The global Anti-Senescence Therapy market report by HNY Research offers users a detailed overview of the market and all the main factors affecting the market. The study on global Anti-Senescence Therapy market, offers profound understandings about the Anti-Senescence Therapy market covering all the essential aspects like revenue growth, supply chain, sales, key players and regions. There is a target set in market that every marketing strategy has to reach. This report on Anti-Senescence Therapy focusses on different categories that define this market with a systematic approach that addresses the consumer base, researchers and market experts like the stakeholders. It also gives a clear perspective towards the competition and demand and supply chain.

Request a sample of this report @ https://www.orbisresearch.com/contacts/request-sample/4359693

Manufacturer Detail

By Market Players:Unity Biotechnology, OisinBiotechnologies, AgeX TherapeuticsInc, Siwa Therapeutics, Cleara Biotech, Calico LLC, Sierra Sciences, Human Longevity, Inc. (HLI), Numeric Biotech, Recursion Pharmaceuticals, Proteostasis Therapeutics, Senolytic Therapeutics, Allergan

By Application

By TypeGene Therapy, Immunotherapy, Others

The Anti-Senescence Therapy market report also offers some presentations and illustrations about the market that comprises pie charts, graphs, and charts which presents the percentage of the various strategies implemented by the service providers in the global Anti-Senescence Therapy market. This report on Anti-Senescence Therapy has been very well drafted to benefit anyone studying it. There are different marketing strategies that every marketer looks up to in order to ace the competition in the Global market. Some of the primary marketing strategies that is needed for every business to be successful are Passion, Focus, Watching the Data, Communicating the value To Your Customers, Your Understanding of Your Target Market. Every market research report follows a robust methodology to define its market value. By doing so, the Anti-Senescence Therapy research study by HNY Research offers collection of information and analysis for each facet of the Anti-Senescence Therapy market such as technology, regional markets, applications, and types.

Browse the complete report @ https://www.orbisresearch.com/reports/index/2020-2025-global-and-regional-blood-culture-tests-industry-production-sales-and-consumption-status-and-prospects-professional-market-research-report

This study can benefit investors and business owners in many ways. It studies the business models, strategies, growth, innovations and every information about manufacturers that can help make business predictions and fetch good results. Making right business decisions is an undeniable measure that needs to be taken for market growth. Every market has a set of manufacturers, vendors and consumers that define that market and their every move and achievements becomes a subject of studying for market researchers and other stakeholders. One of the most important aspects focused in this study is the regional analysis. Region segmentation of markets helps in detailed analysis of the market in terms of business opportunities, revenue generation potential and future predictions of the market. For Anti-Senescence Therapy report, the important regions highlighted are North America, South America, Asia, Europe and Middle East. Another important aspect of every market research report by HNY Research is the study of the key players or manufacturers driving the market forward. The process helps to analyze the opponent thoroughly.

Make an enquiry of this report @ https://www.orbisresearch.com/contacts/enquiry-before-buying/4359693

About Us:

Orbis Research (orbisresearch.com) is a single point aid for all your market research requirements. We have vast database of reports from the leading publishers and authors across the globe. We specialize in delivering customized reports as per the requirements of our clients. We have complete information about our publishers and hence are sure about the accuracy of the industries and verticals of their specialization. This helps our clients to map their needs and we produce the perfect required market research study for our clients.

Contact Us: Hector CostelloSenior Manager Client Engagements4144N Central Expressway,Suite 600, Dallas,Texas 75204, U.S.A.Phone No.: USA: +1 (972)-362-8199 | IND: +91 895 659 5155Email ID: [emailprotected]

Go here to see the original:
2020-2025 Global and Regional Anti-Senescence Therapy Industry Production, Sales and Consumption Status and Prospects Professional Market Research...

Recommendation and review posted by Bethany Smith

MarketsandResearch.biz is releasing the latest insights through extensive research titled Global Gene Therapy for Age-related Macular Degeneration Market 2020 by Manufacturers, Countries, Type and Application, Forecast to 2025 which provides a comprehensive researched abstract of the key players with considerable shareholdings at a global level regarding demand, sales, and income through offering better products and services. The perceptive research study gives an in-depth analysis featuring market scope, history, establishment, attractiveness, production, sales volume, and growth potentials. It presents a thorough lookout towards the ongoing market structure as well as a forecast for the global Gene Therapy for Age-related Macular Degeneration market between 2020 and 2025.

There is also high competition among key market players which forces them to bring constant innovation in their products. The report highlights informative aspects related to product developments, launches, and trends, to assist global Gene Therapy for Age-related Macular Degeneration market players, shareholders, and investors in strategic decision making. Then, primary and secondary drivers, market share, leading segments, and geographical analysis has been shown. Out analysts intends to help clients solve the issues, as well as expect upcoming revenue divisions and growth ranges.

DOWNLOAD FREE SAMPLE REPORT: https://www.marketsandresearch.biz/sample-request/9425

Competitive Analysis:

The report discusses insights into the production and capacities from the manufacturing point of view with price fluctuations of raw materials, process in-flow rate product cost, and production value. The research study has mentioned the key players at the global outlook coupled with growth rates of the global Gene Therapy for Age-related Macular Degeneration market. Here the report helps clients to understand leading participants positions, strengths, and weaknesses in the market by offering a thorough evaluation of their production cost, gross margin, market value, product value, revenue earnings, profitability, and growth rate.

The vital manufacturers included in this report are: RetroSense Therapeutics, REGENXBIO, AGTC,

The geographical division offers data that gives you an idea of the revenue of the companies and sales figures of the Gene Therapy for Age-related Macular Degeneration growth business. Here are highlights of the Geographical divisions: North America (United States, Canada and Mexico), Europe (Germany, France, UK, Russia and Italy), Asia-Pacific (China, Japan, Korea, India and Southeast Asia), South America (Brazil, Argentina, Colombia etc.), Middle East and Africa (Saudi Arabia, UAE, Egypt, Nigeria and South Africa)

The report highlights product types which are as follows: Subretinal, Intravitreal, Unspecified

The report highlights top applications which are as follows: Monotherapy, Combination Therapy,

Queries Addressed In The Market Report:

ACCESS FULL REPORT: https://www.marketsandresearch.biz/report/9425/global-gene-therapy-for-age-related-macular-degeneration-market-2020-by-manufacturers-countries-type-and-application-forecast-to-2025

Moreover, the report gives in-depth information on upstream raw materials sourcing, downstream buyers, raw materials cost, labor cost, and industry chain view. The document contains an analysis of production capabilities, plant locations, manufacturing processes, product specifications, value chain, supply chain, distribution network, and global reach.

Customization of the Report:This report can be customized to meet the clients requirements. Please connect with our sales team ([emailprotected]), who will ensure that you get a report that suits your needs. You can also get in touch with our executives on +1-201-465-4211 to share your research requirements.

See the article here:
Gene Therapy for Age-related Macular Degeneration Market Growth Forecast 2020-2025 RetroSense Therapeutics, REGENXBIO, AGTC - News Times

Recommendation and review posted by Bethany Smith

Woburn Mar 13, 2020 (Thomson StreetEvents) -- Edited Transcript of Flexion Therapeutics Inc earnings conference call or presentation Thursday, March 12, 2020 at 8:30:00pm GMT

* David A. Arkowitz

Flexion Therapeutics, Inc. - CFO

* Michael D. Clayman

Flexion Therapeutics, Inc. - Co-Founder, President, CEO & Director

Flexion Therapeutics, Inc. - VP of Corporate Communications & IR

The Benchmark Company, LLC, Research Division - Senior Healthcare Technology Research Analyst

Joh. Berenberg, Gossler & Co. KG, Research Division - Analyst

* Serge D. Belanger

Good afternoon, ladies and gentlemen. And welcome to the Flexion Therapeutics Fourth Quarter and Full Year 2019 Financial Results Conference Call. My name is Daniel, and I will be your coordinator for today. (Operator Instructions)

I'll now turn the call over to the company.

Scott Young, Flexion Therapeutics, Inc. - VP of Corporate Communications & IR [2]

Thank you, Dan. Good afternoon. This is Scott Young, Vice President for Corporate Communications and Investor Relations. Before we begin, I would call your attention to the metrics slide that we will discuss in today's presentation. Those slides can be viewed directly via the webcast, in the 8-K we issued this afternoon or under the Investors tab on flexiontherapeutics.com.

In addition, our Q4 earnings press release and an archive of this conference call, can also be found there. Today's call will be led by Flexion's Chief Executive Officer, Dr. Michael Clayman; and he is joined by David Arkowitz, Flexion's Chief Financial Officer; and Melissa Layman, Flexion's newly appointed Chief Commercial Officer.

On today's call, we will be making forward-looking statements that include commercial, financial, clinical and regulatory projections. Statements relating to future financial or business performance, conditions or strategies

matters, including expectations regarding net sales, operating expenses, cash utilization, clinical, regulatory and commercial developments and anticipated milestones are forward-looking statements within the meaning of the Private Securities Litigation Reform Act.

Flexion cautions that these forward-looking statements are subject to various assumptions, risks and uncertainties, which change over time. Additional information on the factors and risks that could affect Flexion's business, financial conditions and results of operations are contained in Flexion's Form 10-K for the year ended December 31, 2019, which was filed with the SEC and other filings, which are available at http://www.sec.gov as well as Flexion's website.

These forward-looking statements speak only as of the date of this call, and Flexion assumes no duty to update such statements. I will now

over to Flexion's CEO, Mike Clayman.

Michael D. Clayman, Flexion Therapeutics, Inc. - Co-Founder, President, CEO & Director [3]

--------------------------------------------------------------------------------

Thanks, Scott, and thank you all for joining. Today, I'll recap our commercial progress in 2019, review our life cycle management activities, provide an update on our pipeline and discuss our priorities for this year. After that, I'll turn it over to David for a deeper review of our commercial metrics and a summary of our financial performance, and then we will open the line and take questions.

To begin, as we reported today, we recorded full year ZILRETTA net sales of $73 million for 2019, which is fully in line with the preliminary unaudited revenue estimate we provided in early January. We are very pleased with our sales performance in 2019, which represents growth of more than 220%, compared to our 2018 full year net sales of $22.5 million. Those numbers tell a very compelling story, and they speak to the outstanding work of our field-based teams, the excellent coverage we have for ZILRETTA, the impact from our judicious use of volume-based rebates, but most importantly, our sales performance speaks to the remarkable experience that patients and clinicians are having with ZILRETTA. As you will see in the commercial metrics that David will review, by the end of 2019, our customers had purchased 175,000 units of ZILRETTA. While our data are limited to the account level, that number provides a reasonable surrogate for the number of patients who have been treated with ZILRETTA since it was introduced to the market in late 2017. And we know that many of those patients have received unprecedented pain relief from ZILRETTA. I say it is based on real-world feedback from the countless conversation I've had with grateful ZILRETTA patients and their physicians, feedback that is wholly consistent with our compelling clinical trial data.

