Shareholders and others will have the opportunity to engage with CEOs from AIM ImmunoTech, Heat Biologics, Avalon GloboCare, Oregenisis, and ImmunoPrecise Antibodies

As the coronavirus (COVID-19) pandemic persists and could possibly strengthen again this fall, dozens of biopharmaceutical companies worldwide are racing to develop life-saving therapies and vaccines.

Five of those companies will participate in the virtual One2One Investor Forum entitled New Approaches to COVID-19: Hidden Breakthroughs to be held on September 10 at 1pm ET.

The virtual panel discussion will include Tom Equels, CEO of AIM ImmunoTech Inc (NYSEAMERICAN:AIM); Jeff Wolf, CEO of Inc (); Dr David Jin, CEO of (); Vered Caplan, CEO of Oregenisis Inc (); and Dr Jennifer Bath, CEO of () (OTCQB:IPATF).

The virtual One2One Investor Forum will be moderated by broadcast journalist Christine Corrado of Proactive Investors. The event, co-sponsored by investorrelations firm Crescendo Communications, is an online variant of the popular conference format Proactive has run for more than a decade and enables communication between investors and management from some of the world's most cutting-edge businesses.

is a clinical-stage biopharmaceutical company focused on developing first-in-class therapies to modulate the immune system, including multiple oncology product candidates and a novel COVID-19 vaccine.

The North Carolina-based company heads into the forumjust after releasing some promising preclinical results from a study of a potential vaccine based on its already-developed gp96 platform which is designed to activate immune responses against cancer or pathogenic antigens. The company also just won a second US patent protection for the platform.

Heat said the study found the vaccine significantly increases the frequency of systemic and tissue-specific CD8+ T-cells by conferring cellular immunity thats essential against any viral infection, including SARS-CoV-2, the virus that causes the COVID disease.

Also, the company said the vaccine elicits a robust immune response directed against the Spike protein of SARS-CoV-2, generating both helper CD4+ T-cells that aid in antibody production as well as virus killing cytotoxic CD8+ T cells.

The company said the generation of a durable cellular immune response driven by memory CD8+ T cells also may protect against re-infection. Heat's vaccine is designed to prophylactically "train" the immune system to induce this response in patients, especially in individuals most prone to severe infection such as the elderly, those with comorbidities, or others who are immuno-suppressed.

"We believe that these results are a powerful reinforcement that this platform represents a unique and relevant paradigm for novel vaccine development, capable of inducing cellular immune responses in epithelial tissues such as the lungs, said CEO Wolf in a recent statement

This publication demonstrates the potential utility and versatility of our vaccine platform to address SARS-CoV-2, relevant mutations and other pathogens of interest."

Florida-based AIM ImmunoTech focuseson the research and development of therapeutics to treat immune disorders, viral diseases, and multiple types of cancers.

But it also has developed the drug Ampligen, which the company said decreasedthe infectious viral yield of SARS-CoV-2 by 90% in a recent in vitro model.

"We are pleased with these results, as they establish Ampligen's bio-activity against SARS-CoV-2 as well as support our decision to test Ampligen in humans as an intranasal prophylaxis and early-onset therapy against COVID-19," said CEO Equels in a recent statement.

In conjunction with the Institute for Antiviral Research at Utah State University, the company tested Ampligen and found that a dramatic reduction in viral yield could be achieved at clinically achievable dosage levels. These results support Ampligens goal of developing an intranasal prophylactic approach using Ampligen to prevent the coronavirus. Ampligen has already been tested on the SARS-CoV-1 (SARS) virus, showing antiviral promise.

Also, the company recently signed a trilateral material transfer and research agreement with Japan's National Institute of Infectious Diseases and a Japanese pharmaceutical company to test Ampligen as a potential vaccine adjuvant for COVID-19. Ampligen has been shipped to Japan, to be followed up with an additional shipment.

Furthermore, the company has plans for a Phase 1/2a trial of Ampligen with Roswell Park Comprehensive Cancer Center to commence patient enrollment soon. The trial will examine Ampligen in combination with interferon alfa-2b in cancer patients with COVID-19.

AIM also has the financial runway to advance the development of Ampligen, which is also being studied as an immuno-modulator to treat melanoma, colorectal and ovarian cancers. It amassed $40.3 million as of June 30, nearly 5 times more than the $8.8 million it had at the end of 2019.

Avalon GloboCare, which specializes in developing cell-based technologies to combat cancer, has been marshaling its resources to help fight the pandemic on three fronts: marketing a test kit for a partner company, developing therapeutics to fight cytokine storms (bodys immune attacks its own cells), and creating a vaccine.

The company also has established the Avalon Combat Covid-19 Taskforce to accelerate scientific/clinical development to help combat the Covid-19 pandemic through a strategic combination of therapeutic and vaccine approaches.

Last month, the New Jersey-based company won distribution rights to market Cellex Incs coronavirus antibody-based rapid test. Cellex recently earned Emergency Use Authorization from the US Food and Drug Administration to build and sell the kits. Both are working as well to source manufacturing facilities and to develop next-generation COVID-19 detection kits.

For COVID therapeutics, Avalon is working with the Massachusetts Institute of Technologyto co-develop a therapeutic platform against the cytokine storm, which causes lung damage. Cytokines are small protein molecules in the body required to regulate and maintain proper physiological functions, but when released in excess, the cytokine stormdamages vital tissues and organs.

Avalons AVA-Trap therapeutic program is currently entering animal model testing followed by expedited clinical studies with the goal of providing an effective therapeutic option to combat COVID-19 and other life-threatening conditions involving cytokine storms.

In early September, the company launched its new allogeneic mesenchymal stromal cell (MSC) therapeutic platform as a potential therapy for COVID-19 and bone marrow transplant-related complications of acute graft versus host disease (aGVHD).

Avalon also recently formed a partnership with the University of Natural Resources and Life Sciences (BOKU) in Vienna to co-develop a surface-layer vaccine for SARS-CoV-2.

The vaccine is expected to both decrease the severity of a SARS-CoV-2 infection preventing the more severe respiratory inflammation and organ damage and building immunity against the virus. Avalon plans to complete the proof-of-concept pre-clinical studies in 2020, followed by a first-in-human clinical study of this candidate vaccine during 2021.

Inc (), which develops cell and gene therapy platforms, is collaborating with Holdings Inc () to develop and potentially obtain FDA marketing approval of Ranpirnase to treat patients suffering from severe acute respiratory syndrome.

Maryland-based recently acquired the assets of Tamir Biotechnology Inc, including Ranpirnase, a broad spectrum anti-viral agent. Ranpirnase catalyzes the degradation of RNA, and mediates several essential biological activities, including the regulation of cell proliferation, maturation, differentiation, and cell death.

Over 1,000 patients have been dosed with Ranpirnase in previous cancer/mesothelioma clinical trials.Ranpirnase has already demonstrated a strong safety and tolerability profile.Ranpirnase also has shown preclinical antiviral activity in serious viral diseases, such as cytomegalovirus (CMV), influenza, HIV, Ebola, and SARS.

has conducted in vitro studies of Ranpirnase at the University of Tennessee Health Sciences Center Regional Biocontainment Laboratory and George Mason University National Center for Biodefense and Infectious Diseases against the SARS CoV-2 virus. The in vitro studies demonstrated that Ranpirnase was significantly effective in killing the virus with an eight-fold average decrease in the number of plaque-forming units when cultures with Ranpirnase were compared to the controls treated with a placebo.

Based on these initial pre-clinical results, a pre-IND meeting request to fast track Ranpirnase for the treatment of SARS-COV-2 has been submitted by to the FDA.

"We believe this platform could address a significant need in the market and we look forward to leveraging expertise in the development and clinical trial oversight, as well as relationships with government agencies, to possibly accelerate the development of Ranpirnase and its use as a potential treatment of patients with SARS-COV-2,said CEO Caplan recently.

() (OTCQB:IPATF) has developed a broad portfolio of therapeutic antibodies that bind to multiple regions of the SARS-CoV-2 spike protein.

In July, the Vancouver company announced that its DeepDisplay phage technology confirmedthat a subset of six of these antibodies that were analyzed in combinationresultedin near-complete neutralization of SARS-CoV-2 pseudovirus infection.

As we characterize IPAs approximately seventy-five functional lead candidates it is clear that our extensive program has generated therapeutics with broadly diverse profiles, providing substantial opportunities for multi-epitope targeted strategies, said CEOBath in a recent statement.

After selecting approximately sixteen hundred antibodies with the most desirable binding profiles to various spike protein formats, we down-selected our leads based on very specific criteria, all of which are key in our ongoing determination of ideal candidates.

The company continues to further analyze multiplesubsets of antibodies, including neutralizing antibodies demonstrated to bind to the S1 and S2 domains of the SARS-CoV-2 spike protein. Furthermore, the company has begun steps for the expression of the lead antibodies for pre-clinical and clinical manufacturing.

For ImmunoPrecise, PolyTope is the name of its scientifically rigorous and comprehensive approach employed in its anti-COVID-19 programs, as company scientists lead extensive efforts toward the development of effective coronavirus preventions and therapies.

The company noted that its lead antibodies against COVID-19 (or SARS-CoV-2) have not yet been studied in human clinical trials and, as a result, ImmunoPrecise is not making any express or implied claims that its products have been proven to have the ability to eliminate, cure or contain both the virus and disease at this time.

Contact the author: patrick@proactiveinvestors.com

Follow him on Twitter @PatrickMGraham

Read more:
Biopharmaceuticals battling COVID-19 pandemic to connect with investors via Proactive One2One Investor Forum on September 10 - Proactive Investors USA...

Recommendation and review posted by Bethany Smith

Bleeding disorders usually include symptoms in which delay in the blood clotting process can be observed. Two main types of blood disorders include von Willebrand disease and hemophilia, both of which are hereditary in nature. Von Willbrand is one of the most common congenital bleeding disorders in humans, caused as a result of deficiency of Von Willebrand factor (VWF) which assists in clot clotting process.

There are three types of Von Willebrand disorders classified on the basis of level of VWF synthesis. Von Willebrand disorders occurrence is almost equal in both sexes, and affects about 1% of the general population according to the Centers for Disease Control and Prevention (CDC). The most common complications of the disorder include heavy menstrual bleeding, excessive gum bleeding and abnormal bleeding after minor injuries. Hemophilia, on the other hand, is a disorder in which clotting factors essential for clotting phenomenon are inadequate or absent. In the U.S. about 400 newborns suffer from hemophilia every year according to statistics published by the CDC. The two main types of hemophilia are hemophilia A with deficiency of clotting factor VIII and hemophilia B with deficiency of clotting factor IX. The National Heart, Lung and Blood Institute, U.S. details that approximately 7 out of 10 individuals who suffer from hemophilia A have severe form of the disorder.

Request Brochure for Report

https://www.transparencymarketresearch.com/sample/sample.php?flag=B&rep_id=12218

Global Bleeding Disorder Therapeutics market Witness Most Promising Rise in Demand

Geographically, global Bleeding Disorder Therapeuticsmarket is segmented into North America, Europe, Asia Pacific and Rest of the world (RoW) regions. Currently, North America is leading the global Bleeding Disorder Therapeutics(CSCs) market and is followed by Europe. Factors such as highly developed research infrastructure, well defined regulatory norms, availability of research funds, availability of skilled research and healthcare professionals and supportive economy are driving the North American Bleeding Disorder Therapeuticsmarket towards growth. Asia Pacific is lucrative market for cancer stem cells. Governments in the Asia Pacific countries mainly, India and China are taking initiative to boost the healthcare and biotechnology industry in the respective countries and thus, research and development activities in these countries are swiftly increasing.

Request for Analysis of COVID19 Impact on Bleeding Disorder Therapeutics Market

https://www.transparencymarketresearch.com/sample/sample.php?flag=covid19&rep_id=12218

The study offers an in-depth assessment of various customers journeys pertinent to the market and its segments. It offers various customer impressions about the products and service use. The analysis takes a closer look at their pain points and fears across various customer touchpoints. The consultation and business intelligence solutions will help interested stakeholders, including CXOs, define customer experience maps tailored to their needs. This will help them aim at boosting customer engagement with their brands.

Key Players of Bleeding Disorder Therapeutics Market Report:

Companies are also trying to discover gene therapy which can cure the disorder. Some of the players conducting lineal trials are Biogen Idec, Novo Nordisk, Bayer Healthcare, Xenetic Biosciences, Cangene Corporation, CSL Behring, Alnylam and Pfizer. The global bleeding disorder therapeutics market is highly competitive and fragmented. Technological advances will expand the boundaries of the market by adding new products. In 2014, Baxter International, Inc. agreed to acquire Chatham Therapeutics. The acquisition will give Baxter Chathams developmental gene therapy program which is directed toward of treatment of hemophilia.

Buy Bleeding Disorder Therapeutics Market Report

https://www.transparencymarketresearch.com/checkout.php?rep_id=12218&ltype=S

About Us

Transparency Market Research is a global market intelligence company providing global business information reports and services. Our exclusive blend of quantitative forecasting and trends analysis provides forward-looking insight for several decision makers. Our experienced team of analysts, researchers, and consultants use proprietary data sources and various tools and techniques to gather and analyze information.

Our data repository is continuously updated and revised by a team of research experts so that it always reflects latest trends and information. With a broad research and analysis capability, Transparency Market Research employs rigorous primary and secondary research techniques in developing distinctive data sets and research material for business reports.

Contact

Transparency Market Research,

90 State Street, Suite 700,

Albany, NY 12207

Tel: +1-518-618-1030

USA Canada Toll Free: 866-552-3453

Website: https://www.transparencymarketresearch.com/

View post:
Bleeding Disorder Therapeutics Market: Report Analysis Global Market Revenue and Share by Manufacturers Boosting the Healthcare Industry Worldwide -...

Recommendation and review posted by Bethany Smith

Investment Thesis

Relay Therapeutics share price performance since IPO

(Source: TradingView)

Investors looking to place a bet on the next big biotech trend may want to take a close look at Relay Therapeutics (RLAY), a novel drug discovery startup with a strong management team, access to one of the world's most powerful supercomputers, and nearly $1 billion in funding, having completed the third-largest biotech IPO of all time in mid-July.

Relay's upsized IPO raised $400 million after the company sold 20 million shares for $20 - above the marketed range of $18-19 - to complement the $520 million it had already raised across 3 private funding rounds from backers including the SoftBank Vision Fund, Google Ventures, the Biotechnology Value Fund, and Third Rock Ventures. Shares traded up by 75% on the first day of trading, closing at $44, but have declined slightly and are currently available at a price of $35.3.

Relay's high-profile backers are supporting a brains trust comprising computational chemists, biophysicists, data scientists and drug development experts with access to the Anton 2 supercomputer developed by D.E. Shaw Research, whose founder, David E. Shaw, is also one of Relay's founders, alongside Matthew Jacobson, a faculty member in the Department of Pharmaceutical Chemistry at the University of California, Dorothee Kern, Professor of Biochemistry at Brandeis University, and Mark Murcko, a Senior Lecturer at MIT and formerly chief technology officer at Vertex Pharmaceuticals (VRTX).

The company has developed a proprietary platform, Dynamo, which it is using to pioneer a novel drug discovery paradigm based on generating insights into protein motion, a concept the company refers to as Motion Based Drug Design ("MBDD"), leveraging techniques including crystallography, cryoEM, molecular simulations and machine learning.

These techniques allow Relay to gain access to harder to reach targets with small molecules, such as the allosteric sites on proteins, which are responsible for regulating many of a protein's activities. The company's initial focus is on oncology, specifically the treatment of solid tumours, although Relay is confident its techniques may be adapted to treat genetic and other diseases.

Relay's pipeline is early-stage, and consists of 3 candidates, designed to inhibit protein tyrosine phosphatase SHP2, tyrosine kinase receptor FGFR2 and cellular signalling pathway regulator PI3K, respectively, with SHP2 inhibitor RLY-1971 currently undergoing a phase 1 dose escalation study.

Although it is hard to assign a target price to such an early-stage biotech, there are reasons to believe that an investment into Relay at this time may result in gains over the long term.

Thanks to advances in technology, allosteric drug discovery looks set to become an increasingly important and potentially lucrative market within the pharma industry.

Traditionally, drug developers target the more accessible active site of proteins, known as the orthosteric site, but most of the "low-hanging fruit" targets have already been claimed, and treatments developed by early-stage biotechs and Big Pharma, meaning drug developers are having to widen their search and look deeper and with more penetration at alternative targets.

For example, in July 2018, biotech Revolution Medicines (RVMD) licensed an allosteric SHP2 inhibitor to Novartis (NVS) for a $50 million upfront fee, plus up to $500 million of milestone payments, and in 2016, Gilead (GILD) paid $400 million up front and agreed to milestone payments worth $800 million to acquire Nimbus Therapeutics' allosteric Acetyl-CoA Carboxylase (ACC) inhibitor program.

Research suggests that the allosteric sites on proteins offer drug developers the chance to identify and develop safer and more effective treatments, but these treatments are also more expensive to develop. What may give Relay a significant head start is its powerful technology (as described in the video below), which can be leveraged to identify targets with a theoretically higher chance of treatment success, and its advantageous funding position.

With one candidate already in the clinic and two set to follow, investors ought to benefit from regular news flow in the shape of data readouts, investigational new drug ("IND") and biologics license applications ("BLAs"), and potentially, lucrative development and commercial agreements with major pharmas, whilst the field's high barriers of entry ought to keep the competition at bay.

In the rest of this article, I will take a closer look at Relay's team, candidates, strategy and addressable market. Backing Relay may require a leap of faith and patience, but the opportunity to acquire shares at a discount to their IPO price may not exist for long, whilst the financial strength of Relay's backers limits the downside case, in my view, although the company's high cash burn of $84 million in FY19 and $26 million in the first 3 months of 2020 should be noted.

Relay Therapeutics is based in Cambridge, Massachusetts, and was spun out of the biotech accelerator Third Rock Ventures in 2015. Third Rock has backed numerous Nasdaq-listed biotechs, such as bluebird bio (BLUE), Editas Medicine (EDIT), Global Blood Therapeutics (GBT), Sage Therapeutics (SAGE) and Constellation Pharmaceuticals (CNST), with decidedly mixed success to date.

Listed Third Rock Ventures seeded companies share price performance over 5-year period

(Source: TradingView)

I would put the disappointments down to the experimental nature of many of the companies. Sage, for example, looked set to commercialise a novel CNS treatment until a high-profile trial failure decimated its share price, while bluebird bio operates in the gene therapy space, which has failed to make the impact to date that many experts felt it would.

It is still early days for all of these companies, however, and we can also see from the chart above that all of these stocks are highly volatile, providing plenty of opportunities for risk-on investors who time the market right to make strong short- to medium-term gains. Relay is likely to reflect the same trend.

Relay has moved quickly to build a strong management team which is led by President and CEO Sanjiv J Patel, who joined from Allergan, where he was Chief Strategy Officer. Don Bergstrom, ex Merck, Sanofi and Mersana Therapeutics, where he specialised in antibody-drug conjugates, leads Relay's R&D, whilst Pat Walters, who spent 20 years at Vertex Pharmaceuticals, heads up Relay's Computation & Informatics division. Relay's General Counsel is Brian Adams, who joined from Keryx Pharmaceuticals.

The remainder of the senior management team have decades of biotech experience and an impressive array of skill sets, however I highlight the 4 staff above, as I see leadership, the drug-development / clinical trial process, computation and legal as perhaps the most important elements of Relay's strategy.

In order to succeed, the company will need to leverage its technology and the skill of its team to identify and purchase optimised compounds, and ensure the clinical trial process runs smoothly and that excellent relationships with the FDA and other authorities are maintained, whilst protecting its IP, particularly as and when drugs begin to approach the commercialisation stage.

Relay Therapeutics Presentation at AWS Events

(Source: YouTube)

The above video provides an insight into how Relay uses its Dynamo technology to search for and purchase the compounds it then uses to drug proteins.

Initially, the company uses a variety of different techniques to try to model the motion of proteins, attempting to create a more rounded and dynamic set of insights into its activity than can be achieved using the more traditional method of static imaging. In a recent interview, Relay founder Dorothee Kern explained:

In textbooks, the drug simply binds the protein, and then, game over, but in reality, binding is a series of conformational changes, with the compound changing the energy landscape of a protein. The idea is that different compounds can cause different changes. One molecule might shift the protein in a direction that shuts down the active site, while another might turn it on.

The company tries to look at both wild-type and mutant forms of the protein and uses, for example, room temperature X-ray crystallography and Cryo-EM, and the Anton Supercomputer to create a "movie" of how the protein might behave over time, based on calculating the forces between millions of atoms over a minute (slices of 2.5 x10-15 seconds). Compared to other drug developers, Relay says in its IPO prospectus that its simulations are based on a time scale that is 100x longer.

A 10 microsecond simulation of a 1 million atom benchmark protein (satellite tobacco mosaic virus), which requires one day of processing on the Anton 2, would require 271 days on conventional hardware (Nvidia V100). Quote from IPO prospectus.

Relay virtual screening process

(Source: Relay Therapeutics presentation at AWS Events)

Having identified a target protein, Relay then screens tens of billions of possible compounds, which are evaluated and scored according to their chances of being successful, based on characteristics such as potency, binding capabilities, bioavailability and selectivity. The company then purchases a selection of the top-ranked compounds from a "synthesis on demand" provider and proceeds to evaluate them in vitro.

Relay's platform compared to conventional drug discovery programs

(Source: IPO prospectus)

Relay has now developed 2 ready-for-the-clinic, plus 1 experimental candidate. Since the company's process is repeatable, its technology ought to improve over time as in vitro studies and human trials progress, which could lead to the development of drug franchises across a number of indications.

This gives Relay different options. It is sufficiently well-funded to progress candidates independently, which would pay off if one of its candidates is approved and starts to generate blockbuster (+$1 billion per annum) sales, but this is a risky and expensive process that could leave the company empty-handed, having burned through hundreds of millions of dollars.

The alternative option is to use the model favoured by many drug developers, which is to secure commercial partnerships with larger pharmas, who fund drug development programmes in part or often in full after a certain stage of progress has been reached, in return for the rights to market and sell the drug, with the drug-developer receiving a percentage - usually in the low double digits - of all sales, as well as milestone payments when certain key development stages are reached, i.e., a pivotal trial, submission of IND, etc.

The downsides here are the smaller revenues the company will generate (~90% less than when going it alone), and when a pharma signs an agreement in principle to partner on, for e.g., 3 candidates, but opts against taking up the option on candidates 2 and 3 when they are developed, which leaves the developer with nothing to show for its early-stage development work.

A good example of these types of companies and arrangements can be found in the field of RNAi-based treatments, for e.g., Dicerna Pharmaceuticals (DRNA), which has co-development agreements in place with Novo Nordisk (NVO), Roche (OTCQX:RHHBY), Eli Lilly (LLY), Boehringer Ingelheim and Alexion (ALXN), or Arrowhead (ARWR), which works alongside Janssen, a subsidiary of Johnson & Johnson (JNJ) and Amgen (AMGN).

Relay current candidates

(Source: Company website)

Relay's current candidates all address solid tumours and inhibit the signalling pathways of specific proteins to prevent the proliferation of cancerous cells, meaning they may be adapted to treat a wide range of cancers, including many of the most prevalent, for e.g., lung, breast, colorectal, liver and kidney.

RLY-1971 is the most advanced candidate, and like the Revolution candidate I mentioned earlier that was acquired by Novartis, it is an allosteric inhibitor of the protein tyrosine phosphatase ("SHP2"), which helps cancerous cells to spread by relaying messages downstream from receptor tyrosine kinases ("RTKs"). To quote founder Kern again:

You can view an allosteric binder as a knob where you can dial in how much activation or inhibition you want. Nature has built these allosteric networks in for regulation. Lets take advantage of them.

