC Annexin V (BioLegend Inc., 640941) and DAPI as recommended by the manufacturer. Data from at least 2 104 cells were acquired using CytoFLEX and the CytExpert software (Beckman Coulter, USA). Analyses were done with FlowJo software. For cell cycle analysis, the Dean-Jett-Fox model was applied to at least 10,000 gated cells. Cell viability evaluation was done using the XTT Cell Proliferation Kit (Biological Industries, Israel) according to the manufacturers recommendation.

Eight-week-old female C57BL/6JOlaHsd mice (Envigo, Rehovot, Israel) were anesthetized, positioned in the Kopf Stereotaxic Alignment System, and inoculated with 3 105 005 cells in a 1.5-l volume using automatic syringe pump in a rate of 0.3 l/min. Injections were made to the right frontal lobe, ~1.5 mm lateral, 2 mm caudal from bregma, and at a depth of 2.3 mm. Bioluminescence imaging (IVIS SpectrumCT, PerkinElmer Inc.) was performed every 5 days after tumor cell implantation to monitor tumor growth. XenoLight d-luciferin (122799, PerkinElmer Inc.) was injected at 15 mg/kg subcutaneously. Bioluminescence analysis was conducted using the Living Image software (PerkinElmer Inc.).

Ten days after tumor inoculation, 005 GBMbearing mice were anesthetized, positioned in the Kopf Stereotaxic Alignment System, and injected with either sgGFP-cLNPs, sgPLK1-cLNPs, or PBS (0.05 mg/kg) in a 1.5-l volume using automatic syringe pump in a rate of 0.3 l/min. Injections were made to the right frontal lobe, ~1.5 mm lateral, 2 mm caudal from bregma, and at a depth of 2.3 mm.

Tumor-bearing brains were processed to single-cell suspensions using the Neural Tissue Dissociation Kit (P) (Miltenyi Biotec, USA) and gentleMACS Dissociator according to the manufacturers protocol. For NGS analysis, GFP+ 005 tumor cells were sorted using a BD FACSAria III sorter and further processed as described above.

Twenty percent of the total RNA content of the sgGFP-cLNPs was replaced with an equal amount of short Cy5.5-labeled DNA oligo (Cy5.5: AGCTCTGTTTACGTCCCAGC). Four hours after injection, mice were euthanized and brains were harvested. For fluorescent staining, coronal brain sections (40 m) were cut on a microtome, and images were obtained using a confocal laser-scanning microscope.

Eight-week-old female Hsd: Athymic Nude-Foxn1nu mice (Envigo, Rehovot, Israel) were injected with 3 106 OV8-mCherry cells intraperitoneally. Fluorescence imaging (IVIS SpectrumCT, PerkinElmer Inc.) was performed weekly after tumor cell implantation to monitor tumor growth. Fluorescence analysis was conducted using the Living Image software (PerkinElmer Inc.).

Tumor-bearing mice were processed to single-cell suspensions using Tumor Dissociation Kit, mouse (Miltenyi Biotec, USA) and gentleMACS Dissociator, according to the manufacturers protocol. For NGS analysis, mCherry+ tumor cells were sorted using a BD FACSAria III sorter and further processed as described above.

OV8-bearing mice were injected intraperitoneally with either anti-EGFRsgGFP-cLNPs, isotype controlsgGFP-cLNPs, anti-EGFRsgPLK1-cLNPs, or isotype controlsgPLK1-cLNPs (0.75 mg/kg). For tumor-targeting experiments, OV8-bearing mice were injected intraperitoneally with either anti-EGFR Cy5.5-sgGFP-cLNPs or isotype control Cy5.5-sgGFP-cLNPs (0.75 mg/kg). Fluorescence imaging (IVIS SpectrumCT, PerkinElmer Inc.) was performed 4 hours after LNP injection to evaluate tumor targeting and accumulation. Fluorescence analysis was conducted using the Living Image software (PerkinElmer Inc.).