In fact, last year, we became aware of several professional athletes who received ZILRETTA, namely Rod Woodson, the NFL Hall of Fame Defense named as one of the top 100 players of all time. Michael Eruzione, the captain of (inaudible) Gold medal winning U.S. Olympic Hockey team and the player who scored the game winning goal against the Russians during the Miracle On Ice; and Chris Dickerson, a former outfielder who played from the New York Yankees and other major league baseball teams. From snow blowing a driveway to playing with their children and grandchildren, to jogging for the first time in years, they all have profoundly moving stories about how ZILRETTA has helped each of them manage their knee OA pain, and thereby, improve their ability to participate in regular everyday activities. As part of our ongoing physician marketing initiatives, we brought all 3 athletes together at a major orthopedic conference last December, where they and their treating physicians, spoke to a standing room crowd of some of the country's leading sports medicine experts. They share their stories of how ZILRETTA has helped them, and the best words I can use to describe that session are inspiring and humbling.

While all are elite athletes, their ZILRETTA stories echo the scores of e-mails and letters I've received from patients who are so grateful to reengage in things they love doing with less pain. From gardening, playing around of golf, walking on the beach, hiking, each of these stories serves as a reminder to all of us that while we have impacted more than 175,000 patients, there are 15 million people who see their doctor every year for OA knee pain. And 5 million of them receive an intra-articular injection. The opportunity for ZILRETTA inflection is truly massive, which brings me back to our performance in 2019 and our goals for 2020.

Throughout the course of 2019, we saw existing practices increase their use of ZILRETTA and more than 1,600 new accounts start using the product. Today, with the benefit of 2 years in the market, we have actual claim

(technical difficulty)

play changes in the payer mix versus our assumptions prior to launch. We now see that the actual fix is skewed slightly more toward Medicare, which accounts for roughly 55% of the market versus previous estimates of 50%. 8% is still commercial, but Medicaid, VA and 340B plans are making up roughly 5% of the mix. We view this modest increase in Medicare patients to be incrementally positive as Medicare patients can be injected the same-day they visit without any need for prior authorization. In addition, it is important to point out that commercial coverage for ZILRETTA remains excellent. As we discussed in December, the recent approval of our NDA resulted in a significantly improved label, which most importantly, removed the onerous not intended for repeat administration wording in the limitation of use statement. Within days of the approval, we developed materials to help our MBMs communicate the label update and we have anecdotal feedback from the field that tells us that the changes have been very well received. While we clearly view the label update as a tailwind. We have always said that we continue to believe that the meaningful impact will be seen over the following quarters and years. From a commercial perspective, our progress in 2019 strengthens our belief that ZILRETTA can become the new standard of care for the intra-articular treatment for OA knee pain in the years ahead. While under normal circumstances, these factors would give us confidence that our 2020 ZILRETTA's net sales guidance of $120 million to $135 million is both credible and achievable. Like all businesses, we are acutely attuned to the potential impacts of the coronavirus global pandemic, and we are monitoring this dynamic situation very closely. To date, we have not seen any material impacts on ZILRETTA sales, our ability to access customers or to initiate our clinical trials. However, it is impossible to predict how the outbreak could evolve in the months ahead or what impacts more aggressive social distancing or other containment efforts might have on patients or practices. Regarding our supply chain, we believe we are in a very strong position. We do not source any of our key materials from China, and we presently have approximately 10 months worth of finished product inventory in our warehouses in the U.S. Furthermore, we have an additional 12 months of API, triamcinolone acetonide at our manufacturing facility in the U.K. Again, it is impossible to predict the long-term impacts of the outbreak. But we feel very good about our ability to provide ZILRETTA to patients over the quarters ahead.

Shifting to our clinical development activities, our Phase II trial to investigate the safety and efficacy of ZILRETTA in shoulder OA and adhesive capsulitis, also known as frozen shoulder syndrome continues to advance, and we anticipate data from that trial in 2020.

As we've previously discussed, these 2 conditions combined account for roughly 800,000 injections, and they present an opportunity for us to expand the use of ZILRETTA with a subset of orthopedics, who primarily focus on sports medicine and commonly treat these conditions with steroid injections.

With respect to our pipeline, we've also been making progress with our 2 drug candidates, FX201 and FX301. FX201 is our gene therapy, which holds the potential to provide OA pain relief for at least a year, improve function and potentially modify disease. As we announced last year, the IND for FX201 was accepted by the FDA, and we recently treated the first 2 patients in our Phase I dose-ranging study. We anticipate treating approximately 15 to 24 patients, who will be followed for 104 weeks with initial readout in 2021.

Now we'll move to FX301. Our NAV 1.7 inhibitor, [formulated]

(technical difficulty)

sensitive hydrogel for administration as a peripheral nerve block for control of postoperative pain. We've held our pre-IND meeting with FDA, and we remain on track to initiate our first FX301 clinical trial in

(technical difficulty)

unlike typical local anesthetics. We believe the [selective] pharmacology of FX301 has the potential to deliver at least 3 to 5 days of effective pain relief, while preserving motor function, which could enable ambulation, rapid discharge from the hospital and early rehabilitation following musculoskeletal surgery.

Finally, regarding our search for a Chief Commercial Officer. We were very excited to announce the appointment of Melissa Layman earlier this week, and I'm delighted that she is able to join us for today's call. As we've said repeatedly, in our search for a CCO, we were looking for someone who have had success leading an entire commercial enterprise, who had deep experience and expertise in each of the key commercial functional domains, who had a track record as a very strong leader and who would positively contribute to our already strong culture. Because Melissa fulfills all of these criteria and is simply a terrific person to interact with. We could not be more pleased to have her take the helm of our commercial organization. Before David summarizes our fourth quarter financials and walks through the commercial metrics, I'd like to give Melissa the opportunity to make a few remarks. Melissa?

--------------------------------------------------------------------------------

Melissa Layman, [4]

--------------------------------------------------------------------------------

Thank you, Mike, and thank you for the kind words. It is such a pleasure to be here today and such an honor to join Flexion. While I've barely been in my role for a day, I can already see what an amazing group of people work here. The team has been welcoming, engaging and candid, and that was consistent throughout the entire interview process from the Executive Committee to the Board members. The commitment to patients and passion for winning has been universal, and that was one of the many reasons I wanted to join. Put simply, I can't begin to convey how excited I am

(technical difficulty)

opportunity that's ahead of us. The strong foundation that's been laid by Mike, David, Steve Meyers, and the rest of the commercial leadership team is truly impressive, and I'm looking forward to working together to grow ZILRETTA's market share and help make it the leading IA treatment in this space. Over the next few months, I'll be working intensively with our commercial organization, and I look forward to representing our commercial effort on future calls. At this point, I'll turn it over to David.

--------------------------------------------------------------------------------

David A. Arkowitz, Flexion Therapeutics, Inc. - CFO [5]

--------------------------------------------------------------------------------

Thank you, Melissa. I'll start by walking through our commercial metrics which, as Scott mentioned, can be found on our website and in the 8-K we issued today.

If you look at Slide 2, you can see that we recorded ZILRETTA net sales of $23.7 million in the fourth quarter of 2019, bringing full year 2019 net sales to $73 million. As Mike mentioned, year-over-year growth topped 20%. As in previous quarters, we expanded our list of target accounts in the fourth quarter to 4,972, and by December 31, 2019, we've called on almost all of them. At the end of the fourth quarter, 3,488 accounts had purchased ZILRETTA, which is an increase of nearly 360 purchasing accounts compared to the end of the third quarter.

As of the end of December, we had 2,642 accounts or 76% of all purchasing accounts placed at least 1 reorder for ZILRETTA. Notably, we saw our reorder rate increase in each quarter throughout 2019, and this occurred on a successively growing customer base. Slide 3 charts our quarterly sales from launch through the fourth quarter of 2019, which provides a very compelling view of ZILRETTA's growth in the market, especially since the introduction of the permanent J Code on January 1, 2019. We do not provide quarterly guidance, but based on routine seasonality impacts, directionally, we anticipate first quarter net sales to be roughly flat versus the fourth quarter of last year.

Moving to Slide 4. This slide and the remaining 2 slides reflect purchases of ZILRETTA by accounts, which represent physician practices, clinics and hospitals of various sizes and purchasing potential. As we look at the distribution of accounts that have purchased the ZILRETTA since launch, we stayed with the same groupings that we've used in previous quarters, accounts that have purchased 1 to 10 units, purchased 11 to 50 units or purchased more than 50 units. We continue to see a significant number of accounts with purchases of 1 to 10 units. And as of December 31, 2019, roughly 1,670 accounts had made purchases in this range. While approximately 1,030 accounts had purchased 11 of 50 units. In addition, 794 accounts had purchased more than 50 units, which represents growth of 150% as compared to Q1 2019 when 313 accounts had purchased in this category.

Looking at Slide number 5. You can clearly see the distribution of purchases by accounts. Those 794 accounts that have each purchased more than 50 units are in total, responsible for approximately 143,000 units or roughly 81% of all units purchased since launch. As we have mentioned previously, accounts generally move along a utilization continuum from 1 to 10 units to 11 to 50 units and then to more than 50 units. Importantly, none of our purchasing accounts has fully incorporated ZILRETTA into their practice. And this holds true for even the highest utilizers. As a result, we believe there is tremendous opportunity for us to increase utilization across each of these groups. Before I leave this slide, I would like to point out that the total ZILRETTA purchases by accounts in the fourth quarter were approximately 37,500 units, which is lower than the 48,600 units purchased in the third quarter. We believe this quarter-over-quarter reduction was primarily the result of the broad-based rebate program that we introduced in the third quarter. There was a strong amount of enthusiasm and pent-up demand for this program, and we believe that some purchases that otherwise would have occurred in the fourth quarter instead occurred in the third quarter. To a much lesser extent, we believe that the holidays in the fourth quarter had an impact on the sequential quarter reduction as well. Nevertheless, we saw total ZILRETTA purchases by accounts increased by more than 70% in the second half of 2019 versus the first half of 2019.

Moving to Slide 6. Here, we break out ZILRETTA purchases by new and existing accounts. And in the fourth quarter, we added about 350 new purchasing accounts. While we expect to eventually see a slowing in the number of new accounts coming on board each quarter, we continue to be pleased with the progress we are making with new accounts as they typically work their way through the ZILRETTA utilization continuum.

So at this point, I will briefly walk through the fourth quarter and full year 2019 financial results, which we included in the press release issued this afternoon and in our 10-K. We reported a net loss of $149.8 million for full year 2019 as compared to a net loss of $169.7 million for full year 2018. Net sales of ZILRETTA were $23.7 million for the fourth quarter of 2019 and totaled $73 million for full-year 2019. The cost of sales for full-year 2019 was $10 million. The fourth quarter 2019 net sales reflect a gross to net reduction of 11%. A gross to net reduction is primarily comprised of distributor and service fees, returns reserve, health care provider rebates and mandatory government discounts and rebates, such as Medicaid, 340B institutions, and Veterans Administration, Department of Defense. As we previously mentioned, in the third quarter, we started offering rebates to eligible health care providers that are variable based on the volume of product purchased. These provider rebates contributed 4% of the fourth quarter total gross to net reduction of 11%. Research and development expenses were $69.6 million, and $53.1 million for the years ended December 31, 2019 and 2018, respectively. The increase in research and development expenses year-over-year of $16.5 million was primarily due to an increase in salary and other related costs for additional headcount and stock-based compensation expense, an increase in expenses related to portfolio expansion and other program costs, including an upfront payment to Xenon Pharmaceuticals related to FX301, and an increase in development expenses for ZILRETTA. Selling, general and administrative expenses were $129.7 million and $121.3 million for the year ended December 31, 2019, and 2018, respectively. Selling expenses were $96.3 million and $87.3 million for the years ended December 31, 2019 and 2018, respectively. The year-over-year increase in selling expenses of $9 million was primarily due to salary and other employee-related costs and external costs related to marketing and reimbursement support activities.