RLY-1971 has only made it as far as a phase 1 dose escalation study with advanced or metastatic solid tumors, enrolling 52 participants, with the primary endpoint being to establish a recommended for a phase 2 trial, but the secondary outcome measures - plasma concentration levels, objective response rate ("ORR") and Disease Control Rate ("DCR") - and other outcome measures, including duration of response ("DOR"), progression free survival ("PFS") and tumor mutations, are highly intriguing and offer plenty of share price catalysts if early signs suggest RLY-1971 has an impactful effect on these measures.

SHP2 monotherapy and combination therapy addressable patient populations

(Source: Relay IPO prospectus)

RLY-4008 is an oral, small molecule, selective inhibitor of FGFR2, which is one of four members of the FGFR family. Whilst it's known that targeting FGFR2 in patients with intrahepatic cholangiocarcinoma has demonstrated clinical proof of concept, developers have only been able to produce non-selective, pan-FGFR inhibitors to date, which cause collateral damage by also inhibiting FGFR1, which causes hyperphosphatemia.

Prevalence of hyperphosphatemia in non-selective FGFR inhibitors

(Source: Relay IPO prospectus)

Relay has used its computational models to discover motion-based differences between the two protein types, making it easier to actively target FGFR2 without inhibiting the other family members. This is a great example of how the company's processing power can make the difference when targeting the more complex allosteric site over the orthosteric.

Finally, RLY-PI3K1047 is another signalling pathway regulator, targeting PI3K, which research has indicated may be the most frequently mutated kinase in cancer. Using Dynamo, Relay has been able to model the first full-length protein structure of PI3K, which is important, since prior attempts to inhibit the protein's functions have usually resulted in intolerable levels of toxicity. If the protein can be better understood and mapped, it may unlock the secret to a more effective and safer anti-tumor treatment.

Market value indication of PI3K inhibition

(Source: Relay IPO prospectus)

Relay says it is already leveraging Dynamo to produce 3 more precision oncology programs, and with most of the pieces in place - management, funding, technology and access to funding - required to operate a company successfully, there seems to be little standing in the way of the company rolling out many more candidates over the coming years.

Although there will be volatility in the short term, patience may be the key to holding Relay stock. The company's strategy is predicated upon developing computational analysis of proteins and their functions to new and higher levels of complexity, and generating superior insights, hence it does not want to get pressured into releasing candidates before they are ready purely in order to satisfy the market's demand.

Relay's cash burn - currently at ~$100 million per annum (based on Q120 spend of $26 million) is high and likely to increase substantially as the number of candidates increases and clinical trials begin in earnest. Having listed, fresh funding is likely to come from, and therefore dilute, investors once the current ~$800 million or so of funding is exhausted. This should not happen for at least 18 months at the earliest, however.

It can be very tricky for a layperson investor to get to grips with different drug developers' technologies and decide which are likely to succeed and which aren't, but it is possible (although not always advisable) to look at who else is invested in the company's success.

Relay Chairman and founding investor Alexis Borisy was the founder of Foundation Medicine, acquired by Roche for $5 billion. Another board member, Linda A Hill, is Professor of Business Administration at the Harvard Business School, whilst another, Douglas Ingram, is President and CEO of Sarepta Therapeutics, a commercial-stage biotech that has grown its share price by 344% over the past 5 years.

I would advise against an investment in Relay if you are not won over by the technology side of the business, but despite the fact it is still relatively unproven, and it may be years or even decades away from reaching its peak (based on the ongoing struggles of, for e.g., CAR-T therapy, gene therapy, and RNAi to make a significant impact on the global oncology or other disease markets), it seems a reasonable thesis to me that examining the activities of proteins in more detail can ultimately result in the development of superior treatments.

Since there ought to be no shortage of short-term catalysts as Relay and Dynamo start to reach full-throttle, and based on the overall performance of other Third Rock Venture seeded companies (which suggests a strong culture of good management, oversight and financial planning), I would consider Relay to be a reasonable investment opportunity at a price of $35.3, and as any experienced biotech investor will know, a positive set of data that suggests above standard-of-care efficacy can easily move a stock price by anything from 10% - >100%.

Longer term, Relay appears (in my view) to have an above average chance of graduating to a mid-stage biotech with commercialised products, which gives the current share price plenty of upside potential, in my view.

Gain access to all of the market research and financial analytics used in the preparation of this article plus exclusive content and pharma, healthcare and biotech investment recommendations and research / analytics by subscribing to my channel, Haggerston BioHealth.

Disclosure: I/we have no positions in any stocks mentioned, but may initiate a long position in RLAY over the next 72 hours. I wrote this article myself, and it expresses my own opinions. I am not receiving compensation for it (other than from Seeking Alpha). I have no business relationship with any company whose stock is mentioned in this article.

Excerpt from:
Relay Therapeutics: Heavily Backed Biotech Brains Trust Looks A Long-Term Buy - Seeking Alpha

Recommendation and review posted by Bethany Smith

Manufacturing cell therapies is technically and financially demanding; as a result, despite therapy developers gradually strengthening their in-house expertise, they are also becoming increasingly reliant on contract service providers

Roots Analysis is pleased to announce the publication of its recent study, titled, Cell Therapy Manufacturing Market (3rd Edition), 2019 2030.

The report features an extensive study of the current market landscape and future opportunities associated with cell therapy manufacturing. It focuses on both contract manufacturers, as well as developers with in-house manufacturing facilities, offering in-depth analyses of the various business entities that are engaged in this domain, across different global regions. Amongst other elements, the report includes:

Read Detailed Analysis: https://www.rootsanalysis.com/reports/view_document/cell-therapy-manufacturing/285.html

A detailed market forecast, featuring analysis of the current and projected future opportunity across key market segments (listed below)

Type of therapy

Source of cells

Scale of operation

Purpose of manufacturing

Key geographical regions

Key companies covered in the report

For more information, please click on the following link:

https://www.rootsanalysis.com/reports/view_document/cell-therapy-manufacturing/285.html

About Roots Analysis

Roots Analysis is one of the fastest growing market research companies, sharing fresh and independent perspectives in the bio-pharmaceutical industry. The in-depth research, analysis and insights are driven by an experienced leadership team which has gained many years of significant experience in this sector. If youd like help with your growing business needs, get in touch at [emailprotected]

Contact Information

Roots Analysis Private Limited

Gaurav Chaudhary

+1 (415) 800 3415

[emailprotected]

View post:
Cell Therapy Manufacturing Market is estimated to reach close to USD 11 Billion by 2030 - Scientect

Recommendation and review posted by Bethany Smith

SAN FRANCISCO, Sept. 3, 2020 /PRNewswire/ --Invitae (NYSE: NVTA), a leading medical genetics company, today announced enrollment has begun for a nationwide study to better understand the role of current genetic testing guidelines in ensuring prostate cancer patients receive testing to identify clinically relevant genetic variants that can inform prognosis and support access to targeted therapies. The study is supported by Invitae and is part of the company's ongoing work to increase access to genetic information for men with prostate cancer.

"Currently, germline testing guidelines for patients with prostate cancer have evolved from more than one set of NCCN guidelines and some may still find these guidelines difficult to implement in everyday practice," said Neal D. Shore, M.D., F.A.C.S. from the Carolina Urologic Research Center in Myrtle Beach, South Carolina, and the principal investigator of the study. "Guidelines were established when testing was both more expensive and less accessible and don't address newer therapeutic approvals and trial literature for expanding therapeutic options, missing many patients whose clinical care and treatment choices could benefit from genetic information. Our study is intended to provide a deeper understanding of how these issues impact the care of men with prostate cancer so that we might improve how genetic information can be assessed and utilized for their cancer care and potentially inform their family members."

The use and importance of genetic information in the diagnosis and treatment of prostate cancer has been growing, particularly as the development of targeted treatments continues to accelerate. Despite its utility, guidelines governing testing among prostate cancer patients remain restrictive, and genetic information is underutilized in prostate cancer care. The study will determine whether guidelines are adequate in identifying patients who may benefit from genetic testing.

"Simplifying and possibly expanding current testing guidelines would provide benefits for medical management of men with prostate cancer and offer opportunities for targeted therapies, including PARP inhibitors and qualification for clinical trials," said Robert Nussbaum, M.D., chief medical officer of Invitae. "In addition, the genes involved in prostate cancer include BRCA1 and 2, which as we all know also play an important role in breast and ovarian cancer, and MSH6 and other genes involved in hereditary colon cancer. Widespread testing among men with prostate cancer could have an important role in not only improving their care but also the health of their relatives."

The study will enroll men across the country who have been diagnosed with prostate cancer. Both men who meet and don't meet current testing guidelines will be included to gather data on whether genetic testing results change treatment and recommendations. In addition, the study will also gather data on the patient's experience with genetic testing.

A study presented recentlyby Invitae at the American College of Medical Genetics and Genomics (ACMG) underscored the frequency of actionable variants expanded testing can help uncover. The study of 2,252 men found an overall positive rate of 13% with no statistical differences in rates among stages of disease. Only half of patients with an actionable variant reported a family history suggestive of increased risk. Nearly three-quarters (71%) of positive patients were eligible for management guidelines and/or potentially eligible for approved precision therapies or clinical trials.

An estimated three million men are living with prostate cancer in the U.S., and just under 200,000 are newly diagnosed each year.

Contact clinicalstudies@invitae.com for more information about the study.

About InvitaeInvitae Corporation(NYSE: NVTA) is a leading medical genetics company whose mission is to bring comprehensive genetic information into mainstream medicine to improve healthcare for billions of people. Invitae's goal is to aggregate the world's genetic tests into a single service with higher quality, faster turnaround time, and lower prices. For more information, visit the company's website atinvitae.com.

Safe Harbor StatementThis press release contains forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995, including statements relating to the use and importance of genetic testing and information; and the benefits of simplifying and possibly expanding current testing guidelines for men with prostate cancer. Forward-looking statements are subject to risks and uncertainties that could cause actual results to differ materially, and reported results should not be considered as an indication of future performance. These risks and uncertainties include, but are not limited to: the company's history of losses; the company's ability to compete; the company's failure to manage growth effectively; the company's need to scale its infrastructure in advance of demand for its tests and to increase demand for its tests; the company's ability to use rapidly changing genetic data to interpret test results accurately and consistently; security breaches, loss of data and other disruptions; laws and regulations applicable to the company's business; and the other risks set forth in the company's filings with the Securities and Exchange Commission, including the risks set forth in the company's Quarterly Report on Form 10-Q for the quarter ended June 30, 2020. These forward-looking statements speak only as of the date hereof, and Invitae Corporation disclaims any obligation to update these forward-looking statements.

Contact:Laura D'Angelopr@invitae.com(628) 213-3283

Originally posted here:
Multi-site study to evaluate the role of testing guidelines in ensuring access to genetic information for men with prostate cancer - KPVI News 6

Recommendation and review posted by Bethany Smith

Boston startup Orig3n logged hundreds of false-positives as it processed COVID-19 tests for dozens of Massachusetts long-term care facilities. According to an Orig3n spokesman, the company continues to offer COVID-19 testing elsewhere in the U.S.

A Boston consumer genetics company that has batted away former employees accusations of shoddy practices since at least 2019 is now under investigation by the state Department of Public Health for logging hundreds of false positive coronavirus test results.

The company, Orig3n, has halted COVID-19 testing in the state. A company spokesman said the false positives were due to "human error" in processing the tests.

In August, after learning about the Massachusetts investigation, North Carolina issued a stop order for its coronavirus testing contract with Orig3n.

The consumer genetics startup, which claims it can tell customers what kind of foods they should eat and whether theyre predisposed to intelligence based on their DNA, has secured some of the biggest coronavirus testing contracts in the country.

According to an Orig3n spokesman, the company continues to offer COVID-19 testing elsewhere in the U.S.

So far, the Massachusetts DPH has found Orig3n sent out more than 300 COVID-19 tests wrongly classified as positive in Massachusetts, a number that could increase as DPH staff continue investigating. Orig3n claims the company isnt aware of any additional false positives. According to a Harvard epidemiologist and lab director, false negatives are far more difficult to discover, because most tests come back as negative.

Ted Owens, CEO at North Hills Pines Edge skilled nursing facility in Needham, one of roughly 60 long-term care facilities that used Orig3n test services, said in an Aug. 11 bulletin to residents and staff that Orig3n returned a total of 19 false positives to the nursing home.

The numbers didnt seem credible to Owens, but Pines Edge began immediately to take actions based on the working assumption that we needed to treat these results as correct.

It turned out that several other skilled nursing facilities also showed an unusual spike in positive cases last week, and oddly enough, all these facilities had used the same testing vendor, Owens continued. This caught the attention of the epidemiologists at Mass DPH, who intervened and instructed the vendor to re-test the samples."

Upon retesting, all of the positive tests were found to be negative.

The spike in cases which turned out to be false positives caused panic in Needham. They came as the school district made plans to return to in-person learning, and a public health nurse for the town was asked to appear before the Select Board.

Needham public health nurse Tiffany Zike told the board on Aug. 18 that a number of coronavirus cases reported in July were considered false cases that were revoked due to the lab having an issue.

$25,000 wire transfer

In early May, nursing homes throughout Massachusetts were looking for a miracle.

The DPH had ordered long-term care facilities coping with severe coronavirus outbreaks to test 90% of residents and staff for COVID-19 by May 25 in order to qualify for a portion of $130 million in relief funding offered by the state.

Many nursing homes struggled to meet the deadline because of a shortage of COVID-19 tests. The National Guard was testing nursing home residents and staff on behalf of the state, but demand was high.

When Ron Doty got a memo from the Massachusetts Senior Care Association on May 6 offering Orig3n as a turnkey mobile testing option, he immediately reached out to the company.

Doty, administrator at Marlborough Hills Rehabilitation & Health Care Center in Marlborough, wired $25,000 to Orig3n. The next day, he received 250 COVID-19 test kits from the company.

Two months later, Orig3n was asked to suspend COVID-19 testing in Massachusetts, which it did on Aug. 8. Staff at the DPH noticed the lab was reporting an unusually high rate of positive tests, prompting the agency to investigate, according to a DPH spokesperson.

The state DPH declined to identify which nursing homes used Orig3ns testing services, citing the ongoing investigation.

Tony Plohoros, Orig3ns spokesman, said the lab is now working with state health officials to correct problems in its Boston lab, which has ceased processing coronavirus samples but continues to process consumer genetic profiles.

While it remains unclear if the federal government has taken action to halt use of Orig3ns COVID-19 testing services in other parts of the country, as North Carolina did, concerns about Orig3n hadnt yet reached a health care supply company in Ohio as of this week. That company, Mason, Ohio-based Link-age Solutions, is still working with Orig3n to provide coronavirus tests to long-term care facilities nationwide.

Patrick Schwartz, a spokesman for Link-age Solutions, said Thursday that the company was unaware Orig3n was asked to cease coronavirus testing in Massachusetts.

One of the highest accuracy ratings in the market

Orig3n received an emergency authorization to conduct COVID-19 testing from the Food and Drug Administration in April.

The same month, the company received a federal Paycheck Protection Program loan valued between $350,000 and $1 million from Silicon Valley Bank, according to U.S. Treasury data.

Since getting the FDA approval, Orig3n has provided testing services to The New England Power Generators Association, Bostons homeless population, a boarding school in Virginia and other public and private entities.

In late June, Link-age Solutions, which helps long-term care facilities nationwide obtain supplies ranging from pharmaceuticals to office supplies, issued a press release touting Orig3ns breakthrough testing method as having one of the highest accuracy ratings in the market.

In partnering with Orig3n, Link-age could offer in-demand coronavirus tests to its members at a reduced cost, according to the press release. Results would be returned less than 36 hours after specimens arrived at the lab, the release said.

The lab boasts output capabilities of 6,000 and up to 12,000 tests per day, and will offer billing to Medicare where appropriate, the press release stated. Reporters questions to the Centers for Medicare & Medicaid Services have gone unanswered.

Schwartz, the Link-age spokeman, said Thursday his company continues to offer COVID-19 testing services performed by Orig3n, and that feedback about Orig3ns tests from its customers has been positive.

Company flagged in the past

Orig3n lists its office location as the third floor of 27 Drydock Ave. in the heart of Bostons Seaport neighborhood. Until August, thats where the company processed its coronavirus tests.

Before it got into the coronavirus business, Orig3n billed itself as a consumer genetics pioneer, carving a path toward a future of wellness and health through the use of diagnostics, genetics and biotechnology.

The company, founded in 2014, offers tests ranging in cost from $29 to $298 that are supposed to help people learn what kinds of food, exercise and beauty products would work best for their genetic profiles, and even whether they are genetically predisposed to so-called superhero traits including intelligence and strength, according to Bloomberg Businessweek.

A former Orig3n employee who spoke to Gannett New England reporters on the condition of anonymity because of a nondisclosure agreement with the company said the number one complaint received by customer service was genetic profile tests not being returned to customers. The employee, who left the company pre-pandemic, didnt think the company could handle both genetic profile testing and coronavirus testing.

Unless things drastically changed since I have left, not even testing, just bandwidth-wise, they were already kind of drowning when I left, the employee said.

Despite its startup status, Orig3n quickly gained prominence partly through securing big-name partnerships, including one with the NFLs Baltimore Ravens.

In September 2017, the Ravens linked up with Orig3n for an event called DNA Day. Roughly 70,000 Ravens fans were set to pour into the teams stadium, where they could have picked up a free genetic testing kit.

The event never happened. The Ravens postponed it days before federal health officials told The Baltimore Sun they were working to determine whether any of the testing being offered by Orig3n is subject to the requirements of the Clinical Laboratory Improvement Amendments of 1988.

The federal regulatory standards apply to labs testing human samples in the United States, and are intended to ensure accuracy, effectiveness and reliability.

About a year after DNA Day was scrapped, 17 former Orig3n employees criticized the company in Bloomberg Businessweek, alleging it habitually cut corners, tampered with or fabricated results, and failed to meet basic scientific standards.

Marketing, not science, the employees said, was the companys priority.

Press releases put out by Orig3n throughout the pandemic show the company was eager to publicize contracts with respected institutions, both public and private.

On May 12, the company announced what it called a comprehensive solution to enable COVID-19 testing for Massachusetts nursing home residents.

In the press release, the company said it sought to become the partner of choice for coordinating and providing COVID-19 testing for defined populations beyond long-term care residents and employees, including private employers, schools, government agencies, and cities and states.

The nursing home program is one of many applications for Orig3ns fully-integrated solution, the press release said.

What went wrong?

Doty, the Marlborough nursing home administrator, would not have known about Orig3n if not for the May 6 memo from Massachusetts Senior Care Association, an organization many nursing homes relied on during the viruss spring surge in the state to interpret complex and shifting guidance from the DPH.

Massachusetts Senior Care Association President Tara Gregorio said in a statement that her organization essentially serves as a messenger for its members, and that it relies on governmental agencies to vet labs like Orig3n.

"Throughout the pandemic, MSCA has passed along lists of government approved COVID-19 PCR testing labs options available to our members, Gregorio wrote. We must rely, as all providers do, on the licensing process to ensure legitimacy and accuracy of these labs."

The FDA, which gave Orig3n emergency authorization to conduct coronavirus testing last spring, has not yet responded to Gannett New England reporters seeking comment.

According to a Massachusetts DPH spokesman, Orig3n told the agency after it was contacted by DPH that errors in testing occurred because of a broken vial or contaminated plate during final processing, an explanation DPH investigators are now trying to confirm.

In an email to Gannett New England reporters on Friday, Plohoros, Orig3ns spokesman, said human error at the beginning of the laboratory testing process caused a pre-extraction reagent that was used in the affected batch tests to become contaminated.

In an Aug. 18 press conference, Massachusetts Secretary of Health and Human Services Marylou Sudders said erroneous results from Orig3n affected the number of COVID-19 cases reported in Fall River and Taunton.

The positive test rates for that three-day period for that one lab just seemed high, and so (we) went back, and the lab stopped processing, they're still not processing any tests, Sudders said, adding that DPH staff was analyzing tests processed prior to the discovery to make sure the issue was, as Orig3n told the DPH, a one-time problem rather than a more structural issue.

Dr. Michael Mina is an assistant professor of epidemiology at Harvard T. H. Chan School of Public Health who has experience running laboratories that perform PCR testing.

Mina says a lab that processes 6,000 to 12,000 PCR coronavirus tests a day as Orig3n has said it does would need to be run with what he called extreme quality control measures.

It requires an amazing amount of concentration and care to really ensure you're not getting contamination or any number of other problems that can happen, he said. If this was an easy (test), I would have said, sure, any lab can do it but this particular (test) ... it really is a finicky test. You have to be extremely careful about how you're doing it, and that means you need a lot of quality controls. You need to be a really diligent lab.

Mina, who stressed he has no knowledge of Orig3n other than circulating allegations that the company had previously been investigated, said when a mistake like the kind Orig3n described occurs, staff should immediately stop processing, sterilize the area and alert any affected patients and health departments.

The fact that the Massachusetts DPH noticed the problem and not Orig3n is a problem, Mina said.

That shows in general that the quality control wasn't being maintained, he said, adding that performing intense quality control checks multiple times daily is a core tenet of running any lab, especially a high-complexity clinical lab. And if we're giving them the benefit of the doubt, they didn't know that there was a problem because otherwise it's just nefarious.

Mina said that a professionally run lab would likely have caught the mistake, and alerted the state DPH immediately.

Part of the reason for that is simply a motive to care for the patient, who will likely make important decisions about their own behavior based on the test result they receive, which in turn affect other people.

At Brigham, for example, where I was one of the medical directors, of course people feel embarrassed (about making a mistake), but there's this strong culture where people recognize that their embarrassment is not worth a patient's hardship, Mina said. That's one thing that really, I think, lacks a little bit when we move into industry laboratories running clinical tests. That same spirit of honesty ... might not exist everywhere.

While mistakes at labs are common, Mina said, they're also commonly fixed and they don't usually require an investigation.

Mina said that the U.S. did need to increase its capacity to process coronavirus tests this spring, but labs, especially ones new to the medical diagnostics space, as Orig3n is, need to be monitored closely.

It's just important to keep all these things in check, Mina said. The frenzy to do coronavirus testing has been so extreme. I don't think labs should be immediately shut down for mistakes, but we have to remain vigilant to ensure that all the testing that is being done is up to the highest standards.

Trevor Ballantyne and Jeannette Hinkle are reporters for Gannett New England.

Originally posted here:
The sudden spike in Mass. COVID-19 cases was jarring. Now, the company that did the tests is under investigation. - The Gardner News

Recommendation and review posted by Bethany Smith

John Wagner was 38 when he was diagnosed with late stage colon cancer, a story that resembles the late Chadwick Boseman.

LOUISVILLE, Ky. The sudden death of actor Chadwick Boseman has everyone talking about colon cancer that ended his life at 43.

It's a reminder of the cancer risk that's rising among younger generations, even more so for Black men in this country.

This week, the American Cancer Society said it saw an 8,000% increase in traffic to its colorectal cancer symptoms page since Boseman's passing. It's a combination of colon and rectal cancers (CRC), often grouped together because they have many features in common.

"When I first figured out I had colon cancer, I was 38 years old," John Wagner said.

Wagner wasn't scheduled for a colonoscopy for another 6 years. He had no family history and considered himself a healthy guy, when he started feeling weak, having severe constipation and blood in his stool.

"He didn't smoke, or drink or do anything, and here you get this diagnosis, and you're like, wait. 'How did I get here?'" his fianc, Sharise Durrett said.

Multiple doctors sent him home without screening for cancer. At least one brushed it off as diverticulitis.

"I kept asking. They said, I was too young," said Wagner. "If it wasn't for that ER nurse, no telling what might have happened."

Durrett encouraged him to go to the ER where he received a colonoscopy. That's when they found the cancer. It had already spread to his liver.