Ten-week-old female C57BL/6 mice (Envigo Laboratories) were injected with sgGFP-cLNPs (1 mg/kg) intravenously. Twenty-four hours after injection, blood was collected for biochemistry using Cobas-6000 instrument and complete blood count via Sysmex and ADVIA 120 (A.M.L., Israel). The serum was separated and stored at 80C before cytokine analysis. Cytokine analysis was done by Pharmaseed Pre-clinical CRO, Israel.

All animal protocols were approved by the Tel Aviv University Institutional Animal Care and Usage Committee and in accordance with current regulations and standards of the Israel Ministry of Health. All animal experiments were conducted in a double-blinded fashion; the researchers were blinded to group allocation and administered treatments. Mice were randomly divided in a blinded fashion at the beginning of each experiment.

Statistical analysis for comparing two experimental groups was performed using two-sided Students t tests. In experiments with multiple groups, one- or two-way analysis of variance (ANOVA) with a Tukey correction was used to calculate differences among multiple populations. Kaplan-Meier curves were used to analyze survival. A value of P < 0.05 was considered statistically significant. Analyses were performed with Prism 7 (GraphPad Software). Differences are labeled n.s. for not significant, * for P 0.05, ** for P 0.01, *** for P 0.001, and **** for P 0.0001. Preestablished criteria for the removal of animals from the experiment were based on animal health, behavior, and well-being as required by ethical guidelines.

Acknowledgments: We thank N. Dammes for drawing the illustrations and V. Holdengreber for the scientific assistance with electron microscopy. Funding: A.G. thanks the Dr. Albert and Doris Fields Trust, the Marian Gertner Institute for Medical Nanosystems, and the Glaser Foundation for her fellowships. This work was supported, in part, by grants from the Israel Cancer Research Fund (grant no. 16-1285-PG). Author contributions: D.R., A.G., R.K., S.R., N.V., and D.P. conceived and designed the project. D.R., A.G., A.M.J., M.S.S., and D.F.-M. performed the experimental work. D.R., A.G., A.M.J., M.S.S., D.F.-M., Z.R.C., M.A.B., J.L., and D.P. analyzed the data. D.R., A.G., and D.P. wrote the manuscript. All authors discussed the results. Competing interests: A.M.J., M.S.S., and M.A.B. are employed by Integrated DNA Technologies Inc. (IDT), which manufactures reagents similar to some described in the manuscript. M.A.B. owns equity in DHR, the parent company of IDT. R.K. and D.P. are inventors on a patent related to this work filed by Ramot at Tel Aviv University (no. U.S. 10,543,278 B2, published on 28 January 2020). R.K., N.V., and D.P. are inventors on a pending patent related to this work filed by Ramot at Tel Aviv University (no. U.S. 2019/ 0309087 A1, filed on 10 October 2019). D.P. and S.R. are inventors on a pending patent related to this work filed by Ramot at Tel Aviv University (no. U.S. 2019/0292130 A1, filed on 26 September 2019). D.P., D.R., and A.G. are inventors on a patent application related to this work filed by Ramot at Tel Aviv University (filed on 20 May 2020). Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors. The ionizable amino lipids and the ASSET linker described in this manuscript can be provided by D.P. pending scientific review and a completed material transfer agreement. Requests for the above materials should be submitted to peer{at}tauex.tau.ac.il.

Read more:
CRISPR-Cas9 genome editing using targeted lipid nanoparticles for cancer therapy - Science Advances

Recommendation and review posted by Bethany Smith

BRAZIL - 2020/10/29: In this photo illustration the CRISPR Therapeutics logo seen displayed on a ... [+] smartphone. (Photo Illustration by Rafael Henrique/SOPA Images/LightRocket via Getty Images)

Despite a large 3x rise since the March 23 lows of this year, at the current price of around $107 per share we believe CRISPR Therapeutics stock (NASDAQ: CRSP), a biotechnology gene editing company focused on developing gene-based medicines for human diseases, has more room for growth in the near term. CRSP stock has rallied from $34 to $107 off the recent bottom compared to the S&P which moved 60% over the same period, with the resumption of economic activities as lockdowns are gradually lifted. CRSP stock is also up 4.5x from levels seen in early 2018, over two years ago.