General and administrative expenses were $33.4 million and $34 million for the years ended December 31, 2019 and 2018, respectively, which represents a decrease of $0.6 million year-over-year. Interest expense was $17.1 million and $15.7 million for the years ended December 31, 2019 and 2018, respectively. We expect that while our operating expenses will continue to increase in the near term, primarily driven by commercial activities in support of ZILRETTA, line extension clinical trials for ZILRETTA, continued development of FX201 and FX301 and development activities associated with future additions to the pipeline. We believe we will be able to increasingly leverage our infrastructure in support of these efforts. As of December 31, 2019, and we had approximately $136.7 million in cash, cash equivalents and marketable securities compared with $258.8 million as of December 31, 2018. In addition, earlier this quarter, we fully drew down $20 million from our revolving credit facility, which is secured by our accounts receivables. We believe that our current cash balance with the expected future sales

[Aduio Gap]

and the ongoing prudent management of (inaudible) will enable us to reach profitability. However, our projections are based on certain market assumptions, which may or may not be affected by the coronavirus [pandemic]. As a result, we will continue to review and reassess our

(technical difficulty)

in light of those factors. In addition, we will remain opportunistic as it relates to potential funding decisions, and we will do what we believe is in the best long-term interest of Flexion and our shareholders.

At this point, I would ask the operator to please open the line for questions.

================================================================================

Questions and Answers

--------------------------------------------------------------------------------

Operator [1]

--------------------------------------------------------------------------------

(Operator Instructions)

Our first question comes from Randall Stanicky with RBC Capital Markets.

--------------------------------------------------------------------------------

Daniel James Busby, RBC Capital Markets, Research Division - Senior Associate [2]

--------------------------------------------------------------------------------

This is Dan Busby on for Randall. A couple of questions. First, among the high-prescribing accounts, in particular, can you give us a sense of how much more room there is to grow within those practices? I think I heard you mentioned that you haven't fully penetrated any of those accounts yet. And of the physicians in those accounts who aren't using it, what's the pushback you're hearing?

--------------------------------------------------------------------------------

David A. Arkowitz, Flexion Therapeutics, Inc. - CFO [3]

--------------------------------------------------------------------------------

Yes, Dan, this is David. So as we shared in our prepared remarks and in the deck, we've got almost 800 accounts that have purchased 50 units, more than 50 units of ZILRETTA launch to date. The vast, vast majority of those accounts, ZILRETTA has not been fully adopted, incorporated into their practices (inaudible) even within those accounts of almost 50 accounts that have purchased more than 500 of units of ZILRETTA launch to date. So there's room to run with those almost 800 accounts as well as the other accounts that are less than 50 units of ZILRETTA purchased launch to date. And in terms of the other part of your question, in terms of why have they not fully incorporated ZILRETTA at this juncture. The way this will typically work is take a practice with 5 or 6 physicians

(technical difficulty)

2 of those physicians have started to use ZILRETTA and are using ZILRETTA for their patient -- appropriate patient population. But there just hasn't been awareness and experience with ZILRETTA for the other 3 or 4 docs in the practice. So it's a process. It's a process for the docs that are treating the existing patients to talk to their colleagues or our representatives to be making those physicians that are not yet using ZILRETTA, aware of ZILRETTA, getting them comfortable with reimbursement. So that's really what is going on.

--------------------------------------------------------------------------------

Daniel James Busby, RBC Capital Markets, Research Division - Senior Associate [4]

--------------------------------------------------------------------------------

Okay, that's helpful. And I guess, as a follow-up to that, if 1 practice, if 1 or 2 physicians within a practice, have secured reimbursement? Is it typically the case that other doctors who aren't using it, but may in the future, they would have reimbursement set up already? Or is that more kind of doctor by doctor?

--------------------------------------------------------------------------------

David A. Arkowitz, Flexion Therapeutics, Inc. - CFO [5]

--------------------------------------------------------------------------------

No, it's typically at the office level, at the clinical level. But the -- it's an issue of just getting familiar and comfortable with reimbursement, experiencing reimbursement, and that takes those docs that have not achieved that to just go through the process.

--------------------------------------------------------------------------------

Operator [6]

--------------------------------------------------------------------------------

Our next question comes from Elliot Wilbur with Raymond James.

--------------------------------------------------------------------------------

Elliot Henry Wilbur, Raymond James & Associates, Inc., Research Division - Senior Research Analyst [7]

--------------------------------------------------------------------------------

A couple of questions. First, Mike, I believe you mentioned in your commentary that you expect 1Q 2020 ZILRETTA sales to be essentially flat versus 4Q '19. Just want to get maybe a little bit more color behind that? How much of that you think is attributable to high deductible plans, perhaps influencing utilization versus other factors such as seasonality or just sort of overall company conservatism kind of in light of potentially increased macro uncertainty here in the short term?

--------------------------------------------------------------------------------

Michael D. Clayman, Flexion Therapeutics, Inc. - Co-Founder, President, CEO & Director [8]

--------------------------------------------------------------------------------

Yes. So I think there are a few things, Elliot. So it's a good and important question. First, just to recognize, historically, in this space, the hyaluronic acids are typically down 10% in the first quarter, with the driver being, as you point out, deductible. That is a key driver. I think that you also have to look at an older population may be less active in the winter months. And as a result, have less need to go to their physicians. So there are a couple of reasons why there is a basis for, relatively speaking, the first quarter being softer than other quarters and why we have guided to flat in the first quarter.

--------------------------------------------------------------------------------

Elliot Henry Wilbur, Raymond James & Associates, Inc., Research Division - Senior Research Analyst [9]

--------------------------------------------------------------------------------

Okay. And then with respect to your commentary around some of the data points that emerge from the claims data that you're referring to in terms of the payer mix with Medicare representing now a higher proportion. How should we think about the relative opportunity with respect to additional growth levers such as repeat administration, bilateral administration within the context of a greater Medicare book of business versus commercial?

Read more from the original source:
Edited Transcript of FLXN earnings conference call or presentation 12-Mar-20 8:30pm GMT - Yahoo Finance

Recommendation and review posted by Bethany Smith

DetailsCategory: DNA RNA and CellsPublished on Wednesday, 11 March 2020 09:50Hits: 723

-Cooperation in Product Development for Innovative Cardiac Regenerative Medicine-

March 10, 2020 I Tokyo-based Heartseed Inc. (Heartseed), a Keio University-originated biotechnology company developing induced pluripotent stem cell (iPSC)-derived cardiac regenerative medicine, and MEDIPAL HOLDINGS CORPORATION (MEDIPAL) today announced that they have entered into a capital and business alliance.

In conjunction with the alliance, MEDIPAL will acquire an equity stake in Heartseed. In addition, MEDIPAL and its wholly owned subsidiary SPLine Corporation (SPLine) will begin collaborative research with Heartseed on the logistics of Heartseeds clinical trial supplies.

Purpose of the Alliance

Heartseed is developing HS-001, allogeneic iPSC-derived cardiomyocyte spheroids for severe heart failure, which currently has no effective treatment other than heart transplantation. In preparation for the initiation of its clinical trial, Heartseed will outsource its manufacturing to Nikon CeLL innovation Co., Ltd., and are discussing transport of the cardiomyocyte spheroids with MEDIPAL.

MEDIPAL has established a distribution system in compliance with Japanese Good Distribution Practice (GDP) guidelines. MEDIPAL is a pioneer in logistics services in the growing field of regenerative medicine, and has an extensive track record to support development of regenerative medicine products and to build a logistics system for them using its ultra-low temperature transport system.

In this alliance, MEDIPAL will contribute to the improvement of patient care by promoting development of Heartseeds innovative products from the clinical trial stage with its experience and expertise in the distribution of regenerative medicine products.

Comment from Heartseed CEO Keiichi Fukuda, MD, PhD, FACC

The iPSC-derived cardiomyocyte spheroids we are developing are unique in the mechanism that cardiomyocytes are strengthened by turning them into microtissues. The spheroids will be retained and engrafted with the ventricular myocardium for a long-term and are expected to contribute sustained direct ventricular contraction (remuscularization). It is completely

different from conventional treatment methods. To deliver the treatment to patients, logistical considerations are also important, and we are pleased to partner with MEDIPAL, which has an extensive track record in distribution of cellular medicines.

Comment from MEDIPAL Representative Director, President and CEO Shuichi

Watanabe

Their investigational agent has the potential to be an innovative treatment option for patients with severe heart failure. Promoting the development and stable supply of specialty pharmaceuticals is our mission, based on MEDIPALs management philosophy of

contributing to peoples health and the advancement of society through the creation of value in distribution. In this alliance, SPLine, which performs logistical planning for specialty pharmaceuticals, will be involved from the clinical trial stage, and will also work with us in creating a distribution system to ensure safe and reliable delivery of the product to patients after its launch.

Development of HS-001

Heartseed has allogeneic iPSC-derived highly purified ventricular-specific cardiomyocyte spheroids (HS-001) as its lead pipeline candidate, and is conducting research and development for the early commercialization of cardiac regenerative medicine using iPSCs supplied by the Center for iPS Cell Research and Application (CiRA) at Kyoto University. HS-001 is the produced by differentiating into ventricular-specific cardiomyocytes from iPSCs with the most frequent human leukocyte antigen (HLA) type1 in Japanese people, and removing undifferentiated iPSCs and non-cardiomyocytes to achieve high purity. To improve the engraftment rate, these cardiomyocytes are formed into spheroids in which approximately 1,000 cardiomyocytes are aggregated.

Since 2016, Heartseed has had more than 10 meetings with the Pharmaceuticals and Medical Devices Agency (PMDA), with discussions mainly focused on details of nonclinical safety studies, manufacturing processes, and quality management that are required for initiating clinical trials. Heartseed is currently conducting the nonclinical safety studies under Good Laboratory Practice (GLP)2 standards under the agreement of the PMDA on their designs.

Prior to the company-sponsored clinical trials, investigator-initiated clinical trial plan of HS-001 at Keio University had been under review by the Keio University Certified Special Committee for Regenerative Medicine since May 2019 and was approved in February 2020. This plan will be submitted to the Health Science Council of Ministry of Health, Labor and Welfare after going through established procedures in Keio University Hospital. For 90 days from its submission to the Council, the plan will be examined for conformance with the regenerative medicine provision standards. If conformance is verified, Keio University will be notified and may then begin clinical research.

1. HLA type:White blood cell type, immune rejection is less likely when the HLA type matches.

2. GLP(Good Laboratory Practice):Standards for conducting studies to assess drug safety. These standards should be followed when conducting safety studies using animals in the preclinical stage.

Summary of HS-001

Severe heart failure, particularly heart failure with reduced ejection fraction

About Heartseed Inc.

About MEDIPAL HOLDINGS CORPORATION

As a holding company, MEDIPAL controls, administers and supports the operating activities of companies in which it holds shares in the Prescription Pharmaceutical Wholesale Business; the Cosmetics, Daily Necessities and

OTC Pharmaceutical Wholesale Business; and the Animal Health Products and

Food Processing Raw Materials Wholesale Business, and conducts business development for the MEDIPAL Group.