Wagner's case is one of 145,000 new colorectal cases diagnosed in the U.S. every year. While the majority are in adults older than 50, it's the younger generation that's seen a rapid increase of cases over the last decade, and if you're Black, your risk is 20% higher than most, which increases even more for men, who are already 30% higher than women in the risk category.

The reasons are not clear, but doctors have general ideas.

"We know there are risk factors, like diet, exercise, smoking, obesity, and things like that, that play into this, but I think access plays a big part of that," Dr. Michael Driscoll, a medical oncologist, with Norton Cancer Institute said.

Insurance for most people, will only cover the costs of cancer screenings, if they're at or above the recommended age. For colon cancer, it's 45, unless you have a family history. In that case, screening should start earlier at age 40 or 10 years sooner than the age their relative was diagnosed.

"Any person with CRC under the age of 50 should also undergo genetic testing to make sure they are not dealing with a hereditary cause, such as Lynch Syndrome, which affects 1 in 279 of all races and both sexes," Dr. Whitney Jones, with the Colon Cancer Prevention Project said. "It's the most common cause of genetic colon cancer in America. Family history is critical."

"The colonoscopy is the gold standard," Dr. Driscoll said.

The problem: it's developing well before our golden years, and often times, has already spread before we start experiencing symptoms.

If this is happening to you, demand a test and nothing less.

"Colon cancer is 90 percent preventable," Dr. Driscoll said.

Still, close to 53,000 colon cancer patients will die this year. "Black Panther" star Chadwick Boseman was one of them.

"We were actually watching television together when it came on as breaking news," said Durrett. "It felt as if Chadwick was a member of our family because at that moment, John's life and Chadwick's life were parallel. There were so many similarities, it was scary."

She said the two sat in silence for the next 10 minutes. They know the numbers aren't in their favor.

People with Stage 4 Colon Cancer have less than a 10% survival rate.

"Ultimately, God has the final say," Durrett said.

But that's not stopping Wagner from trying.

"My goals are set high. I'm going to beat this. I can't let it get me down. There's no giving up," Wagner said.

In Kentucky, about 70% of people above the age of 50 get screened. It's about 68% in Indiana. Dr. Driscoll says that's not good enough.

Kentucky leads the nation in both under age 50 CRC incidence and overall CRC incidence. "But our screening rates are improving more rapidly than any state in the nation," Dr. Jones said. "Also, due to the long work of many organizations, screening rates and outcomes are equal for both blacks and whites. Our greatest disparity in outcomes is actually in Appalachia."

Kentucky state laws - by statute - in CRC screening coverage, follow the American Cancer Society guidelines, stating people with no family history of polyps or CRC can be covered for screenings at age 45. Medicaid's included.

Dr. Jones says, "on-time screening at age 45 with a colonoscopy or home stool tests (FIT or stool DNA, Cologuard) will save many lives if we can get the word out. Choice gets more people engaged in screening due to shared decision making."

Contact reporter Brooke Hasch atbhasch@whas11.com. Follow her onTwitter (@WHAS11Hasch)andFacebook.

Make it easy to keep up-to-date with more stories like this. Download the WHAS11 News app now. ForAppleorAndroidusers.

Have a news tip? Emailassign@whas11.com, visit ourFacebook pageorTwitter feed.

Link:
'I kept asking, they said I was too young' | The risks of colon cancer - WATN - Local 24

Recommendation and review posted by Bethany Smith

However, the chances of taking home a baby are still largely dependent on a woman's age and the IVF clinics treating them. Individual clinic success rates range between 7 per cent and 31 per cent of cycles.

There were 14,355 babies born via IVF from 76,341 IVF cycles in 2018 according to the report collated by the National Perinatal Epidemiology and Statistics Unit at UNSW and funded by the FSA. This is up from 13,752 IVF babies in 2017.

The report covers all IVF cycles undertaken in Australian and New Zealand clinics in 2018 and the resulting babies born in 2018 and 2019.

IVF clinics are increasingly doing "freeze-all" cycles, in which all the eggs or embryos collected in a cycle are cryopreserved rather than transferring a fresh embryo.

The proportion of freeze-all cycles doubled in five years from 13 per cent to 26.7 per cent in 2018.

Professor Rombauts said the main driver of the freeze-all trend was the rise in pre-implantation genetic testing, in which embryos are screened for chromosomal abnormalities in the hope of selecting only the healthy embryos to transfer.

"For women over 35 in particular genetic screening can be beneficial, when there is a higher risk of abnormalities," he said.

"Genetic testing can reduce the time, money, energy and trauma it takes to have a healthy live birth because you're potentially not transferring embryos that are doomed to fail."

However, growing evidence suggests there could be a small risk that pre-implantation genetic testing could lead to viable embryos being discarded by incorrectly flagging them as abnormal.

Loading

"For women under 35 I would certainly not recommend it it's an extra manipulation on the embryos and an extra cost," Professor Rombauts said. "But for older women, it can be an important test and I would raise it as an option because there is potential benefit."

Laura Smith, 34, from Forest Lodge is the proud mother of 4-month-old Hunter after undergoing IVF at Genea. "For me, he's perfection and everything I ever wanted," she said.

Ms Smith, who has polycystic ovarian syndrome, and her husband Ben spent a couple of years trying to conceive naturally then about a year trying other fertility treatment before turning to IVF.

Her eggs were harvested in one cycle and the embryo that became Hunter implanted a month later, while the others are frozen for future use. The couple intend to try for a second child fairly quickly.

It's an absolutely fantastic thing that we've been given this technology ... who knows if I would have had a baby by now if I didn't have IVF?

"I was very lucky I fell pregnant the very first round of IVF and I had no complications or issues," Ms Smith said. "It's an absolutely fantastic thing that we've been given this technology and the ability to be able to have babies in this way who knows if I would have had a baby by now if I didn't have IVF?"

She opted to use a frozen embryo because of medical advice it would improve her odds to harvest and implant on different cycles and to enable genetic testing.

IVF clinics are reporting dramatic differences in their success rates. One clinic had a live birth rate of roughly 7 per cent of initiated cycles, compared to 31.5 per cent at the clinic with the highest success rate.

The clinics were not identified in the report and should be interpreted with caution. For instance, some clinics may specialise in second referrals for complex patients, older women, or younger, uncomplicated cases.

Loading

A new federal-government-funded website will soon give would-be parents access to individual clinic success rates and their own chances of taking home a baby after undergoing IVF based on their individual characteristics.

The 'My IVF Success' website is expected to be ready to launch before the end of the year in response to growing calls for greater transparency in the sector.

Age is still a powerful determiner of IVF success, with younger women having better chances. For women under 30 years, live birth rate per fresh embryo transfer was 40.4 per cent compared to 9.5 per cent for women aged 40 to 44.

For frozen embryo transfers, the live birth rate was 34.9 per cent in women under 30, and 20.1 per cent for women aged 40 to 44.

Professor Georgina Chambers, the report's lead author and Director of UNSW's National Perinatal Epidemiology and Statistics Unit said the higher live birth rate for older women via frozen cycles was mostly because the embryo was created in an earlier fresh cycle when she was younger.

"It's also because we're increasingly using pre-implantation genetic testing to select the healthy embryos for transfer rather than putting back embryos that aren't viable," Professor Chambers said.

In 2018, the average age of women using their own eggs was 35.8 years about five years older than the median age at which women, in general, gave birth in Australia (30.7 years).

The average age of women using donor eggs or embryos was 40 and the average age of male partners of women undergoing IVF was 38.1 years old.

The proportion of twins and triplets born via IVF treatment is now a record low 3.2 per cent in Australia and New Zealand thanks to the decrease in multiple embryo transfers in the one cycle.

with Caitlin Fitzsimmons

Kate Aubusson is Health Editor of The Sydney Morning Herald.

More here:
'Quite amazing': One in 10 babies born to women over 35 now conceived via IVF - Sydney Morning Herald

Recommendation and review posted by Bethany Smith

Reportspedia has recently come up with a new market research report titled, Direct-To-Consumer (DTC) Genetic Testing Market. This statistical market study compromises an extensive understanding of the present-day and impending stages of the industry market based on factors such as major research skills, management schemes, drivers, restraints, opportunities, challenges and visions include the subdivisions in the industries and regional distribution. The report comprises detailed study of the potential segments including product type, application, and end-user and their contribution to the overall market size.

Get Free Pdf Sample Copy of this [emailprotected]:

https://www.reportspedia.com/report/-life-sciences/2015-2027-global-direct-to-consumer-(dtc)-genetic-testing-industry-market-research-report,-segment-by-player,-type,-application,-marketing-channel,-and-region/63990#request_sample

Top Players of Direct-To-Consumer (DTC) Genetic Testing Market are:

Myriad GeneticsGeneByGeneDNA DTC23andMeMD RevolutionNavigenicsDeCODEmeGenecodebook OyGenetrainer

The regional analysis of Direct-To-Consumer (DTC) Genetic Testing Market is considered for the key counties such as Asia Pacific, North America, Europe, Latin America and Rest of the World. North America is the wildest upward region crosswise the world in terms of market share. Where, owing to the countries such as China, Japan, and India, Asia Pacific region is anticipated to be the leading region during 2020-2026.

The market specialists and researchers have done all-encompassing breakdown of the global Direct-To-Consumer (DTC) Genetic Testing Market with the benefit of research methodologies such as PESTLE and Porters Five Forces analysis. They provide accurate and consistent market data and useful recommendations with an aim to support the players gain an insight into the overall present and future market scenario. The report provides key statistics on the market status, size, share, growth factors of the Global Direct-To-Consumer (DTC) Genetic Testing industry.

Get discount on this comprehensive report, Ask For Discount: https://www.reportspedia.com/discount_inquiry/discount/63990

KEY MARKET SEGMENTS

On the basis of types, the Direct-To-Consumer (DTC) Genetic Testing Market is primarily split into:

Genome Data Bank Material ModelIndividual Health Planning ModelComprehensive Genome Tests ModelMedical Precision Tests ModelRestricted Trait Tests Model

On the basis of applications, the Direct-To-Consumer (DTC) Genetic Testing Market covers:

HospitalDoctors OfficeOther

Key Pointers of the Report:

Do Inquiry Before Purchase @https://www.reportspedia.com/report/-life-sciences/2015-2027-global-direct-to-consumer-(dtc)-genetic-testing-industry-market-research-report,-segment-by-player,-type,-application,-marketing-channel,-and-region/63990#inquiry_before_buying

This research report represents a 360-degree overview of the competitive landscape of the Meat Ingredients Market. Likewise, it offers enormous data relating to current trends, technological advancements, tools, and methodologies.

The Direct-To-Consumer (DTC) Genetic Testing report thoroughly upholds the up-to-date state of dynamic segmentation of the Direct-To-Consumer (DTC) Genetic Testing Industry, highlighting major and revenue efficient market segments comprising application, type, technology, and the like that together coin lucrative business returns in the Direct-To-Consumer (DTC) Genetic Testing market.

Table ofContents

Get Full [emailprotected]https://www.reportspedia.com/report/-life-sciences/2015-2027-global-direct-to-consumer-(dtc)-genetic-testing-industry-market-research-report,-segment-by-player,-type,-application,-marketing-channel,-and-region/63990#table_of_contents

Read the original:
Global Direct-To-Consumer (DTC) Genetic Testing Market Research Report by Type, by Share, by Product, by End-User Global Forecast to 2027 Cumulative...

Recommendation and review posted by Bethany Smith

Final Report will add the analysis of the impact of COVID-19 on this industry.

The report on the Preimplantation Genetic Testing Market covers the current status of the market including Preimplantation Genetic Testing market size, growth rate, recent developments, prominent players, market dynamics, and current competitive landscape. Furthermore, the report analyzes future opportunities, demand, growth factors, and forecasts the market assessing the strategies of the key players in terms of mergers and acquisitions, technological advancements, R&D investments. Moreover, the report also analysis strength, weakness, threats, and opportunity in terms of SWOT analysis along with present and future effects of COVID-19 on the Preimplantation Genetic Testing market.

The global Preimplantation Genetic Testing market size is projected to reach USD 499.9 million by 2026, from USD 356.8 million in 2020, at a CAGR of 5.8% during 2021-2026.

Get a Sample PDF of report @https://www.industryresearch.biz/enquiry/request-sample/16279735

Market Analysis and Insights: Global Preimplantation Genetic Testing Market

The major players in the market include:

To Understand How Covid-19 Impact Is Covered in This Reporthttps://www.industryresearch.biz/enquiry/request-covid19/16279735

The report identifies various key manufacturers of the market. It helps the reader understand the strategies and collaborations that players are focusing on combat competition in the market. The comprehensive report provides a significant microscopic look at the market. The reader can identify the footprints of the manufacturers by knowing about the global revenue of manufacturers, the global price of manufacturers, and production by manufacturers during the forecast period of 2015 to 2019.

On the basis of product, this report displays the production, revenue, price, market share and growth rate of each type, primarily split into:

On the basis of the end users/applications, this report focuses on the status and outlook for major applications/end users, consumption (sales), market share and growth rate for each application, including:

Get a sample copy of the Preimplantation Genetic Testing Market report 2020-2026

The report provides country-wise revenue and volume sales analysis and region-wise revenue and volume analysis of the global Preimplantation Genetic Testing market.The major regions covered in the report are:

Key Reasons to Purchase Preimplantation Genetic Testing Market Report:

Enquire before purchasing this reporthttps://www.industryresearch.biz/enquiry/pre-order-enquiry/16279735

Some of the key questions answered in this report:

Global Preimplantation Genetic Testing Market providing information such as company profiles, product picture and specification, capacity, production, price, cost, revenue and contact information. Upstream raw materials and instrumentation and downstream demand analysis is additionally dispensed. The Global Preimplantation Genetic Testing market development trends and marketing channels are analyzed. Finally, the feasibility of latest investment projects is assessed and overall analysis conclusions offered.

Years considered for this report:

With tables and figures helping analyse worldwide Global Preimplantation Genetic Testing market trends, this research provides key statistics on the state of the industry and is a valuable source of guidance and direction for companies and individuals interested in the market.

Purchase this report (Price 3350 USD for a single-user license)https://www.industryresearch.biz/purchase/16279735

Some Points from TOC:

1 Study Coverage1.1 Preimplantation Genetic Testing Product Introduction1.2 Market Segments1.3 Key Preimplantation Genetic Testing Manufacturers Covered: Ranking by Revenue1.4 Market by Type1.4.1 Global Preimplantation Genetic Testing Market Size Growth Rate by Type1.4.2 Type 11.4.3 Type 21.4.4 Type 31.4.5 Others1.5 Market by Application1.5.1 Global Preimplantation Genetic Testing Market Size Growth Rate by Application1.5.2 Application 11.5.3 Application 21.5.4 Application 31.5.5 Others1.6 Study Objectives1.7 Years Considered

2 Executive Summary2.1 Global Preimplantation Genetic Testing Market Size, Estimates and Forecasts2.1.1 Global Preimplantation Genetic Testing Revenue 2015-20262.1.2 Global Preimplantation Genetic Testing Sales 2015-20262.2 Global Preimplantation Genetic Testing, Market Size by Producing Regions: 2015 VS 2020 VS 20262.2.1 Global Preimplantation Genetic Testing Retrospective Market Scenario in Sales by Region: 2015-20202.2.2 Global Preimplantation Genetic Testing Retrospective Market Scenario in Revenue by Region: 2015-2020

3 Global Preimplantation Genetic Testing Competitor Landscape by Players3.1 Preimplantation Genetic Testing Sales by Manufacturers3.2 Preimplantation Genetic Testing Revenue by Manufacturers3.3 Preimplantation Genetic Testing Price by Manufacturers3.4 Preimplantation Genetic Testing Manufacturing Base Distribution, Product Types3.5 Manufacturers Mergers & Acquisitions, Expansion Plans

4 Market Size by Type (2015-2026)4.1 Global Preimplantation Genetic Testing Market Size by Type (2015-2020)4.2 Global Preimplantation Genetic Testing Market Size Forecast by Type (2021-2026)4.3 Global Preimplantation Genetic Testing Market Share by Price Tier (2015-2020): Low-End, Mid-Range and High-End

5 Market Size by Application (2015-2026)5.1 Global Preimplantation Genetic Testing Market Size by Application (2015-2020)5.2 Preimplantation Genetic Testing Market Size Forecast by Application (2021-2026)

6 North America6.1 North America Preimplantation Genetic Testing by Country6.1.1 North America Preimplantation Genetic Testing Sales by Country6.1.2 North America Preimplantation Genetic Testing Revenue by Country6.1.3 U.S.6.1.4 Canada6.2 North America Preimplantation Genetic Testing Market Facts & Figures by Type6.3 North America Preimplantation Genetic Testing Market Facts & Figures by Application

7 Europe7.1 Europe Preimplantation Genetic Testing by Country7.1.1 Europe Preimplantation Genetic Testing Sales by Country7.1.2 Europe Preimplantation Genetic Testing Revenue by Country7.1.3 Germany7.1.4 France7.1.5 U.K.7.1.6 Italy7.1.7 Russia7.2 Europe Preimplantation Genetic Testing Market Facts & Figures by Type7.3 Europe Preimplantation Genetic Testing Market Facts & Figures by Application

8 Asia Pacific.

11 Company Profiles11.1 Company Profiles 111.1.1 Company Profiles 1 Corporation Information11.1.2 Company Profiles 1 Description and Business Overview11.1.3 Company Profiles 1 Sales, Revenue and Gross Margin (2015-2020)11.1.4 Company Profiles 1 Preimplantation Genetic Testing Products Offered11.1.5 Company Profiles 1 Related Developments

11.2 Company Profiles 211.2.1 Company Profiles 2 Corporation Information11.2.2 Company Profiles 2 Description and Business Overview11.2.3 Company Profiles 2 Sales, Revenue and Gross Margin (2015-2020)11.2.4 Company Profiles 2 Preimplantation Genetic Testing Products Offered11.2.5 Company Profiles 2 Related Developments

11.3 Company Profiles 311.3.1 Company Profiles 3 Corporation Information11.3.2 Company Profiles 3 Description and Business Overview11.3.3 Company Profiles 3 Sales, Revenue and Gross Margin (2015-2020)11.3.4 Company Profiles 3 Preimplantation Genetic Testing Products Offered11.3.5 Company Profiles 3 Related Developments

11.4 Company Profiles 411.4.1 Company Profiles 4 Corporation Information11.4.2 Company Profiles 4 Description and Business Overview11.4.3 Company Profiles 4 Sales, Revenue and Gross Margin (2015-2020)11.4.4 Company Profiles 4 Preimplantation Genetic Testing Products Offered11.4.5 Company Profiles 4 Related Developments

11.5 Company Profiles 511.5.1 Company Profiles 5 Corporation Information11.5.2 Company Profiles 5 Description and Business Overview11.5.3 Company Profiles 5 Sales, Revenue and Gross Margin (2015-2020)11.5.4 Company Profiles 5 Preimplantation Genetic Testing Products Offered11.5.5 Company Profiles 5 Related Developments.13 Market Opportunities, Challenges, Risks and Influences Factors Analysis13.1 Market Opportunities and Drivers13.2 Market Challenges13.3 Market Risks/Restraints13.4 Porters Five Forces Analysis13.5 Primary Interviews with Key Preimplantation Genetic Testing Players (Opinion Leaders)

14 Value Chain and Sales Channels Analysis14.1 Value Chain Analysis14.2 Preimplantation Genetic Testing Customers14.3 Sales Channels Analysis14.3.1 Sales Channels14.3.2 Distributors

15 Research Findings and ConclusionContinued.

Detailed TOC of Global Preimplantation Genetic Testing Market @https://www.industryresearch.biz/TOC/16279735

About Us:

Market is changing rapidly with the ongoing expansion of the industry. Advancement in the technology has provided todays businesses with multifaceted advantages resulting in daily economic shifts. Thus, it is very important for a company to comprehend the patterns of the market movements in order to strategize better. An efficient strategy offers the companies with a head start in planning and an edge over the competitors.Industry Researchis the credible source for gaining the market reports that will provide you with the lead your business needs.

Contact Info:

Name: Mr. Ajay More

E-mail:[emailprotected]

Organization: Industry Research Biz

Phone:US +1424 253 0807 / UK +44 203 239 8187

Our Other Reports:

Interventional Radiology Market 2020 Industry Trends by Top Companies, Global Industry Demand Status, Evolving Technology, Growth Rate, Analysis and Forecast to 2026

Nanotechnology in Medical Devices Market Size 2020 Global Industry Outlook by Share, Trends Evaluation, Geographical Segmentation, Business Challenges and Opportunity Analysis till 2026

Garage Door Opener Market Size 2020 Explosive Factors of Revenue By Industry Statistics, Progression Status, Emerging Demands, Recent Trends, Business Opportunity, Share and Forecast To 2026 Says Industry Research Biz

Global Helium Leak Detector Market Size 2020 Industry Recent Developments, Emerging Trends, Growth, Progression Status, Latest Technology, and Forecast Research Report 2026

Soybean Germ Protein Market 2020 | Worldwide Industry Gross Margin, Trends, Share, Size, Future Demand, Analysis by Top Leading Player and Forecast till 2026

Read more here:
Preimplantation Genetic Testing Market 2020| Share, Size, Increasing Rapidly with Recent Trends, Growth, Revenue, Demand and Forecast to 2026 -...

Recommendation and review posted by Bethany Smith

Today, the Sexing Technologies methodology is widely used in many animal species, with a wide variety of applications, from livestock production systems to population increases among endangered species. Conception rates are slightly lower than non-sorted semen, as the high-speed sorting process causes stress on the cells. However, this process is a giant step toward the pie-in-the-sky future technology I reported on as an FFA member many years ago.

In recent years, another company, one that is familiar to most cattle producers, American Breeders Service, or ABS Global, has developed an additional process to produce gender- specific offspring. This process, called SexcelTM Sexed Genetics, was first launched in Australia in early 2018. Similar to the Sexing Technologies process, the SexcelTM process differentiates the X- or Y-chromosome-bearing cells due to the slight difference in DNA in each type of cell.

The ABS process uses a nontoxic fluorescent DNA probe that adheres to the DNA of the chromosomes, and the cells can then be differentiated by the level of florescence to segregate the X or Y cells. Based on the type of chromosome, cells may be sorted into separate containers based on sex, or the cells of the undesired sex may be laser-ablated and remain in the solution.

Leaving the ablated cells in the same solution with the viable selected cells does not have any negative impact on fertility of the sex-skewed product. Field performance indicates that X-skewed sexed-semen inseminations produce 86 percent to 93 percent female calves with up to 90 percent relative conception rate to conventional semen. ABS reiterates that results vary according to management, environment and animal.

Excerpt from:
JACK'S INSIGHTS: Animal agriculture technology: pie-in-the-sky inventions - Scottsbluff Star Herald

Recommendation and review posted by Bethany Smith

Releasing mosquitoes into the corridors of apartment complexes might seem like an unusual strategy for a city fighting its worst recorded outbreak of dengue, a painful disease spread between humans by mosquitoes. But the thousands of little insects discharged last week werent your average mosquitoes.

They were bred in a laboratory to carry a substance not commonly found in this type of mosquito: bacteria called Wolbachia. When the bacteria-laden male mosquitoes are released into the open and mate with naturally-born females, the resultant eggs wont hatch.

The outcome is reduced number of dengue cases in the areas where the lab-bred insects were released, according to Singapores government.

Scientists and governments are expanding high-tech solutions like these as the threat from the dengue virus grows. Some are using genetically engineered mosquitoes; others are zapping them with X-ray beams to sterilize them.

The World Health Organization says roughly half the worlds population is at risk of catching dengue, a viral infection that causes an intense flulike illness that is sometimes lethal. Growing urbanization and bulging cities have given mosquitoes vast human populations to feast on. Reported cases of the disease increased from about 500,000 in 2000 to 4.2 million in 2019, with tropical countries such as Brazil, Indonesia and the Philippines especially hard-hit.