Some of the 4x rise of the last 2 years is justified by the roughly 7x growth seen in CRISPRs revenues from 2017 to 2019, while its revenue per share grew 5x to $5.32 in 2019, compared to $1.02 in 2017. This mismatch can be attributed to a 36% uptick in total shares outstanding due to share issuances. Despite the growth in RPS, the companys P/S Multiple saw a contraction. We believe the stock is likely to see upside despite the recent uptick and the potential weakness from a recession-driven by the Covid outbreak. Our dashboard, What Factors Drove 350% CRISPR Therapeutics Stock between 2017 and now?, has the underlying numbers.

CRISPRs P/S multiple changed from 23x in 2017 to 11x in 2019. While the companys P/S is 20x now (based on trailing RPS), there is a potential upside given the expected growth in RPS over the coming years, as we discuss below.

So whats the likely trigger and timing for upside?

Theres not much to look at CRISPRs Q3 sales of $0.2 million, which compares with $212 million in the prior year quarter, which included collaboration revenues from Vertex Pharmaceuticals VRTX in connection with co-development of CTX001, an experimental gene therapy for people with sickle cell disease and transfusion-dependent beta thalassemia. So with barely any revenues this year, whats the buzz around CRISPR stock, given it has rallied 3x over the recent months? It all boils down to its pipeline. The company is working to mass-produce cell therapies that will work in any person. Currently, cell therapies are manufactured from cells derived from human donors or from a patients own cells, making the process lengthy and cumbersome to develop the medication. If CRISPR is successful in its approach, it would mean off-the-shelf cell-based medicines developed using cells from diverse group of donors. The companys in-house CTX110 therapy for non-Hodgkins lymphoma has seen positive results from phase 1 trials. The CTX001, which the company is co-developing with Vertex has received Rare Pediatric Disease designation from the U.S. FDA. Overall, CRISPR stocks value is something to be looked at purely from its potential pipeline. CTX110 alone if approved could garner sales over $1.5 billion. The estimated revenues for 2020 and 2021 are $2.5 million and $12.7 million.

CRISPR is a high growth stock and it comes with a high risk as well. There could be a case where the therapies in CRISPRs pipeline arent found effective. Also, we dont know the timeline of when the products will be ready to be sold. That said, investors willing to be patient will likely be rewarded with any positive data from clinical trials for these therapies

Trefis

What if youre looking for a more balanced portfolio instead? Heres a high quality portfolio to beat the market, with over 100% return since 2016, versus 55% for the S&P 500. Comprised of companies with strong revenue growth, healthy profits, lots of cash, and low risk, it has outperformed the broader market year after year, consistently.

See allTrefis Price EstimatesandDownloadTrefis Datahere

Whats behind Trefis? See How Its Powering New Collaboration and What-Ifs ForCFOs and Finance Teams |Product, R&D, and Marketing Teams

Excerpt from:
Heres Why You Should Stay Invested In CRISPR Stock Despite The Recent 3x Rally - Forbes

Recommendation and review posted by Bethany Smith

Here with your Southeast Regional Ag Report, Im Tim Hammerich.

Its nearly impossible to talk about the Florida citrus industry in 2020, without at least mentioning citrus greening disease. Otherwise known as huanglongbing, citrus greening is spread by the asian citrus psyllid which serves as a vector for the disease.

Citrus greening has done enormous damage to the Florida citrus industry despite years of research to try to develop effective management tools. Scientists are now hopeful that CRISPR can help. The tool for editing genomes, allows breeders to select for very specific traits, and iterate more quickly.

And they have a roadmap to follow. CRISPR has been used to develop resistant varieties to citrus canker. A program started in 2013 was able to identify the citrus canker susceptibility gene in 2014, and through CRISPR found a way to knock out this susceptibility gene. They have now made, this year, citrus varieties that are resistant to citrus canker.

Dr. Nian Wong, professor at the Citrus Research at Education Center for the University of Florida IFAS at Lake Alfred, says they were able to make progress on citrus canker much quicker than traditional breeding, and he hopes this can also be applied to citrus greening.