About SPLine Corporation

3.ALC: Area Logistics Center

4. FLC: Front Logistics Center

SOURCE: Heartseed

Continued here:
Notice of Capital and Business Alliance between Heartseed and MEDIPAL HOLDINGS | DNA RNA and Cells | News Channels - PipelineReview.com

Recommendation and review posted by Bethany Smith

Global 3D Cardiac Mapping Systems Market: Overview

Cardiac mapping is a special type of technique which helps in gathering and displaying the information from cardiac electrograms. Such technique is mainly used in the diagnosis of heart rhythms. Therefore, cardiac mapping technique has gained immense popularity in case of arrhythmia. The cardiac mapping procedure involves the percutaneous insertion of catheter into the heart chamber and recording the cardiac electrograms sequentially. Such procedure helps in correlating the cardiac anatomy with the electrograms. The latest 3D cardiac mapping systems provide the three dimensional model of hearts chamber, which further helps in tracking the exact location of the catheter. Such advantages are majorly driving the global 3D cardiac mapping systems market.

Get Sample Copy of the Report @https://www.tmrresearch.com/sample/sample?flag=B&rep_id=5324

From the perspective of technology, the global 3D cardiac mapping systems market is segmented into basket catheter mapping, electroanatomical mapping, and real-time positional management (Cardiac pathways) EP system. Among these segments, electroanatomical mapping segment accounts for the maximum share in the global 3D cardiac mapping systems market. This mapping are extensively used in several healthcare industry due to its potential in increasing the safety, accuracy, and efficiency of catheter. A research report by TMR Research (TMR) thoroughly explains the new growth opportunities in the global 3D cardiac mapping systems market. Additionally, the report also provides a comprehensive analysis of the markets competitive landscape.

Global 3D Cardiac Mapping Systems Market: Notable Developments

Some of the recent developments are contouring the shape of the global 3D cardiac mapping systems market in a big way:

Key players operating in the global 3D cardiac mapping systems market include BioScience Webster, Boston Scientific Corporation, and Abbott.

Global 3D Cardiac Mapping Systems Market: Key Growth Drivers

Rising Number of Patients with Cardiac Disorders and Arrhythmia Fillips Market

The global 3D cardiac mapping systems market has grown steadily over the years, owing to the convenience it provides to the patients with heart problem. Growing number of people with cardiovascular diseases and rising cases of arrhythmia are the major factors fueling growth in the global 3D cardiac mapping systems market. Along with this, increasing pressure for reducing diagnosis errors and rapidly rising healthcare expenditure are also responsible for boosting the global 3D cardiac mapping systems market. However, above all such factors, the global 3D cardiac mapping systems market is majorly fueled by the accuracy and patient safety provided through real-time monitoring. Such 3D cardiac mapping systems are mainly designed to improve the resolution. This system also helps in gaining prompt of cardiac activation maps. All such advantages are also providing impetus to the growth of the global 3D cardiac mapping systems market.

Request TOC of the Report @https://www.tmrresearch.com/sample/sample?flag=T&rep_id=5324

Furthermore, rising ageing population who are prone to heart-attack and several chronic heart disorders and increasing diagnosis rate of cardiac illness are the factors stoking demand in the global 3D cardiac mapping systems market. Moreover, this 3D cardiac mapping helps in reducing the diagnosis time. Such factor is also contributing to the growth of the global 3D cardiac mapping systems market.

Global 3D Cardiac Mapping Systems Market: Regional Outlook

On the regional front, North America is leading the global 3D cardiac mapping systems market as the region has seen rapid growth in healthcare industry. Along with this, increasing prevalence of heart attacks, rising healthcare expenditure, and burgeoning population is also responsible for fueling growth in the 3D cardiac mapping systems market in this region.

About TMR Research:

TMR Research is a premier provider of customized market research and consulting services to business entities keen on succeeding in todays supercharged economic climate. Armed with an experienced, dedicated, and dynamic team of analysts, we are redefining the way our clients conduct business by providing them with authoritative and trusted research studies in tune with the latest methodologies and market trends.

Contact:

TMR Research,

3739 Balboa St # 1097,

San Francisco, CA 94121

United States

Tel: +1-415-520-1050

See the article here:
3D Cardiac Mapping Systems Market Key Vendors, Analysis by Growth and Revolutionary Opportunities by 2028 - 3rd Watch News

Recommendation and review posted by Bethany Smith

The world of Netflix's Altered Carbon is one where consciousness is no longer tethered to the physical body. It can be, and regularly is, uploaded into "cortical stacks," which are implanted at the base of the neck. In the event of death, a persons consciousness can be reloaded into a new body, known as a "sleeve." For those less fortunate, like protagonist Takeshi Kovacs, that might mean receiving a body thats not your own. In one particularly existential example from the series first episode, it might even mean a young child being uploaded into the body of an adult.

For those with means, however, the mind can be placed into a swiftly made, identical clone, allowing them to return to their lives with little interruption. We've covered what it might take to create a digital copy of a persons mind before (spoiler: it wouldnt be easy), but Altered Carbon's techno-immortality requires a second piece: the swift creation of replacement bodies.

One of the major hurdles that has kept real-world cloning from being the game changer everyone suspected it might be after the birth of Dolly, the first successfully cloned mammal, is the relatively slow development of human bodies. If you wanted to clone a 50-year-old human and get them back to the same stage of development, it would take you 50 years. That's a little too slow to make use of in the same way science fiction does.

We don't have the means to artificially age a body at a rapid pace, but what if we were able to shortcut these limitations to put it plainly, what would it take to build an adult body from scratch?

BONES

If you want to build a person from scratch, you must first make the universe. Carl Sagan said something like that, I think. Just after that, though, youll need a skeleton. Without bones, youll be left with little more than a Cronenbergian nightmare, cool in its own way, but not what were shooting for.

Today, if you have trouble with your bones, your options are limited. The first option, and in most cases the best one, is to let the bone heal itself. Your body is pretty resilient and capable of repairing most day-to-day injuries, even the ones accompanied by a sickening crack. If the injury is really bad, things get a little more medieval. Surgeons might use a series of metal plates and screws to hold your bones in place and give them time for your bodys healing processes to do their work. But those solutions only work for relatively minor injuries where the bone tissue is at least moderately intact.

When it comes to bone replacements, things are a little tougher.

Again, we can return to metal. Like the Wolverine, you might have part of your skeleton replaced or covered over with metal. This might be sufficient in specific cases, but it all feels a little crude.

Ramille Shah, Ph.D., headed a team out of Northwestern's McCormick School of Engineering to create a new material capable of instigating rapid bone regeneration. The team used 3D printers (the invention that never stops giving) and a mixture of 90 percent hydroxyapatite, a natural element of human bones, and 10 percent medical polymer to build bone constructs.

The result is a bit of artificial bone modeled in whatever shape the patient needs. It is porous, allowing for blood vessels and other tissues to easily integrate. The elastibone (perhaps the worst superhero name, trademark pending) stimulates bone regeneration and degrades over time. The intent is for the artificial structure to dissipate, leaving actual bone in its place. A technology like this would go a long way to repairing complex bone defects in all manner of patients, but is particularly promising in pediatrics, where the patients are still growing.

But, in order to truly build a bone from scratch, well need something even better. Thats where Nina Tandon and EpiBone come in.

This technology would work by taking a sample of fatty tissue, something readily available if your plan is to build a copy of an existing person, and use it to extract stem cells. Those cells would then be applied to a 3D printed scaffold of a cows bone which has been scrubbed of all its living cells. Those undifferentiated stem cells would then be placed into a bioreactor (something which sounds made up but is very real) and coaxed into growing into a fully formed bone in just a few weeks. Given enough bioreactors, and enough cows (pour one out for our fallen bovine brethren) you could feasibly grow an entire skeleton in the time it takes for you to finally fold the laundry thats been sitting in the corner of your room.

Now that youve got a skeleton, youre going to need some

ORGANS

For a long time, there weren't many ways to get a new organ if you needed one. The most commonly used method (we hope) was to get your name on a list and wait for a donor. The unfortunate reality of organ donation is that there are more people who need organs than there are organs available. Even when an organ does become available, the odds are against you that theyll match your bodys preferences, and even if you get a match, theres always the threat of rejection.

Organ transplants are a veritable miracle procedure and, while we sometimes take them for granted, they are evidence of our living in truly wizardly times in medical science. But science is never content with the status quo and humanity is forever wondering if we can further laugh in the face of nature. The preferred solution would be to develop a way to craft bespoke organs, made from the recipients' own cells.

Growing cells in a petri dish is old hat. Weve been doing that for longer than many of us have been alive. The trouble is, you can take a heart cell and induce it to multiply in a dish, but all you end up with is a dish-shaped collection of heart cells. That might be good for studying cellular biology, not so good for pumping blood through a person.

A collection of cells does not an organ make. You need something more a scaffold. Each of your organs is a complex collection of various cell types clinging to a protein structure. You can think of that structure as the framing around which the rest of a house is built. Without it, you've got little more than some insulation and drywall tossed into a haphazard stack. You need that scaffold.

There are hopes that one day well be able to build them via (drum roll please) 3D printing, but were not there yet. The level of minute detail involved is beyond our current ability. So, we have to borrow from nature.

Scientists are able to take an existing organ and strip it of its surface cells by pumping detergent through it (good for removing pesky stains and unwanted biological material). Whats left is a ghostly protein structure ready for seeding.

All that's left is to take tissue samples from the recipient and seed them onto the structure, pop it into one of those handy bioreactors, and let the cells get to work. Eventually, youll end up with an organ made of the patients own tissues. Current tests are pretty impressive, but were still a ways off from having a functioning process. The number of different tissue types involved in complex organs is a barrier and the complexity of small structures like circulatory vessels is another. Still, the technology is promising and would not only allow us to build any and all organs in record time, it would solve the organ transplant shortage and save countless lives.

So, now youve got a rigid skeleton filled with juicy oozing organs. Your neighbors are starting to wonder about the smell coming from your garage and youre grateful this abominable creature is not yet sentient because it would very likely go running for the hills. At least it would if it had

MUSCLES

Look, we all know its been a while since youve been to the gym. You bought a membership for the new year and you went a few times. You really meant well but life happened and, somehow, it all got away from you. We get it. It happens to the best of us.

While you might not have the muscle mass you wish you had, you still have quite a lot. The average persons body is comprised of somewhere between 35 and 40 percent muscle, give or take. Thats a lot. Even after all of your efforts with bioreactors, youve only managed to make 60 percent of a person. Its nothing to be scoffed at, but you arent done yet.

In order to complete next steps, youre going to need more tissue samples and a few friends from Duke University.

Using human cells that were no longer stem cells but not yet muscle cells, Nenad Bursac and Lauran Madden, an associate professor of biomedical engineering and a postdoctoral researcher, respectively, were able to successfully create functioning muscle tissues in a lab.

They grew the tissue samples and, using a 3D scaffold and a nutritive gel, ended up with working muscle fibers. These bundles of muscle fibers included receptors capable of taking in external stimuli and contracted when acted on by electricity.

For their part, the intent is not to build novel muscular structures, but to test the efficacy of drugs to treat diseases. According to Bursac, drug tests in the laboratory matched results seen in living patients. Those patients with muscular ailments could provide a tissue sample, that sample could then be grown into fiber bundles and used to test various drug treatments, ex vivo, to find a workable treatment without all the trial and error usually required.