Global warming could spread the disease further as both dengue-carrying mosquitoes and the virus itself thrive in warmer climates.

Dengue is transmitted by the female Aedes aegypti mosquito, which also spreads other diseases like Zika, which can cause severe birth defects when pregnant women are infected, and chikungunya, which causes fever and joint pain. Public-health campaigns have traditionally focused on simple solutions, such as encouraging people to empty stagnant water from household objects such as vases, pails and watering cans, where mosquitoes lay eggs. Insecticides are also used in dengue-prone areas.

But mosquitoes have developed immunity against common insecticides and dengue cases are rising globally. That is why scientists turned to altering or modifying the mosquitoes themselves.

In Singaporewhich has long suffered from dengue outbreaksspecialized mosquito-breeding began with mosquito eggs shipped from Michigan. A team led by Zhiyong Xi, a professor at Michigan State Universitys Department of Microbiology and Molecular Genetics used long, thin glass needles to inject Wolbachia into mosquito eggs, resembling tiny grains of dirt, that had been laid 90 minutes before. Upon hatching, the larvae also contained the bacteria.

That first generation passed the Wolbachia bacteria on to its descendants, birthing a new line of bacteria-infused mosquitoes whose eggs were shipped to Singapore to found the city-states colony.

Before the offspring could be released, the females needed to be separated from the males, which dont bite or transmit the dengue virus. Sex-sorting is critical because Singapores program hinges on mating males that contain the bacteria with females that dont. If both sexes carried the bacteria, the mosquitoes would successfully procreate, thwarting the programs goal of reducing the local mosquito population.

A machine developed by Verily, an Alphabet Inc. company focused on life sciences, uses automated mechanical sieves to separate female mosquito pupaewhich are generally largerfrom male ones. This step removes about 95% of females, the company says.

A computer vision system is used to identify any females the sieve may have missed. The system looks for the females distinct proboscis or mouth, antenna and other anatomical clues, flagging it for removal. Verily says substantially fewer than one in a million mosquitoes it releases is female, keeping Wolbachia from being inherited in the wild mosquito population.

Not all Wolbachia mosquitoes released in Singapore are sieved through Alphabets machine. Others are subjected to low-dose X-ray irradiation using a specific methodology Singapore developed in collaboration with the International Atomic Energy Agency. The irradiation sterilizes female mosquitoes, so that any that are inadvertently released will be unable to reproduce and spread Wolbachia to future generations.

Singapores government says that in parts of the city where its males have been released there were 65% to 80% fewer dengue cases compared with areas where the mosquitoes werent released. Mosquitoes are now being discharged in 5% of the citys public housing blocks. The releases are slated to expand to 15% of them by 2022.

Other programs want the Wolbachia to be inherited widely in wild populations. That is because those programs have found that the bacteria has another feature: It strongly reduces the Aedes aegypti mosquitoes ability to transmit dengue to humans.

The World Mosquito Program, a nonprofit active in a dozen countries in Asia, the Pacific and Latin America, released lab-bred bacteria-containing mosquitoesboth male and femalein the city of Yogyakarta in Indonesia. It counted on the fact that female mosquitoes will produce offspring that also have the bacteria, meaning the dengue-blocking feature is passed down.

Its trial showed a 77% reduction in dengue cases in areas where the mosquitoes were released compared with areas where they werent, the nonprofit said in August.

This method is much simpler than Singapores technique, which involves complex sex-sorting. But some scientists say releasing females with Wolbachia is potentially irreversible. If the Wolbachia turns out to have unintended consequences, it would be very difficult to extract the bacteria from the mosquito population, they say.

One laboratory study found that carrying Wolbachia enhanced the infection rate of West Nile virus in the Culex tarsalis species of mosquito, which is endemic to North America. Its a big black box," said Jason Rasgon, professor of disease epidemiology at Pennsylvania State University, arguing more research should be done on Wolbachias effects on the transmission of other diseases before further large-scale releases.

Cameron Simmons, a director at the World Mosquito Program, said many governments have conducted risk-assessments of its approach. On balance Wolbachia represented a negligible risk compared to doing nothing," he said.

One company is going in a different direction altogether: genetic engineering. Oxitec, a U.S.-owned biotechnology company with research bases in the U.K. and Brazil inserts a new gene in eggs that makes female mosquitoes die shortly after hatching while they are still in the larval stage of development.

Last year, Oxitec conducted a trial of its latest gene-modified version, which it calls OX5034, in Indaiatuba, Brazil, near So Paulo. For the trial, the company produced OX5034 eggs at a factory in Brazil and distributed them at release points around the municipality. When the eggs hatched, the females died before they could become adults capable of flying and biting.

The males, which reached adulthood, mated with local wild females, passing along the female-killing genes, reducing Aedes aegypti mosquito numbers by about 95%, Oxitec said.

The company received U.S. federal approvals in May for pilot releases in Florida, which the company expects to begin next year.

Oxitec says the genes they have added are self-limiting, which means that after a few generationsabout three to four monthsthe female-targeting gene is bred out of the species. Municipalities that wish to continue with the approach would carry on releasing OX5034 eggs to keep the mosquito population in check, it said, and those that dont would still have an off-ramp.

Jeffrey Powell, a biology professor at Yale University, sees drawbacks to the gene-modification approach. He said the need for periodic rereleases would get expensive, and over time wild mosquitoes may adapt to avoid mating with Oxitecs genetically doomed males. There is no evidence it is doing anything bad," he said of the genes Oxitec has introduced into mosquitoes. Its a complete unknown." He said he felt more comfortable with the use of Wolbachia, which is found naturally in many mosquito species.

Oxitec says it has released about one billion mosquitoes in the past decade and has no evidence female mosquitoes selectively mate with non-Oxitec males.

Theres no ecological footprint; theres no persistence," said Kevin Gorman, who heads field operations for Oxitec. Its not going to permanently change the environment at all."

Write to Jon Emont at jonathan.emont@wsj.com

Subscribe to newsletters

* Enter a valid email

* Thank you for subscribing to our newsletter.

Here is the original post:
How to fight the deadly dengue virus? Make your own mosquitoes - Livemint

Recommendation and review posted by Bethany Smith

From a scientific standpoint, the jury is still out on why exactly sperm count and quality are declining. Nevertheless, there is one highly likely culprit: modern life.

What is it about modern life that is wreaking havoc on male fertility?

Try something with me: Search your minds eye for a vivid movie of what your day looked like yesterday? Conjure up every detail you can: what you did, what you thought, what you worried about, what you consumed, how often you sat and what you were doing while sitting, and the details of the environment surrounding you.

Now do the same for an ordinary day in your grandfathers life when he was your age. This will require some imagination on your part, but consider the differences in what your grandfather did, what he thought and worried about, what he consumed, how often he sat and what he was doing while sitting, and the details of the environment surrounding your grandfather.

The difference between routines is where you can start to get a sense of what factors of modern life are taking such a toll on male fertility. (And female fertility, too.) Here are a few to consider:

Read the original post:
How To Improve Male Fertility & Sperm Quality, From An Expert - mindbodygreen.com

Recommendation and review posted by Bethany Smith

Abstract

Meiotic reductional division depends on the synaptonemal complex (SC), a supramolecular protein assembly that mediates homologous chromosomes synapsis and promotes crossover formation. The mammalian SC has eight structural components, including SYCE1, the only central element protein with known causative mutations in human infertility. We combine mouse genetics, cellular, and biochemical studies to reveal that SYCE1 undergoes multivalent interactions with SC component SIX6OS1. The N terminus of SIX6OS1 binds and disrupts SYCE1s core dimeric structure to form a 1:1 complex, while their downstream sequences provide a distinct second interface. These interfaces are separately disrupted by SYCE1 mutations associated with nonobstructive azoospermia and premature ovarian failure (POF), respectively. Mice harboring SYCE1s POF mutation and a targeted deletion within SIX6OS1s N terminus are infertile with failure of chromosome synapsis. We conclude that both SYCE1-SIX6OS1 binding interfaces are essential for SC assembly, thus explaining how SYCE1s reported clinical mutations give rise to human infertility.

Meiotic cell division is defined by a unique and highly dynamic program of events that result in homologous chromosome synapsis, crossover (CO) formation, and subsequent homolog segregation into haploid germ cells (13). Homologous chromosome pairs are established through interhomolog recombination searches from up to 400 induced double-strand breaks (DSBs) per cell (4). Once established, local recombination-mediated alignments are converted into the single continuous synapsis of aligned homologous chromosomes through the zipper-like assembly of the synaptonemal complex (SC) (5). The SCs supramolecular protein structure mediates continuous 100-nm tethering between homologous chromosome axes and provides the necessary three-dimensional framework for crossover formation (2). Following SC disassembly, crossovers provide the sole physical links between homologs at metaphase I, so are essential for ensuring correct homolog segregation in addition to providing genetic diversity (2).

The SC has an iconic and highly conserved tripartite structure that has been observed across meiotically reproducing eukaryotes (6). This consists of lateral elements (LEs) that coat the two homologous chromosome axes and a midline central element (CE), with a series of transverse filaments that bind together these longitudinal electron-dense structures (Fig. 1A) (7). The protein components of the mammalian SC have been identified as transverse filaments protein SYCP1 (Synaptonemal complex protein 1) (8), CE proteins SYCE1, SYCE2, and SYCE3 (Synaptonemal complex central element proteins 1 to 3), SIX6OS1, and TEX12 (Testis-expressed protein 12) (912), and LE proteins SYCP2 and SYCP3 (13, 14). All transverse filament and CE components are essential for SC assembly, and their individual disruption leads to infertility owing to meiotic arrest with failure of DSB repair (10, 11, 1518). In contrast, disruption of LE components produces a sexual dimorphism of male infertility and female subfertility (19, 20), with SYCP3 deficiency in females promoting germ cell aneuploidy and embryonic death (21).

(A) Schematic of the SC demonstrating its tripartite structure of two chromosome-bound LEs and a midline CE. Synapsis is achieved through N-terminal head-to-head assembly of SYCP1 molecules, which are bound via their C termini to meiotic chromosomes. SYCP1 head-to-head assembly is structurally supported within the CE by SYCE3 (red), an SYCE1-SIX6OS1 complex (yellow), and SYCE2-TEX12 fibrous assemblies (green). (B) Human SYCE1 (top) and SIX6OS1 (bottom) sequence schematics indicating the location and consequence of infertility-associated mutations of SYCE1 and 1021 internal deletion of SIX6OS1, alongside the principal constructs used in this study. (C) SDSpolyacrylamide gel electrophoresis (SDS-PAGE) analysis of the purified recombinant proteins used in this study. The dominant degradation product of SYCE1POF is indicated by an asterisk; its identity was confirmed by the observed cleavage of degraded MBP- and His-SYCE1POF fusion proteins upon treatment with TEV protease (fig. S1, A and B), consistent with it representing C-terminal degradation down to SYCE1s structural core. Mw, weight-average molecular weight. (D) SEC-MALS analysis. SYCE1core (yellow), SYCE1POF (green), and full-length SYCE1 (violet) are dimeric species of 36, 48 (39 kDa for the degradation product), and 86 kDa, respectively (theoretical dimers: 37, 55, and 80 kDa). dRI, differential refractive index. Data for SYCE1core and full-length SYCE1 are reproduced from (28).

In recent years, a variety of cellular imaging, biochemical and structural biology approaches have begun to uncover the molecular structures, interactions, and mechanisms responsible for mammalian SC assembly. SYCP1 self-assembles into a supramolecular lattice that provides the underlying 100-nm synapsis between chromosome axes (22, 23), while SYCP3 assembles into regularly repeating filaments that support chromosomal looping (24, 25). The five CE proteins provide essential structural supports for the SYCP1 lattice that enable its continuous and cooperative extension along the entire chromosome length. In this capacity, CE proteins have been categorized as synaptic initiation factors (SYCE3, SYCE1, and SIX6OS1) and elongation factors (SYCE2 and TEX12), of which their disruption leads to complete loss of tripartite SC structure and failure of extension of short SC-like stretches, respectively (10, 11, 1618). Of synaptic initiation factors, SYCE3 forms dimers that undergo potentially limitless self-assembly (26, 27), SYCE1 forms antiparallel dimeric assemblies (28), and SIX6OS1 is an SYCE1-interacting protein of unknown structure (11). These likely act as short-range structural supports between SYCP1 molecules, possibly in transverse, longitudinal, and vertical orientations to stabilize a local three-dimensional SYCP1 lattice (22). In contrast, SYCE2 and TEX12 exist as a seemingly constitutive complex that undergoes self-assembly into fibers of many micrometers in length (29), which likely provide the long-range structural supports that stabilize continuous growth of the SYCP1 lattice along the entire chromosome axis (22).

Owing to the essential roles of meiotic recombination, synapsis, and chromosome dynamics in mammalian meiosis (15, 3034), their defects are associated with human infertility, recurrent miscarriage, and aneuploidies (35, 36). As genetic causes of infertility, they typically fall within the category of idiopathic cases, having no readily diagnosable and clinically resolvable cause. Within the 10 to 15% of couples who suffer from infertility, approximately 25% are idiopathic and of likely genetic origin, comprising 50 to 80% of cases of nonobstructive azoospermia (NOA) and premature ovarian failure (POF) (36, 37). While individual infertility mutations are inherently unlikely to become widespread in a population, they can be found within families, especially when consanguineous (38), and provide crucial insights into their common targets and the molecular mechanisms that they disrupt.

Within the SC, familial infertility mutations have been identified for SYCP3 and SYCE1 (36). All identified SYCP3 mutations are autosomal dominant and alter or delete its structural cores C terminus that mediates filamentous assembly, so likely sequester wild-type (WT) molecules into inactive complexes (24, 36). In contrast, the three identified SYCE1 mutations are autosomal recessive and were found in two familial cases of NOA and one of POF (36). The two NOA cases are splice-site mutations, c.197-2A>G and c.375-2A>G, which are predicted to result in a truncated product of amino acids 1 to 65 and an internal deletion of amino acids 126 to 155, respectively (39, 40). These remove or delete part of human SYCE1s structural core that is encoded by amino acids 25 to 179, so can be explained by disruption of its dimeric structure (Fig. 1B) (28, 36). The POF mutation c.613C>T generates a premature stop codon (p.Gln241*) to give a truncated product of amino acids 1 to 240, relative to the canonical 351amino acid isoform (Fig. 1B) (41). However, as this truncation lies outside SYCE1s structural core, the molecular mechanism that is disrupted, and thereby responsible for infertility, remains unknown.

Here, we combine mouse genetics and cellular and biochemical studies to reveal a multivalent interaction mode between SYCE1 and SIX6OS1 that is disrupted by infertility-associated mutations of SYCE1. We find that the SIX6OS1 N terminus binds and disrupts the core dimeric structure of SYCE1 (amino acids 25 to 179) to form a 1:1 complex as the first interface, and its downstream sequence binds to SYCE1 amino acids 177 to 305 as the second interface. SYCE1s infertility-associated mutations c.375-2A>G (NOA) and c.613C>T (POF) specifically disrupt the first and second interfaces, respectively. Mice harboring the SYCE1 POF mutation and a targeted deletion within SIX6OS1 (which disrupts the first interface) are infertile, with failure of SC assembly. We conclude that both SYCE1-SIX6OS1 binding interfaces are essential for SC assembly and meiotic division, thus explaining how human infertility results from the differential targeting of binding interfaces by SYCE1s reported clinical mutations.

The SYCE1 POF mutation c.613C>T encodes a premature stop codon (p.Gln241*) that is predicted to generate a truncated protein product of amino acids 1 to 240, relative to SYCE1s canonical 351amino acid isoform (Fig. 1B) (41). We previously demonstrated that an N-terminal structural core encoded by amino acids 25 to 179 (SYCE1core) forms an -helical antiparallel coiled-coil structure that mediates head-of-head dimerization of SYCE1 (28). As this core region is retained (Fig. 1B), we predicted that SYCE1s antiparallel dimeric structure would be maintained within the 1- to 240-amino acid truncated product of the POF mutation (SYCE1pof). To test this, we purified recombinant SYCE1pof, generating purified material that contained approximately equal quantities of the full protein and a degradation product of apparent size consistent with degradation to the C-terminal boundary of its structural core (Fig. 1C and fig. S1, A and B). Circular dichroism (CD) spectroscopy confirmed that SYCE1pof contains a proportion of -helical structure consistent with retention of the 25179 core structure (fig. S1C), and SYCE1pof and SYCE1core demonstrated identical melting temperatures (Tm) of 39C (fig. S1D). Furthermore, analysis by size exclusion chromatography multiangle light scattering (SEC-MALS) confirmed that the full and degraded proteins are homodimers of 48 and 39 kDa, respectively (Fig. 1D). We conclude that SYCE1pof retains the dimeric structure imposed by its core 25179 region, so its SC and meiotic defects must result from additional structural or functional roles of its deleted C terminus.

Having established its retention of core dimeric structure, we next sought to determine the structural and functional consequence of the SYCE1 POF mutation on the SC and meiotic division in vivo. We thus generated mice harboring mutations of Syce1 alleles to introduce stop codons at amino acid position 243, equivalent to the human p.Gln241* mutation (figs. S2 and S3). While heterozygotes (designated Syce1POF/WT) were fertile, both male and female homozygotes (designated Syce1POF/POF) were infertile, replicating the autosomal recessive pattern of the POF mutation in humans (41). In male mutant mice, we observed reduced testis size (63% smaller, n = 3 mice at 2 months of age; fig. S4A) and a zygotene-like arrest similar to that observed in the SYCE1 knockout (16). There was defective SC assembly, with reduced staining for SYCP1 (Fig. 2A) and SYCE3 (Fig. 2B) and no staining for SYCE1 (Fig. 2C), SIX6OS1 (Fig. 2D), and SYCE2-TEX12 (fig. S4, B and C). Analysis of SYCE1 expression in the testis of Syce1POF/POF mice confirmed the presence of Syce1 transcript and a protein product of the correct molecular weight, albeit at reduced levels in comparison with WT (fig. S4, D and E, and table S1A). The Syce1POF open reading frame achieved WT levels of protein expression in a heterologous 293T cellular system (fig. S4F). We next studied the kinetics of DSB repair. Meiotic DSBs are generated by the nuclease SPO11 and are then resected to form single-stranded DNA ends that invade into the homologous chromosome by the recombinases RAD51 (DNA repair protein RAD51 homolog 1) and DMC1 (Meiotic recombination protein DMC1/LIM15 homolog) (42). DSBs are labeled by the presence of phosphorylated H2AX (-H2AX) (43). The distribution of -H2AX in mutant spermatocytes was similar to that found in WT cells at early prophase I but show increased staining at zygotene-like arrest (Fig. 2E). The distributions of RAD51 and DMC1 were detected on aligned LEs (Fig. 2, F and G) but in absence of mismatch repair protein MLH1 (DNA mismatch repair protein Mlh1) (marker of crossing-overs) (Fig. 2H). Together, these data indicate generation of DSBs but with failure of their repair and CO formation in Syce1POF/POF. In female mutant mice, we observed no follicles in adult ovaries (fig. S5A), and embryonic oocytes demonstrated zygotene arrest with mostly unaligned chromosome axes, recapitulating the human POF syndrome. Analysis of the SC revealed similar defects, with reduction in SYCP1 and SYCE3 (Fig. 3, A and B) staining (though to a lesser extent than males), and absence of SYCE1, SIX6OS1 (Fig. 3, C and D), and SYCE2-TEX12 (fig. S5, B and C). The distribution of -H2AX, RAD51, and DMC1 labeling in zygotene-like mutant oocytes was also increased and lacked MLH1 foci (Fig. 3, E to H). Thus, the SYCE1 POF mutation leads to male and female infertility with phenotypes of failed DSB repair, synapsis, and lastly SC assembly, similar to those previously observed upon disruption of structural components of the SC CE (10, 11, 1618).

(A) Double immunolabeling of WT pachytene and Syce1POF/POF zygotene-like spermatocytes with SYCP3 (red) and SYCP1 (green). In Syce1POF/POF spermatocytes, AEs fail to synapse and show a weak staining of SYCP1 along the axial elements (AEs). a.u., arbitrary units. (B to D) Double immunolabeling of spermatocyte spreads with SYCP3 (red) and the CE proteins (green). Syce1POF/POF zygotene-like spermatocytes showed a highly reduced signal of SYCE3 (B) and the absence of (C) SYCE1 and (D) SIX6OS1 from the AEs. (E) Double immunolabeling of -H2AX (green) and SYCP3 (red) in spermatocyte spreads from WT and Syce1POF/POF mice. -H2AX staining was persistent in Syce1POF/POF zygotene-like spermatocytes, but was restricted to the sex body in WT pachytene cells. (F and G) Double immunofluorescence of (F) RAD51 or (G) DMC1 (green) and SYCP3 (red). Syce1POF/POF zygotene-like spermatocytes showed increased numbers of foci of RAD51 and DMC1 along the AEs in comparison with WT, indicating unrepaired DSBs. (H) Double immunolabeling of MLH1 (green) and SYCP3 (red) showing the absence of COs (MLH1) in arrested Syce1POF/POF spermatocytes. Fluorescence intensity levels (A, B, and E) and number of foci (F and G) from WT and zygotene-like arrested spermatocytes are quantified in the right-hand plots. Welchs t test analysis: ***P < 0.0001. Scale bars, 10 m.

(A) Double immunolabeling of oocyte spreads from WT and Syce1POF/POF mice with SYCP3 (red) and SYCP1 (green). Syce1POF/POF oocytes became arrested in a zygotene-like stage where AEs remain unsynapsed and unaligned, with reduced levels of SYCP1. (B to D) Double immunolabeling of oocyte spreads with SYCP3 (red) and the CE proteins (green). Syce1POF/POF zygotene-like oocytes showed reduced SYCE3 signal (B) and a complete absence of (C) SYCE1 and (D) SIX6OS1 from the AEs. IP, immunoprecipitation. (E) Double immunostaining of spread preparations of WT pachytene and Syce1POF/POF zygotene-like oocytes with -H2AX (green) and SYCP3 (red). In Syce1POF/POF oocytes, the levels of -H2AX increased and were more restricted to AEs in comparison with WT pachytene cells. (F to G) Double immunolabeling of (F) RAD51 or (G) DMC1 (green) and SYCP3 (red), showing higher numbers of foci in AEs from mutant oocytes. (H) Labeling of MLH1 (green) and SYCP3 (red). MLH1 foci are absent from the AEs of Syce1POF/POF oocytes. Fluorescence intensity levels (A, B, and E) and number of foci (F and G) from WT and Syce1POF/POF zygotene-like oocytes are quantified in the right-hand plots. Welchs t test analysis: ***P < 0.0001. Scale bars, 10 m.

As the Syce1POF/POF mouse strain indicated a clear structural defect in the SC, we wondered whether the POF mutation may disrupt the known interaction between SYCE1 and fellow SC CE components SIX6OS1 and SYCE3 (11). The expression of SYCE1 and SIX6OS1 in COS7 cells produced cytoplasmic signals that became colocalized in foci upon coexpression (95% cells; Fig. 4A and fig. S6), in keeping with our previous findings (11). SYCE1pof formed similar or slightly reduced numbers of foci that equally colocalized with SIX6OS1, indicating a retention of SIX6OS1 binding (89% cells; Fig. 4A). We further demonstrated a similar coimmunoprecipitation of SIX6OS1 by WT SYCE1 and SYCE1pof upon coexpression in human embryonic kidney (HEK) 293 cells (Fig. 4B). Thus, the SYCE1-SIX6OS1 interaction is retained in the SYCE1 POF mutation. Could other disrupted functions contribute to the effect of the POF mutation? The only other known SYCE1 interactor is SYCE3, which undergoes low-affinity binding, as determined by its dissociation during purification (fig. S7, A and B). In contrast with the WT protein, the expression of SYCE1pof (cytoplasmic foci) in COS7 cells failed to recruit SYCE3 (preferentially nuclear) to their cytoplasmic foci (colocalization between SYCE3 and SYCE1 was observed for 95% of cells expressing WT SYCE1 and 21% of cells expressing SYCE1pof; Fig. 4C and fig. S6). Similarly, SYCE1pof failed to coimmunoprecipitate SYCE3 upon coexpression in HEK293 cells (Fig. 4D). Thus, while the SYCE1-SIX6OS1 complex is retained, the low-affinity SYCE1-SYCE3 complex is largely abolished in the SYCE1 POF mutation.