While there can be no guarantees on timing, Dr. Wong hopes that progress can be made on citrus greening on a similar timeline to what theyve been able to do these past seven years with citrus canker.

Read the original:
CRISPR for Citrus Greening - AG INFORMATION NETWORK OF THE WEST - AGInfo Ag Information Network Of The West

Recommendation and review posted by Bethany Smith

Benzinga

Who would have thought 2020 would be the dawn of a new era in electric vehicle stocks. Though many of these companies have been on the market in one shape or form for years, most have traded as penny stocks. Tesla Inc (NASDAQ: TSLA), which was always the top dog in the industry, now finds itself with a number of major competitors.There's no denying that FOMO (fear of missing out) has driven short-term trends in these lesser-known names, and those who invested early are now reaping the benefits.Before we continue, we need to acknowledge that these stocks carry huge amounts of risk. The EV stocks detailed below are all volatile like penny stocks. So if you are looking for ways to trade these names or make money with penny stocks, it's important to control your downside.All that being said, a number of new EV stocks have also helped fuel demand. Let's say you decided that after the March sell-off this year to invest some money into electric vehicle penny stocks. What would that look like right now if you were to take $500 at that time and throw it blindly into some of these names?Kandi Technologies Group, Inc. (NASDAQ: KNDI)Kandi Technologies is one of the newer names in the space. In 2013, the company and Geely Group, a Chinese automaker, jointly invested in the establishment of Fengsheng Automotive Technology Group Co., Ltd. in order to develop, manufacture and sell pure EV products. Earlier this year, Fengsheng introduced its first pure electric SUV, the Maple 30x.Fast-forward to today and Kandi has established dealer partnerships for the retail launch of two "affordable EV models"- K23 and K27. Shares of KNDI have rallied almost 180% in the last two weeks, nearly getting back to the all-time high of $17.40 from July 30.A $500 investment in Kandi in mid-March would've gotten someone around 230 shares. At today's price, that position would be worth around $3,300. That's a 560% return.ElectraMeccanica Vehicles Corp (NASDAQ: SOLO)ElectraMeccanica's flagship is a single-passenger EV dubbed "SOLO". The company has been working toward commercialization and building its U.S. footprint, with its first round of new retail locations just announced at the end of October and the initial shipment of SOLO EV's just arriving in North America.With commercial launch imminent and momentum as a backdrop, SOLO shares have surged in recent weeks. In a July interview with Benzinga, ElectraMeccanica CEO Paul Rivera said, "We are not trying to compete with Tesla... When you're driving this car, it's just you, and you're focused on the road."With SOLO shares trading around $0.90 in mid-March, a $500 position would be somewhere in the ballpark of 555 shares. As of Thursday, the former penny stock reached a high of $9.74 making that position worth about $5,405, a 900% gain.Blink Charging Co. (NASDAQ: BLNK)Another one of the "pick and shovel" EV stocks is Blink Charging. The company continues gaining exposure as its charging stations remain a hot topic among traders and customers alike. Not only has Blink focused on expanding its charging footprint, but the company has also benefitted from other industry news. Apple Inc (NASDAQ: AAPL) for example, announced earlier this year that its Apple Maps would include EV charge routing. According to Blink, that will include its charging stations. Last week, Blink introduced a cable management solution for new and existing EV charger locations.BLNK reached a new all-time high Thursday, breaking $19 for the first time. A $500 position in BLNK around mid-March would equate to roughly 312 shares at $1.60. At today's price that position is worth over $5,720 or an over 1,000% gain.Ayro Inc. (NASDAQ: AYRO)Ayro Inc. initially focused on manufacturing short-haul electric vehicles, such as things that drive around college campuses and office complexes. But the company's recent deal with Karma Automotive forms a partnership that includes a plan to produce more than 20,000 light-duty trucks over the next three years. It's also reportedly worth as much as $300 million. While AYRO is still one of the lower-priced EV stocks, shares have been equally explosive. Prior to its merger with DropCar, shares were trading around $0.40 in mid-March. A $500 position was equal to roughly 1,250 shares of DCAR - now AYRO. At this week's current levels above $6, that position is worth right around $7,700.Green Power Motors (NASDAQ: GP)Green Power was originally listed on the TSX Venture market and traded in the U.S. on the OTCQX Market under the symbol GPVRF. After filing for a $35 million IPO on the Nasdaq, Green Power began trading under GP, the symbol it's known for today. The company manufactures electric buses, cargo delivery vehicles, shuttles, and transit vehicles. Green Power recently closed a deal for six electric school buses that were sold to Thermalito Union Elementary School District through Greenpower's national distributor, Creative Bus Sales.While GP reached of $23.45 earlier this year, the former penny stock currently trades around $19. Back in mid-March when Green Power was still on the OTCQX, the penny stock was worth around $1.05 meaning a $500 position was equal to about 476 shares. As of recent levels of $19, that position is now 1,700% higher valued at around $9,000.Workhorse Group (NASDAQ: WKHS)Who could forget Workhorse Group? It was one of the electric vehicle penny stocks originally brought to life by a Trump Tweet last summer. The company specializes in medium-duty trucks with powertrain components under the Workhorse chassis brand. Most recently, WKHS caught some momentum after receiving a purchase order for 500 all-electric C-1000 delivery vehicles from Pritchard Companies. Some of the momentum had been stifled following news that Ford Motor Company (NYSE: F) would be rolling out its own electric cargo vehicle.Needless to say, it hasn't been a bad year for the former penny stock. In mid-March, shares were trading around $1.50. At its peak, WKHS reached highs of $30.99. Currently, the EV stock sits around $22.78 a share. That means a $500 position in March (roughly 333 shares) is now worth over $7,580 or an over 1,400% gain.Nio Inc. (NYSE: NIO)Nio isn't the new kid on the block anymore. Last year NIO became a penny stock, at one point trading as low as $1.19. Though it didn't experience a massive sell-off like most of the market did in the first quarter, shares of NIO stock were hovering around $2.30 in mid-March. But in light of the company's recent earnings beat, NIO is at $48, knocking on the door of all-time highs. A $500 position in Mid-March would equate to about 217 shares of NIO. Today that would be worth $10,500, equating to a gain of over 2,000%. Neither the author of this post nor Pennystocks.com have a position or financial relationship with any of the stocks mentioned above. See more from Benzinga * Click here for options trades from Benzinga * Cannabis Stock Gainers And Losers From November 19, 2020 * Bitcoin, Ethereum & Chainlink - American Wrap: 11/19/2020(C) 2020 Benzinga.com. Benzinga does not provide investment advice. All rights reserved.