Thanks to Bursac and the team at Duke, youve now built almost all of Takeshi Kovacs. Hes twitching and moving around on the table. He might be screaming a little, thanks to those vat-grown lungs and hes still oozing a bit. Most of all, hes embarrassed by his nakedness. A lots changed in the intervening centuries, but not the need for

SKIN

Youve got your terrible Frankensteinian gift all put together, all thats left is the wrapping. Here, too, is an area were moderately familiar with. When a patient loses skin through injury, a graft can be taken from elsewhere and used to replace the damaged tissue. It gets the job done, some skin is better than no skin of course, but theres still room for improvement.

More recently, bioengineers have had some success in growing sheets of epithelial tissue for implantation but they lacked oil and sweat glands. Again, close, but not quite. Until

A study undertaken at the RIKEN Center for Developmental Biology, led by Takashi Tsuji took cells from the gums of mice and used chemicals to revert them to a stem-cell-like state. The cells were used to grow complex skin tissues.

Once the tissues were ready, they were transplanted onto living mice and were found to develop normally. Not only did those tissues function as a protective barrier, the primary function of skin, but they also succeeded in developing hair follicles and sweat glands. Even more importantly, they successfully integrated with surrounding tissue systems like muscle groups and nerves.

There are, of course, other tissue types weve not covered, each of them important to the successful functioning of a body, but if these emerging technologies are any indication, were well on our way in those areas as well.

So, youve done it. Youve made a full-grown human from scratch in months rather than decades. All thats left is to upload a mind and youre well on your way to cyberpunk chicanery. Go forth, Kovacs, we're rooting for you. And dont mess up this body, please. It was really hard to make. Thanks.

Read more:
How to build a body from scratch, Altered Carbon-style - SYFY WIRE

Recommendation and review posted by Bethany Smith

I'm just going to come out and say it: Everyone has been complimenting my skin lately. My co-workers, random peopleat the grocery store, my friends and familyeveryone. While I've never dealt with any major skin woes like acne, I still never considered myself to be someone with particularly good skin (whatever that means). My skin has always been on thedry side, and like many women of color, I've dealt with my fair share of stubborn hyperpigmentation. The sudden influx of complimentshasn't just been a nice little boost to my newly 30-year-old ego but also a testament to my current skincare routine, which I've tweaked to perfectionover the course of several months.

As a beauty editor, I have access to every product under the sun. But ever since last fall, I felt like my skin had just lost something. When I think back, it makes sense, as there was lot was happening at the time. I had moved, turned 30, gotten engaged, andmade a major professional moveall in a matter of months, and while each of these life developments was exciting and positive, I found myself overwhelmed with stress. I wasn't sleeping well, I wasn't eating properly, my skincare routine had fallen by the wayside, and all of that was showing up on my face. I was getting pimples, my skin tone was blotchy and uneven, and my skin texture was less than smooth.

But then, something started to happen around January: Every time I posted a photo of my mug on Instagram, a sea of adulation would flood into my comments. I started catching glimpses of my makeup-free face and being truly happy with what I saw staring back at me. Maybe it was the newfound self-love I'd been practicing in therapy, or maybe it was my skincare regimen, whichhadadmittedly reached an all-time level of bougie, even for me. Now, I'm at a place where I'llfreely leave the house without makeup on and am genuinely pleased with how healthy and smooth my skin looks. I'm not perfect, by any means, but Iamgenuinely happy, and I have to believe that my fresh, smooth skin has something to do with it. So here it goes: the exact skincare routine thatdelivered smooth, glowing skin in a month's time and continues to do so to this day. Try it out for yourself and let me know what you think.

Klur Gentle Matter ($22)

I thoroughly cleanse my skin at night, so I don't always use a cleanser in the morning. Most days, I find that warm water is enough. When I do feel the need to cleanse in the morning, though,this gel cleanser is the onlyone I'll reach for. It's so gentle and actually adds moisture and nutrients like green tea, dandelion, and olive oil into my skin instead ofjust pulling everything out.

SkinCeuticals C E Ferulic ($166)

Vitamin C is probably the most important component of my skincare routine right now. While there's a lot of debate around L-ascorbic acid and whether or not its potency is actually good for the skin (jury's still out on that one), I find thatmy skin responds really well to it. Vitamin E and ferulic acid round out this formula with extra skin lipid and antioxidant protection. I can alwaystell when I've gotten lazy with my vitamin C regimen because marks from old blemishes will start to deepen, and my skin will lose some of the glow and refinement that earns me an insane amount of compliments.

Bioderma Sensibio Eye Contour Gel ($20)

I'll admit that I didn't take eye cream seriously until about a year ago, and this non-intimidating tube is to thank for that change of heart. The cream inside is lightweight and easy to lightly tap into my eye area. When I'm using eye cream consistently, I notice that any fine lines in the area soften over time, giving me that smooth, even texture I'm always after.

Kiehl's Ultra Facial Cream ($32)

This moisturizer has been an on-again, off-again staple on my vanity for years now. It's unscented, lightweight, and super effective. If I'm feeling extra dry, I'll even add afew small drops of marula oil to give it an extra hit of moisture.

Victoria Beckham by Augustinus Bader Cell Rejuvenating Priming Moisturizer ($145)

This moisturizing primer is basically like a blurring filter for your skin. It has tiny sparkly particles and theproprietary TFC-8 technology found in Augustinus Bader's other famous creams (more on those later). It makes my skin look way smoother, even when I don't layer any makeup on top.

Elta MD UV Clear Broad-Spectrum SPF 46 ($28)

Say it with me: SPF, all the time, no matter what. UV protection is important for so many reasons, but for me, it's all about mitigating hyperpigmentation and making sure any scars or blemishes on my face aren't getting exposed to the sun. This sunscreen by Elta MD is a dermatologist favorite, and it's one of my favorites, too. It doesn't irritate my skin or leave an unsightly white cast.

Farmacy Green Clean Makeup Removing Cleansing Balm ($34)

I'm a makeup wearer, so my nighttime cleansing ritual has always been serious. I need every stitch ofgunk off of my face before I can relax for the evening. This cleansing balm melts even the most stubborn eye makeup with ease. I usually massage it into the rest of my face for about 30 seconds before concentrating on my eyes. After just a few seconds of gentle rubbing, any makeup is melted down to an inky oil that rinses away without leaving any residue behind.

Reflekt Daily Exfoliating Wash ($48)

This exfoliator is said to be gentle enough for daily use, and I've found that to be true for me. Although I've backed off from using it every single day, I still love how clean and soft my face feels after use. The multitasking jojoba beads are small and smooth, so they aren't at all harsh on the skin and also meltdown to impart moisture instead of stripping the skin.

IS Clinical Cleansing Complex ($44)

This slippery cleanser clings to every trace of grime to remove it while also retexturizing. When I want a flat wash at night instead of a gritty, exfoliating one, this is the cleanser for the job. I used to have a serious attitude about paying more than $20 for cleanser (come on, it's literally money down the drain), but this is the one that taught me the power of investing in a high-quality cleanser.

U Beauty Resurfacing Compound ($148)

I've been using the U Beauty Resurfacing Compound pretty consistently since it launched last winter, and I can honestly say that it's ascended to my skincare top five. It's so good. If smooth skin is your goal, you need to try this stuff. It's patent-pending siren capsules are designed to carry active ingredients wherever your skin needs them and bypass the healthy skin cells that don't. That's why you won't experience any redness, irritation, or peeling that typically arises when starting a retinoid. This has definitely been the hero product in my smooth-skin journey.

Moon Juice Beauty Shroom Plumping Jelly Serum ($58)

It was love at first pump with this magical, hyaluronic acid and mushroom-packed elixir. There aren't many products that make a big difference in your skin's texture after just one use, but this one does. Every time I use it, my skin instantly looks plumped and smoother.

IS Clinical Youth Eye Complex ($105)

This eye cream plumps and moisturizes my delicate under-eye skin before bed. It has a little retinol in it, which honestly freaked me out at first, but over time has resulted in major refinement of fine lines.

Augustinus Bader The Rich Cream ($170)

Are you sick of editors telling you how much they love this cream? Well, I'm sorry to tell you that I'm about to do it, too. When I'm running on fumes and can only manage to get my makeup off and slap one product on my face before bed, this is the indispensable one I can't ever skip. Maybe it's the stem cellstimulating TFC-8 technology, maybe it's some sort of sorcery, but all I know is my skin has legitimately changed in texture since I started using this cream. Real talk: It's worth every penny.

Dr. Dennis Gross Clinical Grade Resurfacing Liquid Peel ($95)

I love a good resurfacing peel, but I have to admit that I've calmed way down on the acids. I found my skin becoming more sensitized and reactive, and while I can't say for sure that my nightly resurfacing toners were to blame, I'm way better off since scaling back. Now, once a week, I'll do a pass of this two-step, clinical-grade lactic and glycolic acid peel, and it immediately makes my skin look smooth, bright, and alive. As with any super-potent acid compound, it's a good idea to patch test this one to make sure your skin doesn't have an adverse reaction.

Goldfaden MD Facial Detox ($65)

I love this clean detox mask because it's cooling and tingly on the skin but doesn't dry down so hard that it makes my face feel dry or depleted. Rinsing off the sulfur-infused paste feels like taking the biggest breath of fresh air.

Dr. Dennis Gross Hyaluronic Marine Hydrating Modeling Mask ($48)

If you know me at all, then you already know how obsessed I am with this modeling mask. I firmly believe that I could stay awake for three days straight, not drink any water the whole time, and still look fresh as a daisy after 20 minutes with this goop slopped on my face.

Klorane Smoothing and Relaxing Patches ($24)

Whether I'm prepping for a photo shoot, getting ready for a night out, or just looking to minimize puffy eyes after a couple of glasses of wine, these cornflower eye patches by Klorane get the job done like no other. The soothing hydrogeleye masks actually stay put so I can move around without them slipping off, which is a huge plus.

Pai Rosehip BioRegenerate Oil ($44)

Not only is this fatty acidrich rose-hip oil an ultra-luxe finishing touch to my nighttime routine, but it also helps to get rid of imperfections caused by an imbalance in my skin's pH. I know that using oil to treat breakouts sounds counterintuitive, but this oil does just as much to calm and soothe the skin as it does to moisturize it.

Osea Malibu Blemish Balm ($48)

Speaking of soothing salves, this coolingbalmfeels so good on top of congested skin. Whenever I notice a pimple or that my pores are looking rough, I'll spot-treat with this clean cream and let it penetrate into my skin tocalmany inflammation that's plaguing me. I'll work it in as the first step in my routine whenever I need it, and it really sets the tone for the entire day.

Up next, the 25 best products to keep your skin right and tight well past your 20s.

This article originally appeared on Who What Wear

Read More from Who What Wear

Read more:
My Skin Is Kind of Perfect Right Now Thanks to This Exact 30-Day Routine - Yahoo Lifestyle

Recommendation and review posted by Bethany Smith

Abstract

The complex molecular microenvironment of the wound bed regulates the duration and degree of inflammation in the wound repair process, while its dysregulation leads to impaired healing. Understanding factors controlling this response provides therapeutic targets for inflammatory disease. Esophageal cancerrelated gene 4 (ECRG4) is a candidate chemokine that is highly expressed on leukocytes. We used ECRG4 knockout (KO) mice to establish that the absence of ECRG4 leads to defective neutrophil recruitment with a delay in wound healing. An in vitro human promyelocyte model identified an ECRG4-mediated suppression of the hyaluronic acid receptor, CD44, a key receptor mediating inflammation resolution. In ECRG4 KO mouse leukocytes, there was an increase in CD44 expression, consistent with a model in which ECRG4 negatively regulates CD44 levels. Therefore, we propose a previously unidentified mechanism in which ECRG4 regulates early neutrophil recruitment and subsequent CD44-mediated resolution of inflammation.