(A) Mouse SIX6OS1 colocalized with mouse SYCE1 and SYCE1POF in a cytoplasmatic punctate pattern upon coexpression in COS7 cells; the percentage of cells exhibiting colocalization is shown in the right-hand plot (n = 100 cells). DAPI, 4,6-diamidino-2-phenylindole. (B) HEK293T cells were cotransfected with the indicated expression vectors. Protein complexes were immunoprecipitated with anti-Flag or antienhanced green fluorescent protein (EGFP) antibodies, or mouse immunoglobulin G (IgG) as a negative control, and were analyzed by immunoblotting with the indicated antibody. GFP-mSIX6OS1 coimmunoprecipitated with Flag-mSYCE1 and Flag-mSYCE1POF, suggesting that the POF mutation of SYCE1 alone is insufficient to block the interaction. (C) COS7 cells were transfected with mouse Syce3 in combination with mouse Syce1 or Syce1pof as indicated. SYCE1 colocalized with SYCE3 in its own cytoplasmatic punctate pattern, and colocalization was substantially diminished for SYCE1POF (n = 100 cells). (D) Immunoprecipitation of protein complexes from HEK293T-cotransfected cells with an anti-Myc or anti-EGFP antibody or mouse IgG. SYCE1 coimmunoprecipitated with SYCE3, and the interaction was disrupted for SYCE1 POF, suggesting that the C-terminal region of SYCE1 is required for its interaction with SYCE3. The untransfected lanes in (B) and (D) show the absence of all the proteins in total protein extracts from untransfected 293T cells. Scale bars, 20 m.

What is the molecular basis of SIX6OS1 binding by SYCE1? As this is retained in SYCE1pof, we reasoned that SIX6OS1 binding must be mediated by SYCE1s structural core. We screened SYCE1core against a library of SIX6OS1 constructs through bacterial coexpression and identified a robust interaction with amino acids 1 to 67 of SIX6OS1, herein referred to as SIX6OS1N (Figs. 1B and 5A). We were able to purify the SYCE1core-SIX6OS1N complex by reciprocal affinity chromatography, ion exchange, and size exclusion chromatography (Fig. 5B) and found it to be stable under all experimental conditions tested. We were further able to purify similar complexes for SYCE1pof (with the same degradation product as upon isolated expression) and full-length SYCE1 (Fig. 1C and fig. S1B), confirming that SIX6OS1 binding is retained by all constructs containing the 25179 core. CD analysis revealed similar -helical content for SYCE1-SIX6OS1N complexes as for their isolated SYCE1 proteins (fig. S1C). CD thermal denaturation revealed slightly increased cooperativity of unfolding and melting temperatures for SYCE1-SIX6OS1N complexes relative to their isolated SYCE1 proteins (increasing from 39 to 43C, 39 to 41C, and 38 to 40C for SYCE1core, SYCE1pof, and full length, respectively; Fig. 5C and fig. S1D). SEC-MALS analysis revealed that all three SYCE1-SIX6OS1N complexes are 1:1, with molecular weights of 27, 37, and 46 kDa, respectively (Fig. 5D and fig. S7C). Thus, the SYCE1core undergoes conformation change from an antiparallel homodimer to a 1:1 complex upon binding to SIX6OS1N (Fig. 5E).

(A) Amylose pulldown following coexpression of MBP-SIX6OS1 175, 167, 175 1021, and free MBP with His-SYCE1core. (B) SDS-PAGE of the copurification of the SYCE1core-SIX6OS1n complex. Ni-NTA, Ninitrilotriacetic acid. (C) CD thermal denaturation recording the CD helical signature at 222 nm between 5 and 95C, as % unfolded; estimated melting temperatures (Tm) are indicated. (D) SEC-MALS analysis. SYCE1core-SIX6OS1n (blue), SYCE1POF-SIX6OS1n (red) and full-length SYCE1-SIX6OS1n (black) are 1:1 complexes of 27, 37 (29 kDa for the degradation product complex), and 46 kDa, respectively (theoretical 1:1 to 27, 36, and 48 kDa), while MBP-SIX6OS1n (gray) is a 57-kDa monomer (theoretical, 53 kDa). SDS-PAGE of the SYCE1POF-SIX6OS1n sample is shown in Fig. 1C. (E) Schematic of the conformational change of the SYCE1core antiparallel dimer (yellow) into a 1:1 SYCE1core-SIX6OS1n complex (yellow-blue). (F and G) SEC-SAXS analysis. (F) SEC-SAXS P(r) interatomic distance distributions of SYCE1core-SIX6OS1n (blue), SYCE1POF-SIX6OS1n (red), and SYCE1core (yellow), revealing maximum dimensions (Dmax) of 138, 180, and 186 , respectively. Their cross-sectional radii (Rc) are indicated (fig. S7D). (G) SAXS ab initio models of SYCE1core-SIX6OS1n (blue) and SYCE1core (yellow); averaged models were generated from 20 independent DAMMIF runs. Data for SYCE1core and full-length SYCE1 are reproduced from (28).

We analyzed the conformation of the SYCE1core-SIX6OS1N complex by size exclusion chromatography small-angle x-ray scattering (SEC-SAXS; fig. S7, D and E). The SAXS real-space pair-distance P(r) distribution (the distribution of interatomic distances within a protein structure) demonstrates positive skew, indicating that SYCE1core-SIX6OS1N retains the rod-like structure of SYCE1core, but with a reduction in its molecular length from 186 to 138 (Fig. 5F). Furthermore, its cross-sectional radius is slightly increased from 9 to 11 (fig. S7F), suggesting an increase from a two- to four-helical coiled coil. These geometric changes are consistent with the SYCE1core-SIX6OS1N 1:1 complex forming a shorter but wider coiled coil than the isolated SYCE1core dimer, as indicated by their SAXS ab initio models (Fig. 5G). Furthermore, the SAXS P(r) distribution of SYCE1pof indicates a similar elongated structure but with an increased tail to a maximum dimension of 180 (Fig. 5F), consistent with it containing the same SYCE1core-SIX6OS1N structure with an extended and potentially unstructured C terminus to amino acid 240. We conclude that SYCE1core mediates a direct interaction with SIX6OS1N that imposes a conformational change to a 1:1 complex that adopts a shorter and wider coiled-coil conformation than the isolated SYCE1core antiparallel homodimer.

Does the SYCE1core-SIX6OS1N complex represent the sole means by which SYCE1 interacts with SIX6OS1? We were unable to obtain soluble biochemical complexes containing SIX6OS1 sequences beyond its N terminus and so used yeast two-hybrid (Y2H) to test SYCE1 binding by full-length SIX6OS1. Having confirmed direct binding of SYCE1core to full-length SIX6OS1, we used C-terminal truncation to dissect its minimal binding site to amino acids 1 to 75, in keeping with our biochemical findings, and identified an additional interaction between SYCE1 177305 and full-length SIX6OS1 (Fig. 6A).

(A) Y2H analysis of interactions between SYCE1 and SIX6OS1 in which positive reactions are indicated by the growth of blue colonies. These data are representative of three repeats. (B) Schematic of the SYCE1-SIX6OS1 interaction based on the Y2H data in (A), with the two binding sites highlighted in red and green. The SYCE1 POF mutation blocks the second binding interface between SYCE1 177305 and SIX6OS1 downstream sequence within region 1262, whereas the SIX6OS1 1021 deletion blocks the first binding interface between SYCE1core (25179) and SIX6OS1n (167). (C) COS7 cells were transfected with mouse Six6os1 1021 alone or in combination with mouse Syce1. SIX6OS1 1021 showed nuclear localization with some cytoplasmatic signal and colocalized in cytoplasmic foci with SYCE1; the percentage of cells exhibiting colocalization is shown. Scale bars, 20 m. (D) Coimmunoprecipitation of SIX6OS1 1021 and Flag-SYCE1 from cotransfected HEK293T cells using anti-Myc or anti-EGFP antibodies, or mouse IgG as a negative control. SIX6OS1 1021 coimmunoprecipitated SYCE1, indicating that the second SYCE1 binding interface is retained. The untransfected lanes confirm the absence of SIX6OS1 1021 and SYCE1 in total protein extracts of untransfected 293T cells.

To establish whether SYCE1core and 177305 bind to the same or distinct sites within SIX6OS1, we established an internal deletion of SIX6OS1 amino acids 10 to 21 (1021) that blocks formation of the SYCE1core-SIX6OS1N biochemical complex (Fig. 5A). SIX6OS1 122 did not interact with any SYCE1 construct (Fig. 6A), indicating that amino acids 10 to 21 are necessary but not sufficient for SYCE1core binding. While 1021 completely abrogated the Y2H interaction of full-length SIX6OS1 with SYCE1core (25179), it retained a robust interaction with SYCE1 177305, suggesting distinct SIX6OS1-binding sites (Fig. 6A). Furthermore, 1021 blocked the ability of SIX6OS1 1262 to interact with SYCE1core and SYCE1pof (amino acids 25 to 240) while retaining its binding to full-length and 25315 SYCE1 (Fig. 6A). Thus, SYCE1 undergoes multivalent interactions with SIX6OS1, with the first binding interface mediated by SYCE1core and SIX6OS1N (167), and the second interface mediated by SYCE1 177305 and downstream sequence within SIX6OS1 1262. Furthermore, the first and second binding interfaces are specifically disrupted by SIX6OS1 deletion 1021 and the SYCE1 POF mutation, respectively, and in both cases, an SYCE1-SIX6OS1 complex is retained through the unaffected alternative site (Fig. 6B).

Our biochemical and Y2H analyses concluded that SIX6OS1 1021 would disrupt the first SYCE1-SIX6OS1 binding interface while retaining complex formation through the second interface. In support of this, we found that SIX6OS1 1021 retained its ability to form intense colocalized foci with SYCE1 upon coexpression in COS7 cells (98% of the cells; Fig. 6C), similar to our previous observations for the SYCE1 POF mutation (Fig. 4A). Similarly, SIX6OS1 1021 retained its ability to coimmunoprecipitate SYCE1 upon coexpression in HEK293 cells (Fig. 6D). Thus, localization and coimmunoprecipitation data from heterologous systems support our Y2H findings that the second SYCE1-SIX6OS1 binding interface is retained in SIX6OS1 1021, mirroring the retention of only the second binding interface that is predicted for the 126155 deletion of the SYCE1 c.375-2A>G NOA mutation (40).

Having established that the severe phenotype of the SYCE1 POF mutation likely results from the disruption of the second SYCE1-SIX6OS1 binding interface and its interaction with SYCE3, we wondered whether a similar phenotype would result from the sole disruption of the first SYCE1-SIX6OS1 binding interface. To test this, we generated mice harboring mutations of Six6os1 alleles encoding internal in-frame deletions of amino acids 10 to 21 (equivalent numbering to the human protein) (fig. S8, A and B). While heterozygotes (designated Six6os11021/WT) were fertile, both male and female homozygotes (designated Six6os11021/1021) were infertile, similar to the SYCE1 POF mutation. In males, we observed reduced testis size (Fig. 7A) and a zygotene-like arrest similar to that observed in the Six6os1 and Syce1 knockouts (11, 16). The mutant spermatocytes were defective in synapsis and SC assembly, with reduced staining for SC proteins SYCP1 (Fig. 7B) and SYCE3 (Fig. 7C) and no staining for SYCE2-TEX12 (Fig. 7, F and G). In contrast with their complete absence in the SYCE1 POF mutation, we observed some residual staining for SYCE1 (Fig. 7D) and SIX6OS1 (Fig. 7E) even though the levels of transcription of Six6os11021 appeared to be increased in the mutant testis (fig. S9 and table S1B). We detected -H2AX (fig. S10A) and DMC1/RAD51 foci (fig. S10, B and C) on aligned axial elements but no MLH1 foci (fig. S10D), indicating the proper induction of DSBs with their failed repair and absence of COs. Thus, SIX6OS1 1021 leads to infertility with a phenotype of failed DSB repair and SC assembly, similar to the SYCE1 POF mutation and those reported for disruption of structural components of the CE (10, 11, 1618).

(A) Genetic deletion of amino acids 10 to 21 of SIX6OS1 led to a reduction of the testis size compared to the WT (mice of 3 months of age). (B) Double immunolabeling of WT pachytene and Six6os1/ zygotene-like spermatocytes with SYCP3 (red) and SYCP1 (green). AEs failed to synapse in Six6os1/ spermatocytes despite partial alignment, with reduced loading of SYCP1 along the AEs. (C to G) Double immunolabeling of spermatocyte spreads with SYCP3 (red) and all CE components (green). Six6os1/ zygotene-like spermatocytes showed reduced signals of (C) SYCE3, (D) SYCE1, and (E) SIX6OS1, and the absence of (F) SYCE2 and (G) TEX12 from the AEs. Scale bars, 10 m. Plots represent the quantification of fluorescence intensity levels in Six6os1/ zygotene-like and WT pachytene spermatocytes (B to E). Welchs t test analysis: ***P < 0.0001. (H) Schematic of how the SYCE1 antiparallel dimer (yellow) undergoes conformational change upon interaction with SIX6OS1 (blue) to form a possible 1:1 complex through consecutive binding interfaces mediated by SYCE1core-SIX6OS1n (site 1) and SYCE1 177305 and downstream sequence within SIX6OS1 1262 (site 2). The consequence of SYCE1 mutations associated with POF (c.613C>T) and NOA (c.375-2A>G) and SIX6OS1 1021 on the integrity, predicted stoichiometry, and conformation of resultant SYCE1-SIX6OS1 complexes is illustrated. Photo credit (A): Laura Gmez-H, Instituto de Biologa Celular y Molecular del Cncer.

Thus, we conclude that both first and second SYCE1-SIX6OS1 binding interfaces are essential for SC assembly and meiotic progression. Furthermore, these findings explain how the sole disruption of individual SYCE1-SIX6OS1 binding interfaces by SYCE1 NOA (c.375-2A>G) and POF (c.613C>T) mutations result in the reported familial cases of human infertility.

The structural and functional integrity of the SC is contingent on the structure and assembly of is constituent protein components. Here, we report that SC assembly depends on multivalent interactions between CE components SYCE1 and SIX6OS1 that are disrupted by infertility-associated mutations of SYCE1. The first binding interface is formed by the structural core of SYCE1 (SYCE1core; amino acids 25 to 179), which undergoes conformational change from an antiparallel homodimer to a 1:1 complex upon interaction with SIX6OS1s N terminus (SIX6OS1N; amino acids 1 to 67). The second binding interface is formed by downstream sequence within SIX6OS1 1262 interacting directly with SYCE1 177305. Through the generation of mice harboring an internal deletion of SIX6OS1s N terminus (1021) and the SYCE1 POF mutation (murine p.Gln243*), which specifically block the first and second binding interfaces, respectively, we find that integrity of both SYCE1-SIX6OS1 binding interfaces is essential for SC assembly and meiotic progression in vivo.

What is the structure of the SYCE1-SIX6OS1 complex? SEC-SAXS analysis revealed that the SYCE1core-SIX6OS1N 1:1 complex formed by the first binding interface has a length and cross-sectional radius of 138 and 11 , in comparison with 186 and 9 for the SYCE1core dimer. We previously reported a model for SYCE1core in which amino acids 52 to 179 form an antiparallel dimeric coiled coil containing a midline kink, with helices of amino acids 25 to 50 packing against this structural core (fig. S11A) (28). A maximum dimension of 138 for SYCE1core-SIX6OS1N suggests a coiled-coil length of approximately 92 amino acids, given a helical rise of 1.5 per amino acid (44). This could be explained by the 52179 region forming a helix-turn-helix structure through exaggeration of the kink to a full turn, which may combine with the helix formed by amino acids 25 to 50 and an helix from SIX6OS1N to form a four-helical coiled coil, consistent with its 11- cross-sectional radius (fig. S11B). The second binding interface between SYCE1 177305 and downstream sequence within SIX6OS1 1262 suggests that SYCE1core-SIX6OS1N likely adopts a parallel configuration to form a single SYCE1-SIX6OS1 1:1 complex of consecutive first and second binding interfaces (Fig. 7H).

Our analysis of the SYCE1-SIX6OS1 complex reveals how the three reported clinical mutations of SYCE1 differentially affect its interaction with SIX6OS1. The SYCE1 NOA mutation c.197-2A>G is predicted to result in a truncated product of amino acids 1 to 65 (39), which would disrupt both binding sites and so likely abrogates SYCE1-SIX6OS1 complex formation and thus works as a null mutation. The SYCE1 NOA mutation c.375-2A>G is predicted to result in internal deletion of amino acids 126 to 155 (40), which would disrupt the first binding interface while retaining the second binding interface, and so is likely to result in a conformationally altered 1:1 complex (Fig. 7H). In contrast, while 1021 SIX6OS1 similarly disrupts the first binding interface and retains the second binding interface, the SYCE1core remains unaffected and so is predicted to enable formation of a head-to-head 2:2 complex (Fig. 7H). The SYCE1 POF mutation c.613C>T generates a premature stop codon (p.Gln241*) that gives a truncated product of amino acids 1 to 240 (41), which we have demonstrated disrupts the second binding interface while retaining the first binding interface (Fig. 7H). Thus, the latter two infertility-associated mutations of SYCE1 specifically disrupt one SYCE1-SIX6OS1 interface while retaining the other, which combine with our mouse genetic studies to confirm that both interfaces are essential for the structural assembly of the SC and its function in meiosis.

What are the structural roles of SYCE1 and SYCE1-SIX6OS1 within the SC? Our analyses of Syce1POF/POF and Six6os11021/ 1021 mouse strains revealed similar phenotypes with retention of some SYCP1 and SYCE3 recruitment to chromosome axes, with absence or substantial reduction of SYCE1 and SIX6OS1, and lack of recruitment of SYCE2-TEX12. This pattern suggests a hierarchical model of SC assembly in which SYCE1 and SYCE1-SIX6OS1 lie downstream of SYCP1 and SYCE3, and upstream of SYCE2-TEX12 (Fig. 1A), which is consistent with existing knockout data (10, 11, 1518). The disruption of SYCE3 binding by the POF mutation suggests that its SYCE1-SIX6OS1 complex would be defective for SC recruitment, whereas the SYCE1-SYCE3 interaction, and hence SC recruitment, should be retained for the SYCE1-SIX6OS1 complex of the SIX6OS1 1021 internal deletion. This explains the greater severity of the CE loading defect in Syce1POF/POF than Six6os11021/ 1021, in which SYCE1 and SIX6OS1 staining was substantially reduced in the latter (83.77% of SYCE1 reduction, 0.12 0.02 in the Six6os11021/ 1021 versus 0.73 0.21 in the WT; 68.27% of SIX6OS1 reduction, 0.24 0.02 in the Six6os11021/ 1021 versus 0.76 0.15 in the WT) but completely absent in the former. Thus, we conclude that the first and second SYCE1-SIX6OS1 interfaces are essential for initiation of SC CE formation and likely function by stabilizing a local three-dimensional SC structure that mediates recruitment and self-assembly of SYCE2-TEX12 into fibers that mediate SC elongation along the chromosome axis. Furthermore, the SYCE1 POF mutation is likely worsened by its additional disruption of SYCE3 binding that removes the residual SYCE1-SIX6OS1 SC recruitment observed for the SIX6OS1 1021 internal deletion.

The existence of SYCE1core as an isolated antiparallel homodimer and in a 1:1 complex with SIX6OS1N raises the question of which is the biologically relevant conformation. It is important to highlight that the CD melting temperatures of SYCE1-SIX6OS1N complexes and isolated SYCE1 dimers are very similar, ranging between 38 and 41C. In contrast, highly stable SC components SYCE2-TEX12 and SYCP3 have melting temperatures of approximately 65C (24, 29). Thus, the relatively low melting temperatures of SYCE1-SIX6OS1N complexes and SYCE1 suggest that they may undergo conformational change in vivo, with each conformation functioning at different stages of meiosis and/or at different locations within the SC. Furthermore, our analysis of SYCE1 infertility-associated mutations and a targeted internal deletion of SIX6OS1 revealed at least four possible conformations of SYCE1 and SYCE1-SIX6OS1 complexes (Fig. 7H). Owing to the direct competition between SIX6OS1N binding and SYCE1core dimerization, these conformations could be achieved in the absence of mutations, through alterations of protein levels, local concentrations, allosteric changes, and posttranslational modifications. Hence, alterative conformations of SYCE1 and SYCE1-SIX6OS1 are intriguing candidates for local structural heterogeneity and the propagation of signals along the length of the SC, which could function in roles such as crossover enforcement and interference. Thus, as we progress toward a full molecular understanding of the mammalian SC, the multivalent SYCE1-SIX6OS1 interactions described herein provide tantalizing possibilities for a dynamic role of SC structure in its enigmatic functions in the mechanics of meiosis.

Human SYCE1 sequences were cloned into pHAT4 and pMAT11 vectors (45) for bacterial expression as His- and His-MBP (Maltose-Binding Protein) fusions with TEV (Tobacco Etch Virus) cleavage sites for fusion protein removal. Human SIX6OS1 was cloned into pRSF-Duet1 vectors with a TEV-cleavable N-terminal MBP fusion for coexpression with SYCE1. Proteins were expressed in BL21(DE3) Escherichia coli cells (Novagen), in 2xYT (Yeast Extract Tryptone) media. Expression was induced with addition of 0.5 mM isopropyl--d-thiogalactopyranoside with the cells incubated at 25C for 16 hours. Cells were lysed via sonication in 20 mM tris (pH 8.0) and 500 mM KCl, followed by centrifugation. Supernatant was applied to an amylose (New England Biolabs) affinity chromatography column, followed by HiTrap Q HP (GE Healthcare) anion exchange chromatography. His- and His-MBP/MBP tags were removed by incubation with TEV protease at 4C for 16 hours. The cleaved proteins were further purified by HiTrap Q HP (GE Healthcare) anion exchange chromatography followed by size exclusion chromatography (HiLoad 16/600 Superdex 200, GE Healthcare). The purified proteins/complexes were concentrated using Microsep Advance 3 kDa (PALL) centrifugal filter units and stored at 80C. Protein samples were analyzed for purity using Coomassie-stained SDSpolyacrylamide gel electrophoresis. Protein molecular weights and extinction coefficients were calculated using ExPASY ProtParam (http://web.expasy.org/protparam/) with protein concentrations determined using a Cary 60 ultraviolet (UV) spectrophotometer (Agilent).

Far-UV CD spectra were collected using a Jasco J-810 spectropolarimeter (Institute for Cell and Molecular Biosciences, Newcastle University). Wavelength scans were recorded at 4C from 260 to 185 nm at 0.2-nm intervals using a 0.2-mm path length quartz cuvette (Hellma). Protein samples were measured at 0.2 to 0.4 mg/ml in 10 mM Na2HPO4 (pH 7.5) and 150 mM NaF. Nine measurements were taken for each sample, averaged, buffer-corrected and converted to mean residue ellipticity (MRE) ([]) (1000 degcm2dmol1 per residue). Spectral deconvolutions were carried out using the Dichroweb CDSSTR algorithm (http://dichroweb.cryst.bbk.ac.uk). CD thermal melts were recorded at 222 nm between 5 and 95C, at intervals of 0.5C with a 1C/min ramping rate. Protein samples were measured at 0.1 mg/ml in 20 mM tris (pH 8.0), 150 mM KCl, and 2 mM dithiothreitol (DTT), using a 1-mm path length quartz cuvette (Hellma). The data were plotted as % unfolded after conversion to MRE ([]222,x-[]222,5)/([]222,95-[]222,5). The melting temperature was determined as the temperature at which the proteins are 50% unfolded.