Go here to see the original:
CRISPR Therapeutics to Participate in the Jefferies Virtual London Healthcare Conference - Yahoo Finance

Recommendation and review posted by Bethany Smith

Agriculture is one of the most inefficient industries on the planet. Current industrial farming methods demand unsustainable amounts of water, fertilizer, and land. This demand will only intensify as our global population climbs towards 10 billion by 2050. To sustainably feed our world, we need a second agricultural revolution.

Its no surprise to find synthetic biology leading this revolution. To disrupt and transform old industries, we need to work with nature, not against it. Thats the philosophy behindInari, one of the newest companies reimagining the agricultural space. Inari is leveraging the gene-editing technology CRISPR to build the worlds first Seed Foundry. We spoke with Ponsi Trivisvavet, CEO and director of Inari, about the companys process and vision for the future of agriculture.

The genomic diversity of plants is central to Inaris mission. In order to produce crops optimized for a wide range of climates, altitudes, and soils, the company needs a catalog with as many options as possible. We use diverse tools that are true to nature in order to bring biodiversity back into crops, and this allows crops to actually have better productivity, says Trivisvavet. Certain crop phenotypes require less water or utilize fertilizer more efficiently. Reintroducing these crop varieties back into the field can reduce cost burdens on farmers and dramatically improve soil health.

Read the original post

Excerpt from:
Viewpoint: Farming one of the 'most inefficient industries.' The CRISPR revolution could change that - Genetic Literacy Project

Recommendation and review posted by Bethany Smith