Cutaneous wound repair is a model of tightly controlled inflammation. Early inflammatory responses mediate hemostasis, recruitment of proreparative myeloid cells, and wound debridement to support the revascularization and proliferative phase of wound healing (1). Disruption of this inflammation response is associated with delayed wound closure, infection, and scarring (13). Therefore, understanding the mechanisms that regulate the degree and duration of the inflammatory response is critical for understanding and treating disease.

Injured tissues rapidly recruit leukocytes to clear pathogens and prepare the wound bed for tissue repair. This process involves some well-described chemokines, such as CXCL1 (4), CXCL2 (4), CXCL5 (5), and CXCL8 (6), and is further regulated by factors generated in the complex molecular environment of the wound. For example, proteases activate latent chemokines, such as chemoattractants generated in the complement cascade, and degradation of extracellular matrix components produces biologically active molecules, such as hyaluronan fragments (7, 8). These products mediate the recruitment and activation of leukocytes and stromal cells. Some receptors, such as the Toll-like receptor (TLR) family, amplify inflammation in response to damage-associated molecular patterns and pathogen-associated molecular patterns present in the wound, while others respond by tempering the inflammatory response. For example, activation of CD44 by hyaluronic acid (HA) fragments released from injured tissue modulates TLR signaling and can decrease inflammatory responses and prevent septic shock (911). CD44 is also important for resolving inflammation at sites of injury, a requirement for wound healing to progress to the proliferative phase. In injury models, such as cutaneous wounds (2), pneumonia (12), noninfectious lung injury (13), and myocardial infarction (14), loss of CD44 expression leads to increased and prolonged inflammation, exuberant leukocyte recruitment, failure to clear apoptotic neutrophils, and increased scarring and fibrosis (2, 7, 9, 1215). Understanding the complex interaction of wound products and cellular receptors that govern the choreography of wound healing phase transitions is important for addressing poorly healing wounds and informs treatment of other inflammatory disorders.

Esophageal cancerrelated gene 4 (ECRG4) is a membrane-tethered protein that is widely expressed in normal tissues and highly expressed on the surface of quiescent human granulocytes (1618). ECRG4 was first described as an epigenetically regulated gene whose expression is suppressed in several cancer types (1921), including esophageal cancer. Recent studies indicate that it may promote leukocyte recruitment, with its down-regulation in cancer contributing to escape from immunosurveillance (17, 22). ECRG4 physically associates with TLR4 (23), while proteolytic processing releases it from the cell surface (17, 24). Soluble ECRG4 binds various scavenger receptors, including LOX-1 (25), and regulates phosphorylation of the nuclear factor B (NF-B) transcription factor (16, 23). In murine tumor models, the ability of soluble ECRG4 to increase the recruitment of inflammatory cells is dependent on thrombin cleavage (17). In humans with severe burn injury, ECRG4 is shed from circulating neutrophils, while restoration of cell surface ECRG4 expression correlates with recovery (24). These observations suggest that ECRG4 has a role in regulating specific inflammatory responses, although its function in injury has not been determined in ECRG4 knockout (KO) mice. Here, we propose a previously unidentified mechanism in which the amplification of early neutrophil recruitment and CD44 expression in the wound bed can be regulated by proteolytic processing of the leukocyte chemokine ECRG4.

To determine whether ECRG4 is a functional mediator of the wound healing response, ECRG4 KO and wild-type (WT) mice were subjected to splinted full-thickness excisional wounds. The wound area was measured daily to assess wound closure kinetics. ECRG4 KO mice had a notable, and statistically significant, delay in early wound closure compared to WT mice, which began at post-wound day 1 (WT 22.5 2.4 mm2 versus KO 30.2 0.7 mm2) and persisted until day 9 (WT 6.8 4.7 mm2 versus KO 15.6 4.2 mm2) (Fig. 1, A and B). To visualize changes in the rate of wound closure, we plotted these data as the change in wound area over time (fig. S1A). This highlighted a slower initial rate of wound closure in ECRG4 KO mice after injury that subsequently recovered to the rate of WT mice by day 3. This represents the inflammatory phase of wound healing, suggesting a role for ECRG4 in regulating the initial inflammatory response. We examined the recruitment of Gr1+ granulocytes at the margin of 24-hour wounds and observed decreased Gr1+ staining in the ECRG4 KO mice compared to WT controls (Fig. 1C). To quantify the ECRG4-mediated defect in granulocyte recruitment, we used flow cytometry to immunophenotype single-cell suspensions of dissociated skin from the margins of ECRG4 KO versus WT wounds (26). Flow cytometric analyses of CD45+ cells from the wound margins of post-injury day 1 animals demonstrated a ~14-fold increase in CD45+CD11b+Ly6G+ neutrophils in WT mice compared to uninjured skin, which was not seen in ECRG4 KO mice at the same time point (Fig. 1D, top). In contrast, there was no significant difference between the ECRG4 KO and WT wound neutrophil numbers at day 3 (Fig. 1D, bottom). This is the time at which the ECRG4 KO wound closure rate approaches that of WT mice (fig. S1A). There was also no difference in neutrophil populations between uninjured ECRG4 KO and WT skin. These findings are the first to use an ECRG4 KO mouse to establish the functional significance of ECRG4 in mediating neutrophil recruitment in the inflammatory phase of injury response.

To assess the role of ECRG4 in the cutaneous inflammatory response to injury, we examined wound healing as a model of tightly regulated inflammatory responses. (A) Splinted excisional wounds were created on the dorsal skin of ECRG4 KO and WT littermates. Wound area was measured daily [representative data from three separate experiments, n = 6 mice per group, two-way analysis of variance (ANOVA), P < 0.0001; Bonferroni posttest, *P < 0.05, **P < 0.01, and ***P < 0.001]. (B) Representative images of wounds at various time points. Photo credit: Robert A. Dorschner, UCSD. (C) Excisional wounds in ECRG4 WT (top row) or KO mice (bottom row) were harvested for immunohistochemistry at 24 hours, and infiltration of Gr1+ granulocytes (arrows) was assessed. Two representative images from ECRG4 WT and KO wound margins are shown; scale bars, 500 m (n = 3 per group). (D) Neutrophil recruitment to the full-thickness cutaneous wound was quantified using a protocol for preparing single-cell suspensions via partial enzymatic digestion followed by flow cytometry. Neutrophils were identified as CD45+CD11b+Ly6G+ cells in day 1 (top) and day 3 (bottom) excisional wounds (n = 3 to 4 mice per group; **P < 0.01 and *P < 0.05). ns, not significant.

To define the role of ECRG4 in mediating leukocyte recruitment in the inflammatory phase of tissue response, we used subcutaneous implantation of polyvinyl alcohol (PVA) sponge, a well-characterized in vivo model of sterile inflammation and foreign body reaction (2729). Because infiltrating leukocytes can be harvested from PVA sponges without the need for enzymatic preparation, the cellular infiltrate was directly immunophenotyped by flow cytometry. The 24-hour inflammatory infiltrate included subsets of CD11b+ leukocytes that could be differentiated by their expression of Ly6C, including CD11b+Ly6Cint neutrophils and CD11b+Ly6Chigh inflammatory macrophages (Fig. 2, A to C), as demonstrated by Daley, Dunay, and Gutierrez (27, 30, 31) and confirmed in Fig. 2F. ECRG4 KO mice recruited half the number of total CD11b+Ly6C+ cells to the site of injury at 24 hours compared to their WT littermates (Fig. 2A). Further analysis of this population revealed a threefold decrease in the infiltration of CD11b+Ly6Cint neutrophils in the ECRG4 KO mice (Fig. 2B), whereas no significant changes in the recruitment of CD11b+Ly6Chigh macrophages were observed (Fig. 2C). We further investigated the immunophenotype of the infiltrate at days 3 and 7 to identify any changes at these later time points. Similar to the wound (Fig. 1D), there was no difference in neutrophil recruitment between the WT and ECRG4 KO mice at day 3 (fig. S1B) or day 7 (fig. S1C). Because the early wound environment is rich in thrombin and thrombin acts upon ECRG4 to release a biochemically active C-terminal peptide, CT16 (Fig. 2D) (16), that recruits leukocytes in a tumor model (17), we examined whether CT16 could increase leukocyte recruitment to a 24-hour injury. PVA sponges were loaded with 2 g of sterile synthetic CT16 peptide or vehicle before implantation. We found that CT16 specifically increased CD11b+Ly6Cint neutrophil recruitment by 35% at 24 hours (Fig. 2E). There was no difference in Ly6Clow macrophages or Ly6Chigh inflammatory macrophages at this time point. These results demonstrate that ECRG4 is important for early neutrophil recruitment and support the role of ECRG4 as a novel protease-activated mediator of neutrophil recruitment in cutaneous injury.

The PVA aseptic injury model was used to model inflammatory responses at 24 hours. CD11b+ subpopulations were defined on the basis of their differential expression of Ly6C: CD11b+Ly6Clow patrolling macrophages, CD11b+Ly6Cint neutrophils, and CD11b+Ly6Chigh inflammatory monocytes and macrophages. Quantification of (A) CD11b+Ly6C+ total, (B) CD11b+Ly6Cint, and (C) CD11b+Ly6Chigh cells recruited at day 1 is shown (n = 9 to 12 mice per group; *P < 0.05). (D) The ECRG4 protein contains several domains, including a well-characterized thrombin cleavage domain, which releases the CT16 (ECRG4133148) peptide from the C terminus. (E) The addition of CT16 to the PVA sponge (2 g per sponge) increased recruitment of CD11b+Ly6Cint neutrophils at 24 hours, while CD11b+Ly6Clow and CD11b+Ly6Chigh populations were not significantly different at this time point (n = 4; *P < 0.05). (F) Comparison of the CD11b+Ly6C gating strategy to the CD45+CD11b+Ly6G+ strategy for identifying neutrophils demonstrated equivalency in 24-hour PVA infiltrates and confirmed the decrease in ECRG4 KO neutrophil recruitment (n = 3).

We examined the leukocyte populations in blood and bone marrow to assess whether ECRG4 deficiency affected leukocyte production as a contributor to the decreased neutrophil numbers at the site of injury. Hemograms performed on the peripheral blood from uninjured mice demonstrated no differences between the circulating leukocyte populations of WT and ECRG4 KO mice (Fig. 3A). Similarly, flow cytometric analysis of bone marrow from uninjured mice demonstrated no difference in the composition or numbers of mature CD11b+Ly6C+ cell subsets (Fig. 3B). The composition of the ECRG4 KO mouse hematopoietic system was further analyzed by flow cytometry to assess populations of LSK stem cells and various progenitors of mature myeloid cells (Fig. 3, C and D). There were no differences in LSK hematopoietic stem cells (HSCs), long-term (LT)HSCs, short-term (ST)HSCs, multipotent progenitors (MPP), or LK myeloid progenitor cells (Fig. 3, E and F). Together, these data indicate that the lack of neutrophils seen at the site of injury in ECRG4 KO mice is not due to an impaired hematopoietic system, but a defect in local neutrophil recruitment. When we assessed the ability of ECRG4 KO mice to kill the pathogen, Staphylococcus aureus, in blood, no functional defect in leukocyte antimicrobial activity was observed (Fig. 3G). There was no difference in the capacity for whole blood from either ECRG4 KO mice or their WT littermates to kill methicillin-resistant S. aureus (MRSA) as assessed ex vivo. This indicates that there is no defect in the antimicrobial function of ECRG4-deficient leukocytes.