SEC-MALS analysis of protein samples was carried out at concentrations of 5 to 20 mg/ml in 20 mM tris (pH 8.0), 150 mM KCl, and 2 mM DTT. Samples were loaded onto a Superdex 200 Increase 10/300 GL (GE Healthcare) column at 0.5 ml/min using an KTA Pure (GE Healthcare) system. The eluate was fed into a DAWN HELEOS II MALS detector (Wyatt Technology), followed by an Optilab T-rEX differential refractometer (Wyatt Technology). SEC-MALS data were collected and analyzed using ASTRA 6 software (Wyatt Technology), using Zimm plot extrapolation with a 0.185 ml/g dn/dc value to determine absolute protein molecular weights.

SEC-SAXS experiments were carried out on beamline B21 at the Diamond Light Source synchrotron facility (Oxfordshire, UK). Protein samples at concentrations 6 to 20 mg/ml were loaded onto a Superdex 200 Increase 10/300 GL size exclusion chromatography column (GE Healthcare) in 20 mM tris (pH 8.0) and 150 mM KCl at 0.5 ml/min using an Agilent 1200 high-performance liquid chromatography system. The eluate was fed through the experimental cell, with SAXS data recorded at 12.4 keV, in 3.0-s frames with a detector distance of 4.014 m. Sctter 3.0 (www.bioisis.net) was used to subtract and average the frames and carry out the Guinier analysis for the Rg and cross-sectional Rg (Rc). P(r) distributions were fitted using PRIMUS. Ab initio modeling was performed using DAMMIF (46) imposing P1 symmetry. Twenty independent runs were averaged. The PyMOL Molecular Graphics System, Version 2.0 Schrdinger, LLC was used to generate images of the SAXS ab initio models.

Constructs of human SYCE1 and SIX6OS1 were cloned into pGBKT7 and pGADT7 vectors (Clontech). Y2H experiments were carried out using the Matchmaker Gold system (Clontech) according to the manufacturers guidelines. Y187 yeast strain was transformed with pGBKT7 vectors, while the Y2H gold strain was transformed with pGADT7 vectors. Yeast transformations were carried out using standard lithium acetate methods. Mating of the two strains was carried out in 0.5 ml 2 YPDA (Yeast Peptone Dextrose Adenine) at 30C, 40 rpm, by mixing respective colonies. After 24 hours, the cultures were centrifuged and pellets were resuspended in 0.5xYPDA. These were then plated onto SD/Trp/Leu to select for mated colonies and onto SD/Trp/Leu/Ade/His with X--gal to detect mated colonies through ADE1, HIS3, and MEL1 reporter gene activation. Plates were then incubated for 5 days at 30C.

For developing the Syce1POF/POF model, Syce1single-guide RNA (sgRNA) 5-TGACTTCTTTCCACACTATC-3 targeting the intron 10 was predicted at https://eu.idtdna.com/site/order/designtool/index/CRISPR_SEQUENCE. This crRNA (CRISPR RNA), the tracrRNA (trans-activating CRISPR RNA), and the ssODN (single-stranded donor oligonucleotides) (5-GGGACTCTTCCTCCGAAGCCATGAGGCAGCTGCAGCAATGTAAGATGCAGGGTGGGGCAGGAGGAGGAAATGTCTAGCACTGACTTCTTTCCACACCCCCAGGTAGATCTTCAAGGATGAGAACAAGAAAGCTGAGG

AGTTCCTAGAGGCTGCAGCTCAGCAGCACGAGCAGCTGCAGCAGAGGTGCCACCAGCTACAG-3) were produced by chemical synthesis at IDT. The ssODN contains the mutated base (C>T, p.Gln241*) and the peptidyl-glycine -amidating monooxygenase (PAM) was mutated by substituting it by the human intron sequence (ACTATCAG > CCCCCAG). The crRNA and tracrRNA were annealed to obtain the mature sgRNA. A mixture containing the sgRNAs, recombinant Cas9 protein (IDT), and the ssODN [Cas9 (30 ng/l), annealed sgRNA (20 ng/l each), and ssODN (10 ng/l)] were microinjected into B6/CBA F2 zygotes (hybrids between strains C57BL/6 J and CBA/J) (47) at the Transgenic Facility of the University of Salamanca. Edited founders were identified by polymerase chain reaction (PCR) amplification (Taq polymerase, NZYTech) with primers flanking the exon 11 (primer F 5-CTGTAGAGAAACTGATGAAAGT-3 and R 5-CAAGAAAATATGAAGAGACATAC-3) producing an amplicon of 398 base pairs (bp) for both edited and WT alleles, and either direct sequenced or subcloned into pBlueScript (Stratagene) followed by Sanger sequencing, selecting the point mutation in the targeted region of Syce1 (fig. S2). For generating the Six6os11021/ 1021 (named as Six6os1/), Six6os1-crRNA G68 5-ATCTGTTTGTCAGTTTGGAC-3 and Six6os1-crRNA G75 5-TACTTATGTCTTGCTCATAC-3 targeting exons 2 and 3 and the ssODN (5-GTTCTTACTTTATGTATGCTCTTTTATATATGGCTTCTGAAAGTTTTATTATTTATTTTACACAGTGTCCAAGATGAATGATAATCTGTTTGTCAGTTTGCAAGACATAAGTATTAAAGAAGATACGATTCAAAGAATTAATAGTAAGTAGTTTTGCATGAAATAAATATTTTAGTCTTTTGGTTTTATCTTATATAGCA-3) were predicted, produced, and microinjected, as previously described. Edited founders with the predicted deletion were identified through PCR using primers flanking this region (primer F 5-CACTTACATTTTCCTTTTAAGAATGC-3 and R 5-CCCCTCTCATACATACAAGTTGC-3). The 1021 allele was 285 bp long versus 413 bp of the WT allele (fig. S8, A and B). The founders were crossed with WT C57BL/6 J to eliminate possible unwanted off-targets. Heterozygous mice were resequenced and crossed to give rise to edited homozygous. Genotyping was performed by analysis of the PCR products of genomic DNA with primers F and R.

Histology. For histological analysis of ovaries, after the necropsy of the mice, their ovaries were removed and fixed in formol 10%. They were processed into serial paraffin sections and stained with hematoxylin and eosin. The samples were analyzed using a microscope OLYMPUS BX51, and images were taken with a digital camera OLYMPUS DP70.

Immunocytology. Testes were detunicated and processed for spreading using a conventional dry-down technique. Oocytes from fetal ovaries (E17.5 embryos) were digested with collagenase, incubated in hypotonic buffer, disaggregated, and fixed in paraformaldehyde. Both meiocyte preparations were incubated with the following primary antibodies for immunofluorescence (IF): rabbit SIX6OS1 R1 and R2 [1:100, Proteogenix (11)], rabbit SYCE1 17406-1-AP (1:50, Proteintech), guinea pig SYCE1 (1:100, provided by C. Hg), mouse SYCP3 immunoglobulin G (IgG) sc-74569 (1:1000, Santa Cruz Biotechnology), rabbit serum SYCP3 K921 (1:500), rabbit SYCP1 IgG ab15090 (1:200), guinea pig SYCE3(1:20, provided by R. Benavente), guinea pig SYCE2 (1:100, provided by C. Hg), rabbit TEX12 IgG (1:100, provided by R. Benavente), rabbit anti--H2AX (ser139) IgG #07-164 (1:200) (Millipore), mouse MLH1 51-1327GR (1:5, BD Biosciences), rabbit RAD51 PC130 (1:50, Calbiochem), and rabbit DMC1 R1 and R2 (1:500, Proteogenix). The secondary antibodies used were goat Alexa 555 -mouse A-32727, goat Alexa 488 -mouse A-11001, donkey Alexa 555 -rabbit A-31572 (1:200, Thermo Fisher Scientific), goat Alexa 488Fab -rabbit 111-547-003, and donkey fluorescein isothiocyanate guinea pig 706-095-148 (1:100, Jackson Immunoresearch). Slides were visualized at room temperature using a microscope (Axioplan 2; Carl Zeiss Inc.) with 63 objectives with an aperture of 1.4 (Carl Zeiss Inc.). Images were taken with a digital camera (ORCA-ER; Hamamatsu) and processed with OPENLAB 4.0.3 and Photoshop (Adobe). Quantification of fluorescence signals was performed using ImageJ software.

HEK293T and COS7 cell lines were and obtained from the American Type Culture Collection (ATCC). Cell lines were tested for mycoplasma contamination (Mycoplasma PCR ELISA, Sigma-Aldrich). They were transfected with Jetpei (PolyPlus) according to the manufacturers protocol.

Immunoprecipitation and Western blotting. HEK293T cells were transiently transfected, and whole-cell extracts were prepared and cleared with protein G Sepharose beads (GE Healthcare) for 1 hour. The antibody was added for 2 hours, and immunocomplexes were isolated by adsorption to protein G Sepharose beads overnight. After washing, the proteins were eluted from the beads with 2 SDS gel-loading buffer 100 mM tris-HCl (pH 7), 4% SDS, 0.2% bromophenol blue, 200 mM -mercaptoethanol, and 20% glycerol and loaded onto reducing polyacrylamide SDS gels. The proteins were detected by Western blotting with the indicated antibodies. Immunoprecipitations were performed using mouse -Flag IgG (5 g; F1804, Sigma-Aldrich), mouse green fluorescent protein (-GFP) IgG (4 g; CSB-MA000051M0m, Cusabio), mouse -Myc obtained from hybridoma cell myc-1-9E10.2 ATCC (4 g), and ChromPure mouse IgG (5 g/1 mg protein; 015-000-003). Primary antibodies used for Western blotting were rabbit -Flag IgG (1:2000; F7425 Sigma-Aldrich), goat -GFP IgG (sc-5385, Santa Cruz Biotechnology) (1:3000), and rabbit -Myc Tag IgG (1:3000; #06-549, Millipore). Secondary horseradish peroxidaseconjugated -mouse (715-035-150, Jackson ImmunoResearch), -rabbit (711-035-152, Jackson ImmunoResearch), or -goat (705-035-147, Jackson ImmunoResearch) antibodies were used at 1:5000 dilution. Antibodies were detected by using Immobilon Western Chemiluminescent HRP Substrate from Millipore. Both Syce1POF and Six6os1 1021 complementary DNAs (cDNAs) used for IF and coimmunoprecipitation experiments were reverse transcription PCRamplified (the primers used for it were Syce1 S 5-GAGCAGTATGGCCACCAGACC-3 and Syce AS 5-GAGGAGGGTATTAGGTCCTGC-3; Six6os1 S 5-AGTGTCCAAGATGAATGATAATCTG-3 and Six6os1 AS 5-GTTCAAAAATAATAACTCAAAAAAAC-3) from total RNA extracted from Syce1POF/POF and Six6os11021/ 1021 mice, respectively. PCR-amplified fragments were cloned in pcDNA3-based mammalian expression vectors with different tags (enhanced GFP or Flag) and verified by Sanger sequencing.

Total RNA was isolated from testis of WT and mutant mice. To analyze the expression of Syce1 and Six6os1 mRNAs, equal amounts of cDNA were synthesized using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies) and Oligo (dT). Quantitative PCR (qPCR) was performed using FastStart Universal SYBR Green Master Mix (ROX) (Roche) and specific forward and reverse primers: qSYCE1_F 5-GGACATGGTGAAAAAGTTGCAG-3 and qSYCE1_R 5-CAGTTCCTTCTGCAGGTTGTC-3 for Syce1, and qSIX6OS1_F 5-GCTGAATGTGGAGATAAAGAG-3 and qSIX6OS1_R 5-AGGAGTTTCAGGAGTTTGAGG-3 for Six6os1. All qPCR reactions were performed at 95C for 10 min and then 40 cycles of 95C for 15 s and 62C for 1 min on the iQ5 Thermal Cycler (Bio-Rad). -Actin was amplified as a housekeeping gene with the primers q-actin_F 5-GGCACCACACCTTCTACAATG-3and q-actin_R 5-GTGGTGGTGAAGCTGTAGCC-3.

Statistics. To compare counts between genotypes, we used the Welchs t test (unequal variances t test), which was appropriate as the count data were not highly skewed (i.e., were reasonably approximated by a normal distribution) and, in most cases, showed unequal variance. We applied a two-sided test in all the cases. Asterisks denote statistical significance: *P < 0.01, **P < 0.001, and ***P < 0.0001.

Acknowledgments: We thank Diamond Light Source and the staff of beamline B21 (proposals sm15836, sm21777, and sm23510). We thank H. Waller for assistance with CD data collection. Funding: O.R.D. is a Sir Henry Dale Fellow jointly funded by the Wellcome Trust and Royal Society (grant number 104158/Z/14/Z). This work was supported by MINECO (BFU2017-89408-R) and by Junta de Castilla y Leon (CSI239P18). F.S.-S., L.G.-H., and N.F.-M. are supported by European Social Fund/JCyLe grants (EDU/556/2019, EDU/1083/2013, and EDU/310/2015). CIC-IBMCC is supported by the Programa de Apoyo a Planes Estratgicos de Investigacin de Estructuras de Investigacin de Excelencia cofunded by the CastillaLen autonomous government and the European Regional Development Fund (CLC201701). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. Ethics statement: Mice were housed in a temperature-controlled facility (specific pathogen free) using individually ventilated cages, standard diet, and a 12-hour light/dark cycle, according to European Union laws at the Servicio de Experimentacion Animal, SEA. Mouse protocols were approved by the Ethics Committee for Animal Experimentation of the University of Salamanca (USAL). We made every effort to minimize suffering and to improve animal welfare. Blinded experiments were not possible since the phenotype was obvious between WT and mutant mice for all of the experimental procedures used. No randomization methods were applied since the animals were not divided in groups or treatments. The minimum size used for each analysis was two animals per genotype. Author contributions: F.S.-S., L.G.-H., O.M.D., N.F.-M., C.G.-P., M.S.-M., and O.R.D. performed experiments. O.R.D. and A.M.P. designed experiments, analyzed data, and wrote the manuscript. A.M.P., E.L., and O.R.D. supervised and designed the work. Competing financial interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Link:
Meiotic chromosome synapsis depends on multivalent SYCE1-SIX6OS1 interactions that are disrupted in cases of human infertility - Science Advances

Recommendation and review posted by Bethany Smith

One of the major challenges facing gene therapy - a way to treat disease by replacing a patients defective genes with healthy ones - is that it is difficult to safely deliver therapeutic genes to patients without the immune system destroying the gene, and the vehicle carrying it, which can trigger life-threatening widespread inflammation.

Three decades ago researchers thought that gene therapy would be the ultimate treatment for genetically inherited diseases like hemophilia, sickle cell anemia and genetic diseases of metabolism. But the technology couldnt dodge the immune response.

Since then, researchers have been looking for ways to perfect the technology and control immune responses to the gene or the vehicle. However, many of the strategies tested so far have not been completely successful in overcoming this hurdle.

Drugs that suppress the whole immune system, such as steroids, have been used to dampen the immune response when administering gene therapy. But its difficult to control when and where steroids work in the body, and they create unwanted side effects. My colleague Mo Ebrahimkhani and I wanted to tackle gene therapy with immune-suppressing tools that were easier to control.

I am a medical doctor and synthetic biologist interested in gene therapy because six years ago my father was diagnosed with pancreatic cancer. Pancreatic cancer is one of the deadliest forms of cancer, and the current available therapeutics usually fail to save patients. As a result, novel treatments such as gene therapy might be the only hope.

Yet, many gene therapies fail because patients either already have pre-existing immunity to the vehicle used to introduce the gene or develop one in the course of therapy. This problem has plagued the field for decades, preventing the widespread application of the technology.

Traditionally scientists use viruses - from which dangerous disease-causing genes have been removed - as vehicles to transport new genes to specific organs. These genes then produce a product that can compensate for the faulty genes that are inherited genetically. This is how gene therapy works.

Though there have been examples showing that gene therapy was helpful in some genetic diseases, they are still not perfect. Sometimes, a faulty gene is so big that you cant simply fit the healthy replacement in the viruses commonly used in gene therapy.

Another problem is that when the immune system sees a virus, it assumes that it is a disease-causing pathogen and launches an attack to fight it off by producing antibodies and immune response just as happens when people catch any other infectious viruses, like SARS-CoV-2 or the common cold.

Recently, though, with the rise of a gene editing technology called CRISPR, scientists can do gene therapy differently.

CRISPR can be used in many ways. In its primary role, it acts like a genetic surgeon with a sharp scalpel, enabling scientists to find a genetic defect and correct it within the native genome in desired cells of the organism. It can also repair more than one gene at a time.

Scientists can also use CRISPR to turn off a gene for a short period of time and then turn it back on, or vice versa, without permanently changing the letters of DNA that makes up or genome. This means that researchers like me can leverage CRISPR technology to revolutionize gene therapies in the coming decades.

But to use CRISPR for either of these functions, it still needs to be packaged into a virus to get it into the body. So some challenges, such as preventing the immune response to the gene therapy viruses, still need to be solved for CRISPR-based gene therapies.

Being trained as a synthetic biologist, I teamed up with Ebrahimkhani to use CRISPR to test whether we could shut down a gene that is responsible for immune response that destroys the gene therapy viruses. Then we investigated whether lowering the activity of the gene, and dulling the immune response, would allow the gene therapy viruses to be more effective.

[Deep knowledge, daily. Sign up for The Conversations newsletter.]

A gene called Myd88 is a key gene in the immune system and controls the response to bacteria and viruses, including the common gene therapy viruses. We decided to temporarily turn off this gene in the whole body of lab animals.

We injected animals with a collection of the CRISPR molecules that targeted the Myd88 gene and looked to see whether this reduced the quantity of antibodies that were produced to specifically fight our gene therapy viruses. We were excited to see that the animals that received our treatment using CRISPR produced less antibody against the virus.

This prompted us to ask what happens if we give the animal a second dose of the gene therapy virus. Usually the immune response against a gene therapy virus prevents the therapy from being administered multiple times. Thats because after the first dose, the immune system has seen the virus, and on the second dose, antibodies swiftly attack and destroy the virus before it can deliver its cargo.

We saw that animals receiving more than one dose did not show an increase in antibodies against the virus. And, in some cases, the effect of gene therapy improved compared with the animals in which we had not paused the Myd88 gene.

We also did a number of other experiments that proved that tweaking the Myd88 gene can be useful in fighting off other sources of inflammation. That could be useful in diseases like sepsis and even COVID-19.

While we are now beginning to improve this strategy in terms of controlling the activity of the Myd88 gene. Our results, now published in Nature Cell Biology,provide a path forward to program our immune system during gene therapies and other inflammatory responses using the CRISPR technology.

Continued here:
CRISPR can help combat the troubling immune response against gene therapy - The Conversation US

Recommendation and review posted by Bethany Smith

Ovarian cancer affects several women these days. Early diagnosis can help in successful treatment of the cancer. Read here to know everything about its diagnosis.

Ovarian cancer is more common in post-menopausal women

Ovarian cancer stands to be the third most common cause of cancer in Indian women. It is also the second most commonly occurring gynaecological cancers in the country today, as per reports. By the present year, 2020, India is supposed to have over 36,000 new ovarian cancer cases while around a lakh case would be prevalent. The cancer constitutes to be 6% of all cancer cases in India.

There are multiple types of ovarian cancer. The most common ones are those which develop on the ovarian surface lining. This usually affects post-menopausal women. A female reproductive system contains two ovaries, one on each side of the uterus.

The exact cause of ovarian cancer is not known; however, some of the common risk factors associated with the disease include post-menopausal status, genetic predisposition, hormonal replacement therapy, overweight and smoking.

Early detection is critical for curing ovarian cancer. Treatment and cure will be highly effective when the cancer is still confined to the ovary. The disease is largely asymptomatic in its early stages. Consequently, patients do not seek any medical advice which makes the condition worse. Diagnoses is the first step to confirm or rule out the disease.

Early detection can help treat ovarian cancer on timePhoto Credit: iStock

Unlike breast and cervical cancer, there is no standardised mass level screening technique associated with ovarian cancer. Only through a laparoscopic biopsy the epithelial precursor lesion STIC can be detected early, which cannot be applied at a mass level. More useful methods include trans vaginal USG (specially in post-menopausal women) and serial and annual USG evaluation. Another effective method can be to genetically screen the BRCA gene, which has a significant role in the disease process of hereditary ovarian cancer.

Also read:Ovarian Cancer: Causes, Symptoms, Prevention And Treatment

There are several tests used in the cases of ovarian cancer. The CA125 is the most common tested biomarker for ovarian cancer, especially for post-menopausal women. It is highly important to know the disease stage at the time of presentation, as it is crucial for evaluating the diagnostic utility of this test. The test is not sufficient as a diagnostic marker to differentiate between benign and malignant tumours. However, a new found test which is the combination of human epididymis secretory protein 4 (HE4) is considered as more competent (sensitive) in cancer detection.

Another method is to use imaging or radiology in full blown cases of cancerous ovary. The disease stage and viability of surgical resection is determined by computed tomography (CT) scan of the abdomen and pelvis with oral and intravenous contrast, and chest imaging. However, the most reliable method is to conduct a biopsy which includes cutting a small piece or surgical removal of tumour from suspected tissue and getting it examined for malignancy. A microscopic examination reveals the final diagnosis of ovarian cancer and its type.

In early stages when the tumor is operable, surgical resection of the tumor is the treatment of choice. However in advanced cases where the tumor has spread, chemotherapy is the preferred treatment modality.

Also read:Ovarian Cancer Is Deadly, But New Tests, Treatments Start To Emerge

Ovarian cancer hasn't received equivalent focus in comparison with breast and cervical cancers. The biggest challenge of the top three women cancers which include breast, cervical, and ovarian cancers is the stigma associated with it. Owing to numerous social pressures and stigmas associated with check-up of breasts and gynaecology, women don't come forward for diagnosis and worse delay treatment on being diagnosed. Consequently, they are significantly under-reported and under-investigated. It therefore becomes imperative that much awareness is imparted about the second most common gynaecological malignancy in Indian women.

Promoted

(Dr. Prabal Deb, Director Lab Operations & Chief Histopathologist, SRL Diagnostics)

Disclaimer: The opinions expressed within this article are the personal opinions of the author. NDTV is not responsible for the accuracy, completeness, suitability, or validity of any information on this article. All information is provided on an as-is basis. The information, facts or opinions appearing in the article do not reflect the views of NDTV and NDTV does not assume any responsibility or liability for the same.

Continued here:
How Is Ovarian Cancer Diagnosed? Everything You Need To Know - NDTV Doctor

Recommendation and review posted by Bethany Smith

DetailsCategory: Small MoleculesPublished on Saturday, 05 September 2020 18:01Hits: 346

Gavreto is a once-daily, oral precision therapy that selectively inhibits RET-altered cancers

Genentech and Blueprint Medicines will co-commercialize Gavreto in the United States

FDA also granted Priority Review to Gavreto for the treatment of people with advanced or metastatic RET-mutant medullary thyroid cancer (MTC) and RET fusion-positive thyroid cancer

South San Francisco, CA, USA I September 4, 2020 I Genentech, a member of the Roche Group (SIX: RO, ROG; OTCQX: RHHBY), today announced that the U.S. Food and Drug Administration (FDA) has approved Gavreto (pralsetinib) for the treatment of adults with metastatic rearranged during transfection (RET) fusion-positive non-small cell lung cancer (NSCLC) as detected by an FDA approved test. This indication was approved under the FDAs accelerated approval program based on data from the Phase I/II ARROW study. Continued approval for this indication may be contingent upon verification and description of clinical benefit in a confirmatory trial. Gavreto is a once-daily, oral precision therapy designed to selectively target RET alterations, including fusions and mutations.

The FDA approval of Gavreto for RET fusion-positive non-small cell lung cancer is an important step towards our goal of providing an effective treatment option for every person diagnosed with lung cancer, no matter how rare or hard-to-treat their type of disease, said Levi Garraway, M.D., Ph.D., chief medical officer and head of Global Product Development. We remain committed to finding personalized treatment options for people with cancer based on specific genomic or molecular alterations, and we look forward to partnering with Blueprint Medicines to further explore the potential of Gavreto across multiple RET-altered tumor types.

RET-activating fusions and mutations are key disease drivers in many cancer types, including NSCLC and medullary thyroid cancer (MTC), and treatment options that selectively target these genetic alterations are limited. In NSCLC, RET fusions represent approximately 1-2% of patients. Biomarker testing for these fusions is the most effective way to identify people who are eligible for treatment with Gavreto.

The approval is based on the results from the Phase I/II ARROW study, in which Gavreto produced durable clinical responses in people with RET fusion-positive NSCLC with or without prior therapy, and regardless of RET fusion partner or central nervous system involvement. Gavreto demonstrated an overall response rate (ORR) of 57% (95% CI: 46%, 68%) and complete response (CR) rate of 5.7% in the 87 people with NSCLC previously treated with platinum-based chemotherapy, and the median duration of response (DoR) was not reached (95% CI: 15.2 months, not reached). In the 27 people with treatment-nave NSCLC, the ORR was 70% (95% CI: 50%, 86%) with an 11% CR rate. The most common adverse reactions (25%) were fatigue, constipation, musculoskeletal pain and increased blood pressure (hypertension).

Gavreto is now the sixth FDA-approved medicine in Genentechs portfolio of treatments for lung cancer. The FDA granted Breakthrough Therapy Designation to Gavreto for the treatment of RET fusion-positive NSCLC that has progressed following platinum-based chemotherapy and for RET mutation-positive MTC that requires systemic treatment and for which there are no acceptable alternative treatments.

The FDA has also granted Priority Review to Gavreto for the treatment of people with advanced or metastatic RET-mutant MTC and RET fusion-positive thyroid cancer, and is expected to make a decision on approval by February 28, 2021. This New Drug Application (NDA) was accepted for review under the FDAs Real-Time Oncology Review (RTOR) pilot program, which aims to explore a more efficient review process to ensure safe and effective treatments are available to patients as early as possible.

For those who qualify, Blueprint Medicines will offer patient assistance programs for people prescribed Gavreto by their doctor through YourBlueprint . Please visit http://www.yourblueprint.com or contact 1-888-BLUPRNT for more information.

About the ARROW study

ARROW (NCT03037385) is a Phase I/II, open-label, first-in-human study designed to evaluate the safety, tolerability and efficacy of Gavreto, administered orally in people with rearranged during transfection (RET) fusion-positive non-small cell lung cancer (NSCLC), RET-mutant medullary thyroid cancer (MTC), RET fusion-positive thyroid cancer and other RET-altered solid tumors. The trial consists of two parts: a dose escalation portion, which is complete, and an expansion portion in people treated with 400 mg of Gavreto, once-daily. ARROW is being conducted at multiple sites across the United States, European Union and Asia.

About lung cancer

According to the American Cancer Society, it is estimated that more than 228,000 Americans will be diagnosed with lung cancer in 2020, and NSCLC accounts for 80-85% of all lung cancers. It is estimated that approximately 85% of lung cancer diagnoses in the United States are made when the disease is in the advanced stages. In NSCLC, RET fusions represent approximately 1-2% of patients.

About Gavreto

Gavreto is a once-daily, oral precision therapy designed to selectively target RET alterations, including fusions and mutations, regardless of the tissue of origin. Preclinical data have shown that Gavreto inhibits primary RET fusions and mutations that cause cancer in subsets of patients, as well as secondary RET mutations predicted to drive resistance to treatment. Blueprint Medicines and Genentech are also co-developing Gavreto for the treatment of patients with various types of RET-altered thyroid cancers and other solid tumors.

Gavreto U.S. Indication

Gavreto (pralsetinib) is indicated for the treatment of adult patients with metastatic rearranged during transfection (RET) fusion-positive non-small cell lung cancer (NSCLC) as detected by an FDA approved test.

This indication is approved under accelerated approval based on overall response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in confirmatory trials.

Important Safety Information

Gavreto may cause serious side effects, including:

Lung problems (pneumonitis) occurred in 10% of patients who received Gavreto, including 2.7% with Grade 3/4, and 0.5% with fatal reactions. Monitor for pulmonary symptoms indicative of interstitial lung disease (ILD)/pneumonitis. Withhold Gavreto and promptly investigate for ILD in any patient who presents with acute or worsening of respiratory symptoms (e.g., dyspnea, cough, and fever). Withhold, reduce dose or permanently discontinue Gavreto based on severity of confirmed ILD.

Increased blood pressure (hypertension) occurred in 29% of patients, including Grade 3 hypertension in 14% of patients. Overall, 7% had their dose interrupted and 3.2% had their dose reduced for hypertension. Treatment-emergent hypertension was most commonly managed with anti-hypertension medications. Do not initiate Gavreto in patients with uncontrolled hypertension. Optimize blood pressure prior to initiating Gavreto. Monitor blood pressure after 1 week, at least monthly thereafter and as clinically indicated. Initiate or adjust anti-hypertensive therapy as appropriate. Withhold, reduce dose, or permanently discontinue Gavreto based on the severity.

Liver problems (hepatotoxicity): Serious hepatic adverse reactions occurred in 2.1% of patients treated with Gavreto. Increased AST occurred in 69% of patients, including Grade 3/4 in 5.4% and increased ALT occurred in 46% of patients, including Grade 3/4 in 6%. The median time to first onset for increased AST was 15 days (range: 5 days to 1.5 years) and increased ALT was 22 days (range: 7 days to 1.7 years). Monitor AST and ALT prior to initiating Gavreto, every 2 weeks during the first 3 months, then monthly thereafter and as clinically indicated. Withhold, reduce dose or permanently discontinue Gavreto based on severity.

Grade 3 bleeding (hemorrhagic events) occurred in 2.5% of patients treated with Gavreto including one patient with a fatal hemorrhagic event. Permanently discontinue Gavreto in patients with severe or life-threatening hemorrhage.

Impaired wound healing can occur in patients who receive drugs that inhibit the vascular endothelial growth factor (VEGF) signaling pathway. Therefore, Gavreto has the potential to adversely affect wound healing. Withhold Gavreto for at least 5 days prior to elective surgery. Do not administer for at least 2 weeks following major surgery and until adequate wound healing. The safety of resumption of Gavreto after resolution of wound healing complications has not been established.

Based on findings from animal studies and its mechanism of action, Gavreto can cause fetal harm when administered to a pregnant woman. Advise pregnant women of the potential risk to a fetus. Advise females of reproductive potential to use effective non-hormonal contraception during treatment with Gavreto and for 2 weeks after the final dose. Advise males with female partners of reproductive potential to use effective contraception during treatment with Gavreto and for 1 week after the final dose. Advise women not to breastfeed during treatment with Gavreto and for 1 week after the final dose.

Common adverse reactions (25%) were fatigue, constipation, musculoskeletal pain, and hypertension. Common Grade 3-4 laboratory abnormalities (2%) were decreased lymphocytes, decreased neutrophils, decreased phosphate, decreased hemoglobin, decreased sodium, decreased calcium (corrected) and increased alanine aminotransferase (ALT).

Avoid coadministration with strong CYP3A inhibitors. Avoid coadministration of Gavreto with combined P-gp and strong CYP3A inhibitors. If coadministration cannot be avoided, reduce the Gavreto dose. Avoid coadministration of Gavreto with strong CYP3A inducers. If coadministration cannot be avoided, increase the Gavreto dose.

Please click here to see the full Prescribing Information for Gavreto.

Gavreto, Blueprint Medicines, YourBlueprint and associated logos are trademarks of Blueprint Medicines Corporation.

About Genentech in lung cancer

Lung cancer is a major area of focus and investment for Genentech, and we are committed to developing new approaches, medicines and tests that can help people with this deadly disease. Our goal is to provide an effective treatment option for every person diagnosed with lung cancer. We currently have six approved medicines to treat certain kinds of lung cancer and more than 10 medicines being developed to target the most common genetic drivers of lung cancer or to boost the immune system to combat the disease.

About Genentech

Founded more than 40 years ago, Genentech is a leading biotechnology company that discovers, develops, manufactures and commercializes medicines to treat patients with serious and life-threatening medical conditions. The company, a member of the Roche Group, has headquarters in South San Francisco, California. For additional information about the company, please visit http://www.gene.com.

SOURCE: Genentech

See the rest here:
Genentech Announces FDA Approval of Gavreto (pralsetinib) for the Treatment of Adults With Metastatic RET Fusion-Positive Non-Small Cell Lung Cancer |...

Recommendation and review posted by Bethany Smith

Today, in our Gilmore Health Q&A Series we discuss genetic diseases with Dr. Sony Sherpa as they are a biological, and financial burden. They may only affect a single member of the family physically but can be socially and mentally draining for the rest of the family.

Genetic diseases are a group of diseases that can pass from parents to their children, causing disease with varying degrees of severity. Genetic diseases are relatively common, making up to 14% of all pediatric discharges. Furthermore, they cost upwards of 50 billion dollars yearly, putting a financial strain on the families of affected individuals

Here we talk more about genetic diseases with Dr. Sony Sherpa, to get more insight into these diseases with the aim of understanding them further.

What are genetic diseases? Arent all diseases genetic, technically?

Dr. Sony Sherpa: Well, yes. As researchers learn more about diseases and the different components to them, they have concluded that almost all diseases do have a genetic component to them. However, a genetic disease is a disease that occurs as a result of a change in a persons DNA. This change or mutation can cause disease of varying severity depending on the extent of damage done to the DNA.

So, when you say all diseases have a genetic component, that means all diseases arise from this change in the DNA?

The short answer is yes. The long answer is that most genetic diseases are diseases arising from mutations in one single gene. But most diseases, in general, are what we call multifactorial, or complex disease. Now, these diseases can arise due to environmental factors, genetic factors, occupational hazards, or iatrogenic reasons. Hence, the name; multifactorial. The genetic component of these diseases, albeit a small part, is a very important part in the understanding of these diseases.

Could you perhaps elaborate on this with an example?

Yes, sure. Diseases like sickle cell or Cystic fibrosis are genetic diseases. They arise from a mutation in a single gene and have a clear cut inheritance pattern. On the other hand, there are diseases like diabetes mellitus type 2 or cardiovascular diseases that are polygenic in origin. Not just that, the inheritance pattern of these diseases isnt understood much either. While many studies are looking into it, its going to be a while before we understand the hereditability factors of these complex diseases.

Can complex diseases be passed on from parents to their children? Is it seen usually, or is that one of the many things yet to be discovered?

Complex diseases usually cluster in families, but as I mentioned before, there is no clear explanation for that phenomenon yet.

Alright, then how do single gene-genetic diseases pass on from parents to offsprings?

That we have an understanding of. At least the basics. There are five inheritance patterns of single-gene genetic diseases, namely; Autosomal Dominant, Autosomal Recessive, X-linked Dominant, X-linked Recessive, and mitochondrial. However, the pattern of inheritance differs for each disease.

All single-gene genetic disorders follow one of these five inheritance patterns. Whats the difference between them, in simple terms? What is the basis of separation between these patterns?

Well, it is pretty interesting. Inheritance patterns tell us the origin of the genetic disease, the genotype it has and it can mathematically estimate the percentage risk that a child born to two carriers/patients will have the disease. The genotype of the genetic makeup decides the phenotype or physical appearance of the disease for everyone. The genotype can be realized from alleles that are received from both parents. These alleles can recognize the traits and then classify the inheritance into dominant or recessive. Basically, if a disease requires a mutation to be present on both alleles, then it is recessive. But if it can be pathological with just one mutated allele, then it is dominant.

What about the mitochondrial inheritance pattern then?

Some books and studies still do not accept mitochondrial inheritance patterns to be one of the main inheritance patterns. But regardless of that, it is an important topic. Mitochondria of the cell have their own DNA. And this DNA is passed down from mother to offspring. Its always inherited from the mother. Therefore, any mitochondrial disease would also be purely maternal in origin.

Since these diseases are inherited with alleles on genes and are due to mutation in the DNA, how does one diagnose these diseases? I am assuming it would require a lot of genetic karyotyping and testing? That sounds like a very tedious and complicated process.

Dr. Sony Sherpa: Yes and No. Yes, genetic diseases are very much gene-related as the name suggests, these diseases are diagnosed mostly through genetic testing. OR better yet, the diagnosis is usually suspected through clinical presentation and laboratory testing, it is confirmed through genetic testing.

Genetic testing is not tedious, and a very simple procedure. It can be done in one of three ways; cytogenetic genetic testing wherein the entire chromosome is analyzed and studied, biochemical genetic testing which includes testing the proteins and the biochemical reactions associated with them, and lastly, molecular genetic testing for analysis of small DNA mutation.

You mentioned suspicion of a genetic disease. What araises suspicion of a genetic disease, what are the symptoms that can be alarming?

The suspicion of genetic diseases depends on physical examination, family, and personal history. The red flags for a doctor usually include positive family history, history of miscarriages or stillbirths in the mother of the affected individual, presence of clinical signs characteristic of a genetic syndrome, and so on. If the mother admits to being exposed to teratogens, whether occupational, alcohol, or certain medications, they may also alert the physician towards the presence of a genetic disease or syndrome. Usually, there are mandatory screening tests for certain genetic conditions in most countries.

Basically, a genetic disorder can be the differential diagnosis of many symptoms an individual might present to the hospital with?

Dr. Sony S: Well, yes. Pretty much so.

And how would someone affected by a genetic disease get treated for these conditions? It would seem like they would need a gene treatment plan.

Treatment of genetic diseases obviously depends on each disease and what it entails. For genetic syndromes, the plan is usually to prevent its progress with medications all the while treating the symptoms of the disease. Depending on the symptoms, appropriate therapy may be applied.

Genetic diseases are a life-long process, and they require a very healthy lifestyle and strict adherence to medical therapy and surgical therapy if needed, for a chance to have a good quality of life. The main aim is to increase the quality of life and increase the life expectancy of affected individuals. It mostly is symptomatic therapy of sorts.

That explains it. Thank you for your time.

And until our next Q&A session please share us and like us so that we may continue to provide you with the latest in medicine, health, and fitness free of charge. You may also join the Gilmore Health newsletter to receive the latest in health news. If you are interested in any subject that you wish us to cover please share it with us at the comments area below!

Chronic Fatigue Syndrome: A Large Genetic Study to Identify the Mechanisms of the Disease Is Underway in the UK

Turner Syndrome Latest Facts: Causes, Symptoms, Diagnosis and Treatment

University of Connecticut Reverses Prader-Willi Syndrome in Lab by Restoring Silent Genes

CRISPR Technology Could Be Soon Used to Treat Obesity

Spinal Muscular Atrophy Latest Facts: What is it, How to Diagnose and Treat it?

X-Linked Juvenile Retinoschisis Latest Facts: Etiology, Diagnosis and Tr

Congenital Mirror Movement Disorder Caused by a Mutation in the RAD51 Gene French Study Shows

ASOs Are An Effective Treatment Option for Pelizaeus-Merzbacher Disease, Researchers say

Hashimotos Disease Latest Facts: Causes, Symptoms and Treatments

Behets Disease Latest Facts: Causes, Symptoms and Treatments

Spinal Muscular Atrophy Latest Facts: What is it, How to Diagnose and Treat it

Fragile X Syndrome Latest Facts: Symptoms, Diagnosis, and Treatment

Klinefelter Syndrome Latest Facts: Symptoms, Diagnosis and Treatment

Originally posted here:
Gilmore Health: A Q&A Session on Genetic Diseases With Dr. Sony Sherpa - Gilmore Health News

Recommendation and review posted by Bethany Smith

WASHINGTON, Sept. 4, 2020 /PRNewswire/ -- During the COVID-19 pandemic, many stem cell transplant centers including guidance from the National Marrow Donor Program (NMDP) recommend that stem cell products be frozen for preservation. However, a new study in Blood Advances suggests that the freezing process can decrease the quality of stem cells, particularly if they were manipulated before being preserved, if they had high white blood cell content, or if they were stored for a long period of time.

Stem cells can develop into many different types of cells, so they are often used in treatment to replace or repair damaged organs or tissues. Allogeneic stem cell transplantation, which involves transferring stem cells from a healthy donor to a patient, can treat a variety of diseases, including leukemia, lymphoma, myeloma, thalassemia, and sickle cell disease.

Before the coronavirus outbreak, it was not common to freeze allogeneic donor stem cells prior to infusion. However, due to COVID-19's effects on donor and hospital availability, as well as new travel and transportation restrictions, more transplant centers including the NMDP are recommending cryopreservation.

"Prior to COVID-19, the donor and transplant systems were well coordinated and effective. Now, with irregular flights and closed borders, travel and transportation are not assured," said lead study author Duncan Purtill, MD, of Fiona Stanley Hospital in Western Australia. "Five to seven days before stem cell transplant, the recipient usually starts chemotherapy to remove all their bone marrow cells. Without a healthy transplant to replace the cells on the same day, they would be left with no functioning bone marrow, which would of course be very high risk and carry a poor prognosis. Life literally depends on the safe arrival and immediate infusion of stem cells."

Dr. Purtill and his team analyzed 305 samples of allogeneic stem cell products that were cryopreserved at participating Australian cell processing labs between 2015 and 2019. They found that, on average, the recovery of the stem cell products was 74%. This is considered an acceptable, viable recovery, enabling the cells to be used in transplantation. However, some products did not recover to that level: around 15% of the surveyed products had a cell recovery of less than 50%. In fact, the study found that quality recovery could range as low as just 6%. Such a significant cell loss after thawing may mean that the remaining cells may be too few, or too damaged, to achieve timely bone marrow recovery in the patient after infusion.

"It seems that there is variability in recovery and more work needs to be done to determine why," said Dr. Purtill. "When we freeze stem cells and then thaw them afterwards, we sometimes get unexpected results. In this study we identified some possible factors influencing that variability."

The research team pointed to three possible reasons for the loss of quality in some of the stem cells products they analyzed. First, they noted that prolonged transportation and storage time prior to cryopreservation was associated with a loss of quality. They also found that higher white cell concentration of the product affected its quality. It was thought that the presence of other white cells could adversely affect the stem cells, either by releasing damaging enzymes or chemicals, or else by consuming nutritional elements within the product and resulting in less healthy stem cells. And finally, they pointed out that a small proportion of cells which underwent complex manipulation before being frozen also suffered quality loss for instance, when the cell processing lab removed lymphocytes or washed the product to remove plasma and other noncellular components.

Dr. Purtill and his collaborators expressed hope that their findings could serve to inform and improve stem cell transplantation, collection, and processing procedures. "Our findings could be a note of caution for transplant centers to not take for granted that the frozen product they have received will show perfect recovery once thawed," said Dr. Purtill. "I hope centers will insist on receiving a pilot vial which has been frozen and transported in the same way. They can assess the pilot vial to determine its viability before they use the full product and start chemotherapy for the patient."

Blood Advancesis a peer-reviewed, online only, open access journal of the American Society of Hematology (ASH), the world's largest professional society concerned with the causes and treatment of blood disorders.

Blood Advances is a registered trademark of the American Society of Hematology.

The rest is here:
Study: Cryopreservation Associated with Loss of Quality in Donor Stem Cell Products - WFMZ Allentown

Recommendation and review posted by Bethany Smith

Could gene therapy provide a solution to HIV? A new research project aims to find out.

The National Institutes of Health(NIH) has backed researchers at the University of Southern California and the Fred Hutchison Cancer Center with a five-year, $14.6 million grant to develop a gene therapy that could potentially control HIV without the need for daily medications. Most HIV patients take a well-regimented cocktail of medications each day to control the virus. This therapy could change that. According to an announcement from the Keck School of Medicine at USC, the goal will be to develop a therapy that prepares patients for a stem cell transplantation using their own cells with little to no toxicity, engineers their own stem cells to fight HIV and stimulates those cells to quickly produce new and engineered immune cells once they're reintroduced into the patient. The hematopoietic stem cell transplants, also known as bone marrow transplants, have been used to treat some blood cancers. The idea is to infuse an HIV patient withhealthy donor blood stem cells that can grow into any type of blood or immune cell.

The gene therapy strategy has been inspired by three cases where leukemia patients who also had HIV received blood stem cell transplants from donors who also carried a mutation that confers immunity to HIV. The mutation was in the CCR5 gene, which encodes a receptor that HIV uses to infect immune cells and is present in about 1 percent of the population, USC said.

The program will engineer blood cells to remove CCR5 from a patient's own stem cells.That will be combined with other genetic changes so that the progeny of engineered stem cells will release antibodies and antibody-like molecules that block HIV.

In addition to the potential gene therapy treatment, researchers are also assessing whether or not CAR-T treatments will benefit HIV patients. Researchers from Harvard University developed a Dual CAR T-cell immunotherapy that can potentially help fight HIV infection. First reported by Drug Target Review, the HIV-specific CAR-T cell is being developed to not only target and eliminated HIV-infected cells, but also reproduce in vivo to enable the patients to fight off the infection. HIVs primary target it T cells, which are part of the bodys natural immune response.

Todd Allen, a professor of Medicine at Harvard Medical School, said the Dual CAR-T cell immunotherapy has so far provided a strong, long-lasting response against HIV-infection while being resistant to the virus itself.

According to the report, theDual CAR T cell was developed through the engineering of two CARs into a single T cell. Each of the CARs contained a CD4 protein that allowed it to target HIV-infected cells and a costimulatory domain, which signaled the CAR T cell to increase its immune functions. As DTR reported, the first CAR contained the 4-1BB co-stimulatory domain, which stimulates cell proliferation and persistence, while the second has the CD28 co-stimulatory domain, which increases its ability to kill infected cells.

To protect the CAR-T cells from HIV, the team added the protein C34-CXCR4, which prevents HIV from attaching to and infecting cells. When that was added, the researchers found in animal models that the treatment was long-lived, replicated in response to HIV infection, killed infected cells effectively and was partially resistant to HIV infection.

Still, other researchers are looking to those rare individuals who are infected with HIV but somehow on their own are able to suppress the virus without the need for any treatment. Researchers have sought to replicate what this small percentage of patients can naturally do in other patients who require those daily regimens of medications. Through the sequencing of the genetic material of those rare individuals, researchers made an interesting discovery.

The team discovered large numbers of intact viral sequences in the elite controllers chromosomes. But in this group, the genetic material was restricted to inactive regions, where DNA is not transcribed into RNA to make proteins, MedNewsToday reported.

Now the race is on to determine how this can be replicated and used to treat the nearly 38 million people across the globe who have been diagnosed with HIV.

Original post:
New HIV Gene Therapy, CAR-T Treatments Could be on the Horizon for Patients - BioSpace

Recommendation and review posted by Bethany Smith

Global Human Mesenchymal Stem Cells (hMSC) Market report forecast 2020-2024 investigate the market size, manufactures, types, applications and key regions like North America, Europe, Asia Pacific, Central & South America and Middle East & Africa, focuses on the consumption of Human Mesenchymal Stem Cells (hMSC) in these regions. This report also studies the global Human Mesenchymal Stem Cells (hMSC) market share, competition landscape, status share, growth rate, future trends, market drivers, opportunities and challenges, sales channels and distributors.