(A) Leukocyte populations in uninjured ECRG4 KO and WT mice were assessed for underlying deficits. Hemograms of blood showed no significant difference in populations between uninjured ECRG4 KO (white bars) and WT (black bars) mice (n = 8 mice per group). (B) Flow cytometric analysis of bone marrow from uninjured ECRG4 KO (white bars) and WT (black bars) mice showed no significant difference between populations of CD11b+Ly6Clow, CD11b+Ly6Cint, and CD11b+Ly6Chigh cells (n = 9). HSC compositions were compared between the WT and ECRG4 KO bone marrow using flow cytometry. (C) Schematic of the lineage distinctions for HSCs and hematopoietic progenitor cells evaluated. (D) Lin cells from healthy ECRG4 KO or WT bone marrow (left) were gating on the c-Kit+Sca1+ LSK population (middle), which was then differentiated by CD48 and CD150 expression (right) to identify long-tem (LT) HSC, short term (ST) HSC, and multipotent progenitor (MPP) populations. (E) There was no detectable difference in LSK HSCs (Linc-Kit+Sca1+), including no difference in LT HSC, ST HSC, or MPP subpopulations. (F) In addition, there was no difference in numbers of LK HPCs (Linc-Kit+Sca1), which include common myeloid progenitor (CMP), megakaryocyte/erythrocyte progenitor (MEP), and granulocyte/macrophage progenitor (GMP) populations that give rise to all nonlymphoid myeloid cells (n = 8 mice per group). (G) The antimicrobial function of ECRG4 KO leukocytes was compared to WT mice in whole blood for their ability to kill MRSA. USA300 LAC [106 colony-forming units (CFU)/ml] was inoculated into fresh whole blood and incubated at 37C for 3 hours, and the remaining colonies were enumerated, revealing no difference in antimicrobial function (n = 3 mice per group).

To assess the effect of ECRG4 on gene expression in an in vitro model of leukocytes, we performed an RNA sequencing (RNA-seq) analysis on HL60 human promyelocyte cells engineered to constitutively express ECRG4. In a comparison with vector control HL60 cells, 1638 genes were up-regulated and 1632 were down-regulated in cells constitutively expressing ECRG4 (data file S1). Both Gene Ontology analysis of biochemical processes and a KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway visualization analysis demonstrated a number of biochemical pathways affected by the constitutive expression of ECRG4 that are important for inflammation and injury response (Fig. 4A and table S1).

RNA-seq was performed on HL60 promyelocytes constitutively expressing ECRG4. (A) The top differentially expressed pathways, as determined by KEGG pathway visualization, included pathways central to inflammatory responses. (B) The top differentially expressed category was proteoglycan signaling, with the CD44 pathway having the most genes altered, as demonstrated in the heat map (N.D., not detected). (C) CD44 cell surface protein was evaluated on these cells via flow cytometry, gating on green fluorescent proteinpositive (GFP+) cells and measuring CD44 mean fluorescence intensity (data are representative of five separate experiments with three replicates each; ***P < 0.001). (D) Confirmation of CD44 gene expression in the H60 cells constitutively expressing ECRG4 demonstrated loss of CD44 transcription via quantitative PCR (data are representative of five separate experiments with three replicates each). The ability of a soluble factor from the cells constitutively expressing ECRG4 to suppress CD44 was demonstrated by the addition of conditioned media (CM) to nave parental HL60 cells. (E) Decreased CD44 cell surface protein expression was determined by flow cytometry (data are representative of five separate experiments with three replicates each). MFI, mean fluorescence intensity.

The pathway most affected by the expression of ECRG4 in the KEGG analysis was the category of proteoglycans in cancer (Fig. 4A), which included changes in the expression of the HA receptor, CD44, and its signaling pathways (Fig. 4B and fig. S2). We validated a number of targets with potential relevance to the ECRG4-dependent inflammatory response defect in ECRG4 KO mice by flow cytometry (fig. S3), and cell surface CD44 was the most markedly altered. Given the deficit in neutrophil recruitment and wound healing seen in the ECRG4 KO mouse and the importance of CD44 in regulating leukocyte migration, inflammation, and TLR signaling (2, 911, 13, 14, 32), we hypothesized that ECRG4 may regulate the expression of CD44. Using these HL60 cells in vitro, we verified the RNA-seq data with quantitative polymerase chain reaction (PCR) to measure mRNA and flow cytometry to measure surface protein (Fig. 4, C and D). Delivery of ECRG4 leads to a decrease of cell surface CD44 protein in HL60 cells (Fig. 4C) and CD44 gene expression (Fig. 4D) compared to control cells. On the basis of the observation that shed ECRG4 peptide increases neutrophil recruitment in vivo (Fig. 2E), we determined whether soluble ECRG4 affected CD44 expression. Incubation of nave HL60 cells with the conditioned media of ECRG4-expressing cells, but not control cells, decreased CD44 surface protein expression (Fig. 4E). These results suggest that soluble ECRG4 can negatively regulate CD44 expression in vitro.

On the basis of the observation that increased expression of ECRG4 down-regulated CD44 on myelocytes in vitro, we sought to determine whether the loss of ECRG4 in KO mice affected CD44 on leukocytes in vivo. Using a flow cytometric analysis of uninjured mice, ECRG4 KO mice demonstrated a 57% increase in the expression of CD44 on blood neutrophils compared to WT controls (Fig. 5, A and C), with no difference in the overall number of CD44+ neutrophils (Fig. 5B). In bone marrow from uninjured mice, we observed an increase in CD44 surface expression on ECRG4 KO neutrophils (22.7% increase; Fig. 5, D and F) compared to WT mice, with no significant difference in the number of CD45+ cells or CD11b+Ly6G+ neutrophils (Fig. 5E and fig. S4). This increased CD44 expression on ECRG4 KO leukocytes, particularly neutrophils, correlates inversely with the loss of CD44 seen on myeloid cells overexpressing ECRG4 in vitro and supports a role for ECRG4 in the negative regulation of CD44 expression on neutrophils.

Flow cytometric analysis of blood (A to C) and bone marrow (D to F) from healthy ECRG4 KO mice and littermate controls assessed CD44 expression. (A and D) Representative histograms of CD44 expression on ECRG4 KO (unshaded plot) and WT (shaded plot) neutrophils. (B and E) Middle: Number of CD44+ cells within the CD45+CD11b+Ly6G+ neutrophil population, which were not significantly different between the ECRG4 KO and WT mice (n = 6 mice per group, representative of two independent experiments). (C and F) Right: CD44 MFI on CD45+CD11b+Ly6G+ neutrophils, which show a significant increase in the amount of CD44 expressed per cell in the ECRG4 KO mice compared to their WT controls [**P < 0.01 for (C) and *P < 0.05 for (D); n = 6 mice per group, representative of two independent experiments]. The expression of ECRG4 and CD44 was correlated in vivo in a wound time course. Gene expression was analyzed from an Affymetrix microarray performed on murine cutaneous wounds at multiple times through the wound healing process [Gene Expression Omnibus accession GSE23006; (34)]. Relative expression of CD44 (G) and ECRG4 (H) was plotted against time. (I) To visualize changes in expression of CD44 and ECRG4 together, the data were normalized to their expression at time 0 (uninjured skin). n = 3 mice for each of the eight time points.

On the basis of the in vitro and in vivo data demonstrating that ECRG4 negatively regulates CD44 expression on leukocytes, we evaluated the expression of these genes over the entire course of wound healing in mouse skin. Previous studies by our group demonstrated that ECRG4 expression remains low for the first 3 days after cutaneous injury and then increases with a peak of gene expression at day 7, when the wound is transitioning from the proliferative to the remodeling phases of repair (33). We reanalyzed the same gene expression database of cutaneous wound repair (34) and found that, as predicted, CD44 gene expression rapidly increased after injury and peaked at 24 hours before gradually returning to its baseline expression (Fig. 5G). As reported by Shaterian et al., ECRG4 expression remained low until day 3, when it increased until day 7, and then gradually decreased toward baseline (Fig. 5H). To compare these changes, expression was normalized to their relative expression at time 0 before injury and assessed together (Fig. 5I). The inverse relationship between ECRG4 and CD44 expression in the murine cutaneous wound supports a model wherein ECRG4 negatively regulates CD44 to mediate the inflammatory response to cutaneous injury.

This study demonstrates a role for leukocyte ECRG4 as a factor that amplifies neutrophil recruitment to site of injury and regulates their expression of CD44. Coordination of inflammation is an essential component of injury response and effective wound healing. The recruitment of neutrophils is a hallmark of the early wound response during hemostasis and the initial inflammatory phase, which prepares the wound bed for subsequent proreparative leukocytes to mediate revascularization, reepithelialization, and tissue repair. The regulation of CD44 by ECRG4 in this process is consistent with the role of CD44 in resolving inflammatory processes, including limiting neutrophil accumulation at sites of injury (2, 14), tempering TLR-mediated inflammatory responses (911), and enhancing phagocytosis (15) and efferocytosis (13), all of which are central to coordinated wound healing.

This study uses a novel genetic KO mouse model to identify ECRG4 as a previously unrecognized regulator of inflammation in cutaneous injury. Analysis of these wounds demonstrated defective recruitment of neutrophils in the ECRG4 KO wound at 24 hours after injury, which was confirmed in an aseptic injury model. We evaluated whether a thrombin-mediated ECRG4 peptide could contribute to this effect, because it has been shown to enhance leukocyte recruitment in tumor models. The CT16 peptide of ECRG4 was able to increase early in vivo neutrophil recruitment to an aseptic injury, demonstrating that an ECRG4 peptide generated in the thrombin-rich inflammatory microenvironment of the wound bed amplifies neutrophil responses. These data define ECRG4 as a regulator of the inflammatory response to injury, including early neutrophil recruitment and wound healing.

To further define the effects of ECRG4 seen in leukocytes in vivo, we used HL60 cells as an in vitro myeloid cell model. We identified the alteration of a number of key inflammatory processes in cells constitutively expressing ECRG4, including innate immune signaling (TLR signaling, NF-B cascade, and cytokine signaling), apoptosis, and cell cycle. Among these, CD44 expression was completely abrogated at the transcriptional and protein expression levels in the HL60 cells expressing ECRG4. This effect is mediated, at least in part, by a soluble factor from the ECRG4-expressing cells, as their conditioned media decreased CD44 expression on nave cells. These results indicate that ECRG4 can function in an autocrine or paracrine fashion to affect transcriptional programming of cells in the local inflammatory milieu. While it has been shown that various ECRG4 peptides are released into the media of cells constitutively expressing ECRG4 (16), the precise mechanism for its suppression of CD44 expression is unknown. We show that the capacity for ECRG4 to regulate CD44 expression occurs in vivo based on the increased CD44 expression observed on neutrophils from ECRG4 KO mice compared to WT mice and the inverse expression of these genes in the murine wound. These changes were due to an increase in CD44 expression per cell and not a change in the overall number of CD44+ cells in blood or bone marrow, supporting the role of ECRG4 as a negative regulator of CD44.