About Human Mesenchymal Stem Cells (hMSC):

Get a Sample Copy of the Report at: https://www.absolutereports.com/enquiry/request-sample/13755739

Human Mesenchymal Stem Cells (hMSC) Market Manufactures:

Human Mesenchymal Stem Cells (hMSC) Market Types:

Human Mesenchymal Stem Cells (hMSC) Market Applications:

Inquire or Share Your Questions If Any before the Purchasing This Report: https://www.absolutereports.com/enquiry/pre-order-enquiry/13755739

Scope of this Report:

The content of the study subjects, includes a total of 15 chapters:

Purchase this Report (Price 3480 USD for A Single-User License) at: https://www.absolutereports.com/purchase/13755739

Table of Contents of Human Mesenchymal Stem Cells (hMSC) Market:

1 Market Overview

1.1 Human Mesenchymal Stem Cells (hMSC) Introduction

1.2 Market Analysis by Type

1.2.1 Type 1

1.2.2 Type 2

1.3 Market Analysis by Applications

1.3.1 Application 1

1.3.2 Application 2

1.4 Market Analysis by Regions

1.4.1 North America (United States, Canada and Mexico)

1.4.2 Europe (Germany, France, UK, Russia and Italy)

1.4.3 Asia-Pacific (China, Japan, Korea, India and Southeast Asia)

1.4.4 South America, Middle East and Africa

1.4.4.5 Turkey Market States and Outlook (2014-2024)

1.5 Market Dynamics

1.5.1 Market Opportunities

1.5.2 Market Risk

1.5.3 Market Driving Force

2 Manufacturers Profiles

2.1 Manufacture

2.1.1 Business Overview

2.1.2 Human Mesenchymal Stem Cells (hMSC) Type and Applications

2.1.2.1 Product A

2.1.2.2 Product B

2.1.3 Manufacture Human Mesenchymal Stem Cells (hMSC) Sales, Price, Revenue, Gross Margin and Market Share (2017-2018)

3 Global Human Mesenchymal Stem Cells (hMSC) Sales, Revenue, Market Share and Competition by Manufacturer (2017-2018)

3.1 Global Human Mesenchymal Stem Cells (hMSC) Sales and Market Share by Manufacturer (2017-2018)

3.2 Global Human Mesenchymal Stem Cells (hMSC) Revenue and Market Share by Manufacturer (2017-2018)

3.3 Market Concentration Rate

3.3.1 Top 3 Human Mesenchymal Stem Cells (hMSC) Manufacturer Market Share in 2018

3.3.2 Top 6 Human Mesenchymal Stem Cells (hMSC) Manufacturer Market Share in 2018

3.4 Market Competition Trend

13 Sales Channel, Distributors, Traders and Dealers

13.1 Sales Channel

13.1.1 Direct Marketing

13.1.2 Indirect Marketing

13.1.3 Marketing Channel Future Trend

13.2 Distributors, Traders and Dealers

14 Research Findings and Conclusion

15 Appendix

15.1 Methodology

15.2 Data Source

Contact Us:

Name: Ajay More

Phone: US +1424 253 0807/ UK +44 203 239 8187

Email id- [emailprotected]

Our Other Reports:

Global Myasthenia Gravis Therapies 2020 Market Research Report 2020, Industry Size, Share, Competitive Landscape, Regions and Covid-19 Impact Analysis to 2024

Global Fire Extinguishers 2020 Market by Manufactures, Types, Applications, Regions, Growth and Forecast to 2024 |Absolute Reports

Cricket Protein Powders Market 2020 by Global Market Insights, Manufacturers, Regions, Technology, Development, Application and Forecast to 2024 | Absolute Reports

Global Segmented Diamond Saw Blades Market Detailed Analysis Report by Market Dynamics, Size, Growth, Covid-19 Impact and Forecast to 2024

Global Denatonium Saccharide Market Size 2020 by Manufacturers, Regions, Type and Application, Forecast to 2025

Touring Bike Market Size 2020 Global Leading Players, Industry Updates, Future Growth, Business Prospects, Forthcoming Developments and Future Investments by Forecast to 2025

Global Carbide Blank Market Size by Manufactures, Types, Applications and Forecast 2020 to 2025

More:
Global Human Mesenchymal Stem Cells (hMSC) Market 2020, Impact of Covid-19 on Leading Vendors, Types, Applications, Regions and Forecast to 2024 - The...

Recommendation and review posted by Bethany Smith

In 2016, Danny Wade, a successful marketing professional and an active and doting father to his three young children, aged 11, 8 and 6, checked himself into the emergency department when he began experiencing severe, inexplicable bone pain and unusual fatigue.

Two days later, after undergoing a battery of tests, Danny was diagnosed with multiple myeloma, a little-known and incurable cancer of the plasma cells. He was just 42 years old.

"I was shocked when I got the news, Danny recalls. What upset me most was when the doctor told me that the average life expectancy for myeloma patients was only five to seven years. The thought that I would not see my children grow up was devastating. I knew I had to fight for my life.

Thats exactly what Danny has been doing. Within six months of being diagnosed, Danny went through a difficult high-dose chemotherapy regimen to prepare for an autologous stem cell transplant using his own stem cells. Then in 2017 after further tests, Dannys doctors recommended that his best option for survival was to undergo another transplant with stem cells from a healthy donor. He took his doctors advice and underwent the procedure. Fortunately, he was eligible to participate in a clinical trial at Maisonneuve-Rosemont Hospital where he received a breakthrough therapy involving bi-weekly injections that he will continue to take for a year.

Dannys condition is relatively stable at this time, and he extremely thankful to still be alive. He is thrilled to watch his children grow and to resume being an active part of their lives. He credits his survival to the life-saving treatments that he has access to and the love and support he receives from his partner, Anik. With my beloved Anik by my side, Ive had the courage to get through this nightmare and to have faith that I can get through whatever else the future holds.

Danny is eager to do what he can to help others living with myeloma. I made a promise that once I was doing well, I would do everything in my power to help find a cure so that other patients dont have to live through the horrors I have," says Danny. Danny is a member of the organizing committee of the Montreal Support Group, and recently co-founded the South Shore Myeloma Support Group.

Over the past four years, Danny has seen, first-hand, the life-changing impact that advances in myeloma research are having on the lives of those living with this incurable cancer. Thats why he and his family are more intent than ever to raise as much awareness and funds for myeloma as they can, and will be participating in Myeloma Canadas 12th annual Montreal Multiple Myeloma March on Sunday, September 20, at 10 am.

This years Montreal March has been modified to help stop the spread of COVID-19. In compliance with physical distancing measures, participants are encouraged to hold their own walk in their neighbourhood at the same time as the regularly scheduled March on September 20. Danny and his fellow Montreal Marchers have set their fundraising goal at $60,000 to help further crucial research for this deadly blood cancer that affects nine new Canadians every day.

Myeloma research has produced extremely promising results over the past two decades. In fact, for the first time, theres a cure in sight, says Dr Richard LeBlanc, Medical Hematologist and Oncologist, and holder of the Myeloma Canada Chair in Multiple Myeloma Research at the Universit de Montral. We cant afford to let the current situation stop the progress weve made and put vulnerable people living with myeloma at risk, which is why its more crucial than ever to invest in research and find a cure.

The Multiple Myeloma March, Myeloma Canadas flagship fundraiser is now in its 12th year. The annual five-kilometer event brings Canadian communities together to raise essential funds for research and to help improve the lives of all Canadians impacted by myeloma. Montreal is one of a record 33 communities across the country to be included in this years Multiple Myeloma March. The national fundraising goal is set at $650,000. To learn more about how this event will be working, please click here.

While this years March will undoubtedly be different because of the pandemic, its crucial to stay positive, says Martine Elias, Executive Director of Myeloma Canada. Fundraising has taken a huge hit for many organizations. We need to do all we can to increase awareness and raise essential funds for research that will improve the lives of Canadians impacted by myeloma, and bring us closer to a cure, Martine added. As we mark Myeloma Canadas 15th anniversary, we celebrate the strength of our incredible community. More than ever, were counting on our supporters to help us achieve our goal of $650,000. Canadians impacted by this incurable cancer are depending on us.

This year, a minimum of 50% of funds raised by the Multiple Myeloma March will go directly to support Myeloma Canadas Myeloma Research Priority Setting Partnership (PSP), the first program of its kind in myeloma. The PSP will use input provided by the Canadian myeloma community to identify and define investments in myeloma research over the next 18 months. The balance raised will go toward supporting various myeloma research projects and initiatives that are pivotal for improving quality of life and moving the needle toward a cure.

Multiple myeloma, also known as myeloma, is the second most common form of blood cancer. Myeloma affects a type of immune cell called the plasma cell, found in the bone marrow. Every day, nine Canadians are diagnosed, yet in spite of its growing prevalence, the disease remains relatively unknown. While there is no cure, people with myeloma are living longer and better lives, thanks to recent breakthroughs in treatment. To find the cure, more funding and research are required. To learn more, or to donate, please visit http://www.myeloma.ca

Myeloma Canada

http://www.myeloma.ca

AB

Here is the original post:
Father of Three with Incurable Cancer is Helping Researchers Get One Step Closer to a Cure - The Suburban Newspaper

Recommendation and review posted by Bethany Smith

The Stem Cell Market report 2020 provides comprehensive analysis of Stem Cell industry by types, applications, regions. It shows Stem Cell market 2020-2024 by production, consumption, supply, gross margin, revenue of key players in the industry. Additionally, Stem Cell market report covers market size, share, and growth rate of industry with respect to regions.

Stem Cell market includes following leading manufacturers on the basis of sales, revenue, price, and gross margin.

Stem Cell market report presents in-depth analysis regarding the development, current trends, industry policies, and regulations implemented in each of the geographical regions. It includes analysis of upstream raw materials, downstream demand, and current market dynamics. Furthermore, the Stem Cell market report provides an in-depth insight into Stem Cell industry during 2020-2024.

Scope of the Report:

The scope of this market is limited to tracking the stem cell market. As per the scope of this report, stem cells are biological cells that can differentiate into other types of cells. Also, various types of stem cells are used for therapeutic purposes.

Inquire or Share Your Questions If Any Before the Purchasing This Report https://www.industryresearch.co/enquiry/pre-order-enquiry/13999718

Key Market Trends:

Oncology Disorders Segment is Expected to Exhibit Fastest Growth Rate Over the Forecast Period

Cancer has a major impact on society in the United States and across the world. As per the estimation of National Cancer Institute, in 2018, 1,735,350 new cases of cancer were anticipated to get diagnosed in the United States, and 609,640 deaths were expected from the disease. This increasing medical burden is due to population growth. Bone marrow transplant or stem cell transplant is a treatment for some types of cancers, like leukemia, multiple myeloma, multiple myeloma, neuroblastoma, or some types of lymphoma.

Embryonic stem cells (ESC) are the major source of stem cells for therapeutic purposes, due to their higher totipotency and indefinite lifespan, as compared to adult stem cells with lower totipotency and restricted lifespan. However, the use of ESCs for research and therapeutic purposes is restricted and prohibited in many countries throughout the world, due to some ethical constraints. Scientists from the University of California, Irvine, created the stem cell-based approach to kill cancerous tissue while preventing some toxic side effects of chemotherapy by treating the disease in a more localized way.

Although the market shows positive growth, due to the growing focus of stem cell-based research that can further strengthen the clinical application, its expensive nature for stem cell therapy may still hamper its growth.

North America Captured The Largest Market Share and is Expected to Retain its Dominance

North America dominated the overall stem cell market with the United States contributing to the largest share in the market. In 2014, the Sanford Stem Cell Clinical Center at the University of California, San Diego (UCSD) Health System, announced the launch of a clinical trial, in order to assess the safety of neural stem cell-based therapy in patients with chronic spinal cord injury. Researchers hoped that the transplanted stem cells may develop into new neurons that could replace severed or lost nerve connections, and restore at least some motor and sensory functions. Such numerous stem cell studies across the United States have helped in the growth of the stem cell market.

Reasons to Buy Stem Cell Market Report:

Purchase this Report (Price 4250 USD for a Single-User License) https://www.industryresearch.co/purchase/13999718

Stem Cell Market Report Covers the Following Questions:

Detailed TOC of Stem Cell Market 2020-2024:

1 INTRODUCTION1.1 Study Deliverables1.2 Study Assumptions1.3 Scope of the Study

2 RESEARCH METHODOLOGY

3 EXECUTIVE SUMMARY

4 MARKET DYNAMICS4.1 Market Overview4.2 Market Drivers4.2.1 Increased Awareness about Umbilical Stem Cell4.2.2 Increase in the Approval for Clinical Trials in Stem Cell Research4.2.3 Growing Demand for Regenerative Treatment Option4.2.4 Rising R&D Initiatives to Develop Therapeutic Options for Chronic Diseases4.3 Market Restraints4.3.1 Expensive Procedures4.3.2 Regulatory Complications4.3.3 Ethical and Moral Framework4.4 Industry Attractiveness- Porters Five Forces Analysis4.4.1 Threat of New Entrants4.4.2 Bargaining Power of Buyers/Consumers4.4.3 Bargaining Power of Suppliers4.4.4 Threat of Substitute Products4.4.5 Intensity of Competitive Rivalry

5 MARKET SEGMENTATION5.1 By Product Type5.1.1 Adult Stem Cell5.1.2 Human Embryonic Cell5.1.3 Pluripotent Stem Cell5.1.4 Other Product Types5.2 By Therapeutic Application5.2.1 Neurological Disorders5.2.2 Orthopedic Treatments5.2.3 Oncology Disorders5.2.4 Diabetes5.2.5 Injuries and Wounds5.2.6 Cardiovascular Disorders5.2.7 Other Therapeutic Applications5.3 By Treatment Type5.3.1 Allogeneic Stem Cell Therapy5.3.2 Auto logic Stem Cell Therapy5.3.3 Syngeneic Stem Cell Therapy5.4 By Banking Service and Technology5.4.1 Stem Cell Acquisition and Testing5.4.2 Cell Production5.4.3 Expansion5.4.4 Sub-culture5.4.5 Cryopreservation5.5 By Type of Banking5.5.1 Public5.5.2 Private5.6 Geography5.6.1 North America5.6.1.1 US5.6.1.2 Canada5.6.1.3 Mexico5.6.2 Europe5.6.2.1 UK5.6.2.2 Germany5.6.2.3 France5.6.2.4 Italy5.6.2.5 Spain5.6.2.6 Rest of Europe5.6.3 Asia-Pacific5.6.3.1 China5.6.3.2 Japan5.6.3.3 India5.6.3.4 Australia5.6.3.5 South Korea5.6.3.6 Rest of Asia-Pacific5.6.4 Middle East & Africa5.6.4.1 GCC5.6.4.2 South Africa5.6.4.3 Rest of Middle East & Africa5.6.5 South America5.6.5.1 Brazil5.6.5.2 Argentina5.6.5.3 Rest of South America

6 COMPETITIVE LANDSCAPE6.1 Company Profiles6.1.1 Osiris Therapeutics Inc.6.1.2 Pluristem Therapeutics Inc.6.1.3 Thermo Fisher Scientific6.1.4 Qiagen NV6.1.5 Sigma Aldrich Corporation6.1.6 Becton, Dickinson and Company6.1.7 Stem Cell Technologies Inc.6.1.8 AllCells LLC6.1.9 Miltenyi Biotec6.1.10 International Stem Cell Corporation

7 MARKET OPPORTUNITIES AND FUTURE TRENDS

Contact Us:

Name: Ajay More

Phone: US +14242530807/ UK +44 20 3239 8187

Email: [emailprotected]

Our Other Reports:

Omega 3 Products Market Insights on Global Share 2020 Latest Industry Trends, Market Demand, Growth, Opportunities and Forecast 2026

Mattress Supports Market Size and Share Forecast Analysis, Top Key Players, Latest Developments, Growth Factors till 2020 to 2024 | Research Report by Industry Research.co

Automotive Metal Coil Spring Market Growth by Forthcoming Developments 2020 Global Industry Scope, Future Prospects, Manufacturers with Size and Share Analysis till 2026 | Report by Industry Research.co

Healthcare 3D Printing Market Share and Business Development 2020 Future Plans of Top Companies, Growth Size, Industry Share by Latest Trends Forecast to 2025

Human Microbiome Sequencing Market Business Growth Analysis with COVID-19 Impact, Future Trends, Industry Size, Global Share and Demand Status Forecast to 2026 Available at Industry Research.co

Underfloor Heating and Cooling Market Growth, Industry Trends 2020 Size by Regions, Global Industry Share, Sales Revenue and Opportunities till 2026 with COVID-19 Impact

Casing Heads Market Size, Share | Growth Analysis by Revenue, Future Demand Status, Price Analysis by Types and Applications till 2020-2026

Engine Cooling Pumps Market Share and Forecast by 2020 to 2026 | Top Key Players Analysis Covers Regions with Growth Value, Comprehensive Development Strategy, Global Size with Revenue and COVID-19 Impact

Go here to see the original:
Stem Cell Market 2020: Share Value Analysis of Top Key Players, Global Size, Consumption Analysis, Trends Forecast to 2024 | Industry Research.co -...

Recommendation and review posted by Bethany Smith

Compiled by Gabi Zietsman | Health24

04 Sep 2020, 02:45

Two hikers are going to great heights to increase awareness of blood disorders, and the urgent need for bone marrow donors in South Africa.

In a symbolic hike up the country's highest peak in the Drakensberg range, adventurer and bone marrow donor Clayton Coetzee and expert mountaineer and author Gavin Raubenheimer will be tackling Mafadi from 7 to 9 September in honour of those who have helped save the lives of countless people suffering from blood disorders.

Bone marrow donation is close to my heart as one of my dearest friends got sick with Acute Myeloid Leukaemia (AML) several years ago," says Coetzee. "Its then when I heard about the SA Bone Marrow Registry and the life-saving work that they do, and I decided to sign up as a donor."

READ | Could smoking lead to this blood disorder?

Increase in cases

Blood cancer is one of the most common of these disorders and affects children the most, while other blood disorders include non-Hodgkin lymphoma (NHL).

Unfortunately, according to the Search Coordinator for the SA Bone Marrow Registry (SABMR) Alicia Venter, these diseases have increased in the last decade 45% in NHL cases and 26% in leukaemia cases.

"While recommended, prevention efforts, such as lifestyle changes, tend to be less effective for hematologic malignancies than for other cancers, which makes a blood stem cell transplant a patients only hope for survival," says Venter.

In order to be a suitable bone marrow donor, your human leukocyte antigen (HLA) needs to match someone in need. HLAs are genes in a human's DNA that help regulate immunity and affect whether or not a recipient's body will reject a transplant.

READ MORE | Bone marrow transplants less risky now

Need more non-white donors

Finding a match, however, isn't as easy as swiping on a dating app and SAMBR has a serious lack of diversity in the donor database. Currently, there are only about 74 000 local donors on the South African Bone Marrow Registry.

In South Africa, there is a dire need for donors of colour," explains Venter.

"When it comes to matching HLA types, a patients ethnicity plays an important role as HLA markers are inherited. Some ethnic groups have more complex tissue types than others, therefore finding a match is most likely to come from someone of the same ethnic group."

'As easy as giving blood'

The hike is supposed to be symbolic of the uphill battle that faces those suffering from blood disorders, including finding a suitable donor to increase their chances of survival. Besides the gruelling experience, SAMBR will also be doing a cheek swab drive at the same time in Agulhas, Western Cape, and Musina, Limpopo, to help boost donor registrations.

According to Coetzee, it's easy to be registered as a donor all it takes is a cheek swab. If you do match with someone, it's "almost as easy as giving blood".

If a match is found, a donor will undergo a full medical exam to look for any exclusionary factors like obesity, HIV status, other chronic conditions and viral infections. Once cleared, the donor goes on a five-day treatment of injections to increase the number of stem cells in the bloodstream.

On the fifth day, the donor will be admitted to a hospital and connect to a cell separator machine, where the bone marrow donation would be made. The collected samples then has 72 hours to be transplanted to the receiving patient.

In South Africa, doctors will seldom collect bone marrow straight from the source.Possible side effects to receiving the injections may include headache, bone pain and flu-like symptoms.

I want people to know that blood diseases can affect anyone, regardless of ethnicity or gender. Extending beyond our boundaries or comfort zones like climbing Mafadi can be hard, but imagine the indelible difference the act of becoming a donor can have on someone elses life and their loved ones, says Coetzee.

You can follow the hikers' journey onSAMBR's Facebook page.

If you are between the ages of 18 and 45 and want to become a donor, contact the SABMR on021 447 8638 oremail:donors@sabmr.co.za.For more info and how to donate, visit their website.

READ MORE | Leukaemia survivor stories

Image credit: Pixabay

View original post here:
There is a dire need for 'donors of colour' in the fight against blood disorders - Health24

Recommendation and review posted by Bethany Smith

Dr. Kayla Luhrs is Petersburg Medical Centers fifth full-time doctor. (Photo courtesy of Kayla Luhrs)

Petersburg Medical Center has hired a fifth doctor, which administration hopes will improve access to care. As KFSKs Angela Denning reports, Dr. Kayla Luhrs hails from Southeast Alaska.

Dr. Kayla Luhrs grew up in Ketchikan and she also lived in Juneau before moving to Petersburg. She says shes liking the new town so far.

I have a dog and were loving the trails, the quick access to the trails and the beach, she said. And the people have been so kind, I cant even count how many meals Ive had dropped off on my doorstep and I would say thats my very favorite way to be shown appreciation so yeah, Ive felt really good in my transition here.

Historically, PMC has employed four doctors and a physicians assistant or a nurse practitioner. CEO Phil Hofstetter says the last nurse practitioner left at the start of COVID so PMC decided to hire another doctor to help with pandemic response. At first Luhrs was hired as an independent contractor and then she became a permanent full-time position.

Hofstetter says the pandemic wasnt the only reason PMC was looking for another doctor.

It was sort of dual effect of opportunity and also need, he said.

Besides addressing additional COVID details, Hofstetter says they had a long standing need to help patients access care more easily. They have wanted to improve waiting times for appointments at the clinic.

If you look at a scheduling book and you look how far ahead does it take to have an appointment, they were pretty far down the road for some physicians, Hofstetter said. You can come in and do walk-in but scheduled, follow-up appointments were sometimes quite a ways out and that tells me that theres a higher demand in the community.

Luhrs says as a doctor, she likes to develop relationships with her patients to find out what their health goals are. She also appreciates the variety of work that PMC provides.

I get to be in the ER and take care of patients when they have acute needs but then I also get the follow up of seeing them in clinic, she said. I think this is kind of a unique situation where as a general physician you do get to follow patients in the hospital, in the ER, in the clinic, and I really like that.

Luhrs has an interest in sports medicine and she likes to use food as medicine through a holistic approach to helping patients. One specialty that she has background in and hopes to pursue in Petersburg once the pandemic situation changes are group visits. Its where patients see the doctor together about a common issue. The patients typically spend 90 minutes with her in the group, which is longer than a normal one-person clinical visit.

It can be a really efficient and an effective way to share information. And we also have studies showing that when we meet together in groups then we can have better outcomes than meeting one on one, Luhrs said. I think we learn so much from each other. Other people maybe think to ask question that is a question for you but you didnt even think to ask it.

Seeing the doctor in a group setting wont work for everything. But Luhrs says it can help with healing and wellness for some things. Specifically, she has a group on the topic of womens health where patients get a better understanding of the cyclical nature of hormone changes. Shes done groups on diabetes and pregnancy loss and support.

Shes also had success with groups on Irritable Bowel Syndrome. She says patients have benefited from getting a better understanding of how digestion works for them.

I think that can be kind of a frustrating diagnosis for people and so meeting together and just getting more information in depth about how your digestive system works and the timing of these things and the way we break down different foods and nutrients and the downstream effects of that, Luhrs said.

Hofstetter says that the new hire will help PMC move towards a more patient-centered focus, which includes more case management and outreach to patients.

More:
PMC's new doctor hopes to bring group visits to patient care - KFSK

Recommendation and review posted by Bethany Smith