These findings define ECRG4 as a mediator of CD44 expression and support a model where loss of ECRG4 at the site of injury increases CD44 expression, suggesting a novel mechanism for the regulation of the inflammatory response in cutaneous injury. In these studies, we demonstrate a role for ECRG4 in both cutaneous wounds and the subcutaneous PVA implant, which represent two distinct models of inflammation. This also appears to be a previously unrecognized regulatory pathway of inflammation, as CD44 itself is known to play an important role in regulating the inflammatory response to a variety of injuries, including cutaneous wounds (2), pneumonia (12), noninfectious lung injury (13), and myocardial infarction (14). Neutrophil recruitment and TLR responses are central to the cutaneous host defense against infection. Several investigators have found that activation of CD44 by fragments of HA released from injured tissue modulates TLR signaling, decreases inflammatory responses, and prevents excessive systemic inflammation, such as septic shock (911). Others have shown that decreased CD44 enhances neutrophil accumulation at the site of injury (2, 14). Together, these data infer that an ECRG4-CD44 pathway may be important for host defense.

Our findings demonstrate that ECRG4 mediates the early inflammatory response and regulates CD44 expression. In addition to this ability, previous studies have shown that cell surface ECRG4 can be processed by proteases, like thrombin, at the site of inflammation or tumor to release peptides with proinflammatory activity. While intact ECRG4 associates with TLR4 (16, 23), its various peptide fragments increase phosphorylation of p65 (16, 17), bind scavenger receptors, and activate NF-B in a MyD88-dependent manner in cultured cells (25). Despite these reports, the function of ECRG4 in regulating inflammation was previously unknown, in vivo.

On the basis of our current findings, we propose a model (Fig. 6) where ECRG4 acts as a sentinel and maintains homeostasis on quiescent leukocytes, including restraining expression of CD44. In this model, ECRG4 expression levels determine the amount of CD44 on the leukocyte surface (Figs. 5I and 6A) to precondition its responsiveness to proinflammatory signals, such as TLR agonists. Higher levels of ECRG4 expression would result in decreased CD44 and thus less anti-inflammatory signaling, such as TLR signal suppression. After injury, rapid processing of cell surface ECRG4 protein in the protease-rich inflammatory milieu releases ECRG4 peptides that activate NF-B signaling and amplify local inflammatory responses and neutrophil recruitment (Fig. 2E). This proteolytic processing depletes cell surface ECRG4 (Fig. 6B), while ECRG4 transcription remains low immediately after injury, preventing its replacement (Figs. 5H and 6) (3335). Loss of ECRG4 releases its inhibition of CD44. This leads to subsequent increases in CD44 expression at the site of injury (Figs. 6C and 5, G and I) (14, 34), which can temper proinflammatory responses (911) and contribute to the resolution of inflammation (2, 1214). Return of ECRG4 expression at the end of the inflammatory phase (Figs. 6D and 5, H and I) decreases CD44 expression (Figs. 6E and 5, G and I) and restores homeostatic expression levels. This model is further supported by studies of human burn patients, where it has been observed that cell surface ECRG4 on circulating leukocytes diminishes after injury but returns to housekeeping levels as patients recover (24). These findings support a role for ECRG4 as a sentinel factor, which can both precondition the responsiveness of leukocytes through its regulation of CD44 expression and respond to environmental cues to mediate the kinetics of the cutaneous inflammatory response.

(A) On quiescent leukocytes, ECRG4 expression maintains CD44 at homeostatic levels. Following injury, leukocytes present in the wound are exposed to proteases during the hemostasis and early inflammatory phases. These proteases cleave leukocyte cell surface ECRG4 to release active peptides into the wound milieu, which enhance the early local inflammatory response. (B) Black tracing represents decreasing cell surface ECRG4 as it is cleaved by wound proteases to release peptides. During this phase, ECRG4 transcription remains low (green tracing), so ECRG4 protein is not replenished on the cell surface. (C) This loss of ECRG4 removes its inhibition of CD44 expression (red tracing), which results in an increase in cell surface CD44 receptor (purple tracing). Increased CD44 functions to resolve the inflammatory phase; it is activated by HA fragments in the wound to decrease proinflammatory signaling. As the wound transitions to the proliferative phase, ECRG4 expression resumes (D) and mediates a decrease in CD44 expression (E), returning both ECRG4 and CD44 cell surface protein to homeostatic levels as wound closure completes and the wound transitions to the remodeling phase. Gene expression data from Fig. 5 (G to I) [Gene Expression Omnibus accession GSE23006; (34)] are shown. Protein expression inferred from published reports (14, 35).

While deficient neutrophil mobilization has been shown to inhibit wound healing (36, 37), which we observed in the ECRG4 KO mouse wound, many studies have demonstrated that prolonged neutrophil recruitment also results in delayed wound closure (38, 39). Earlier studies examined the effect of adenovirus-driven ECRG4 overexpression in cutaneous excisional wounds and observed delayed wound healing, possibly through decreased migration of fibroblasts (33). On the basis of our current studies, we hypothesize that ECRG4 overexpression in the wound bed decreases CD44 expression, which has been shown to decrease fibroblast migration (2). This is supported by the wound closure (Fig. 1A) and healing rate (fig. S1A) plots. Initially, rapid wound closure occurs through contraction and migration of keratinocytes over residual basement membrane at the wound margin. The rate then slows, as further reepithelialization requires keratinocyte proliferation and replacement of the basement membrane by fibroblasts. In our model, ECRG4 KO mice have increased CD44 expression, which may contribute to the equalization of the healing rate seen in the KO mouse after an initial delay that occurs in the first 3 days after injury. The potential role of ECRG4 in regulating the function of stromal cells is outside the scope of this study but will be an important area for further investigation. Our current results also suggest that an ECRG4-mediated decrease in CD44 expression could support excessive neutrophil recruitment and prolonged inflammation (2, 14, 32), which also contribute to delayed wound closure. Neutrophils are essential for the onset of inflammation, but the termination of neutrophil influx is equally critical for timely resolution of inflammation and prompt restoration of tissue homeostasis (40).

In our study, we demonstrated that ECRG4 is a negative regulator of CD44 expression and a mediator of early inflammatory responses. It is interesting to note that the gene encoding ECRG4 is epigenetically regulated. Its expression and transcriptional responsiveness are down-regulated by hypermethylation of its promoter (41), accounting for its diminished expression in multiple human cancers (1921). Many of these same cancers are marked by increased expression of CD44 (42), which is implicated in their proliferation and metastasis and correlates with our findings that ECRG4 is a negative regulator of CD44. On the basis of our experimental observations demonstrating a role for ECRG4 in recruiting neutrophils to the site of injury and regulating CD44 expression levels, it is interesting to speculate that the epigenetic inhibition of ECRG4 expression may alter CD44 expression to precondition the inflammatory response, thus driving phenotypic differences in individuals based on environmental exposures and aging, which affect promoter methylation.

Here, we report that ECRG4 modulates CD44 expression and mediates the early neutrophil response to injury, with impaired wound repair in its absence. The precise timing of inflammation and its resolution in the wound healing response is essential to proper wound closure, with unresolved inflammation driving most of the chronic wounds. Our current study demonstrates that ECRG4 is a factor that helps orchestrate the proper timing of the inflammatory response: First, it facilitates and amplifies early inflammation but then subsequently supports the expression of factors that are essential to injury resolution. A better understanding of its contribution to inflammation preconditioning, susceptibility, and resilience will help identify new and sorely needed diagnostic and therapeutic strategies to treat cutaneous diseases that are associated with dysfunctional inflammation, including chronic wounds.

Heterozygous ECRG4 KO mice were purchased from the Mutant Mouse Regional Resource Center supported by the National Institutes of Health and distributed by the University of California, Davis. Briefly, RIKEN complementary DNA 1500015O10 gene coding exon 1 was targeted by homologous recombination in B6/129S5 mixed-background mice. Heterozygous ECRG4 KO mice were then backcrossed to C57/BL6 mice (the Jackson Laboratory, no. 000664) for five generations and subsequently interbred to generate homozygous ECRG4 KO mice on the C57/BL6 background. Ten- to 12-week-old littermate mice were used for experiments involving ECRG4 KOs, and 10- to 12-week-old C57/BL6 mice purchased from the Jackson Laboratory were used as WT mice in experiments without ECRG4 KO mice. The University of California, San Diego (UCSD) Institutional Animal Care and Use Committee approved all animal procedures.

Excisional wound studies were modified from the protocol of Galiano et al. (43). Briefly, mice were anesthetized, and dorsal hair was clipped and depilated with Nair (Church & Dwight). Full-thickness excisional skin wounds were created with a 4-mm biopsy punch. A donut-shaped splint with an outer diameter of 10 mm and an inner diameter of 6 mm was prepared from a 0.5-mm-thick silicone sheet (Grace Bio-Labs, Bend, OR) and sutured on top of the wound using 4-0 nylon monofilament sterile suture (CP Medical, no. CP-B662B-05). Digital photography was used to image each wound daily with a ruler included for scale. Wound area was assessed by planimetry using the National Institutes of Health ImageJ software. Wounds were excised at various time points in some experiments and either fixed in 10% buffered formalin for histological analysis or digested with a Whole Skin Dissociation Kit (Miltenyi Biotec, no. 130-101-540) per manufacturers instructions to isolate cells for flow cytometry. All experiments were repeated three times, unless otherwise stated, with data pooled and total n noted in the figure legends of each experiment.

ECRG4 KO mice and WT littermates, or C57/BL6 mice, were used for PVA sponge implantation assays (28). PVA sponges (7 mm by 3 mm; PVA Unlimited Inc.) were sterilized and hydrated with saline. Anesthetized mice were shaved, an incision was made on the back, and sponges were implanted subcutaneously (28, 29). Incisions were closed with a single 4-0 monofilament nylon suture (CP Medical, no. CP-B662B-05). In one set of assays, 2 g of sterile synthetic CT16 peptide (Phoenix Pharmaceuticals, no. 012-24) in phosphate-buffered saline (PBS), or vehicle control, was instilled into the PVA sponges before implantation. Infiltrates were isolated from the sponge in PBS and analyzed by flow cytometry at indicated time points. All experiments were repeated three times, unless otherwise stated, with data pooled and total n noted in the figure legends of each experiment.

Live cells were collected from mouse bone marrow, blood, spleen, PVA sponges, or digests of mouse wounds and skin, as described above. Cells were incubated with a cocktail of primary antibodies that included specified antibodies: antiCD11bAPC (allophycocyanin)Cy7 (BD Pharmingen, 561039; 1:200) and antiLy6CPE (phycoerythrin) (BD, eBioscience, 12-5932-80; 1:200) or antiCD45-VioGreen (Miltenyi Biotec, 130-110-803), antiCD11b-APC-Vio770 (Miltenyi Biotec, 130-109-288), antiLy6C-APC (Miltenyi Biotec, 130-102-341), antiCD44-PE-Vio770 (Miltenyi Biotec, 130-110-085), and antiLy6GFITC (fluorescein isothiocyanate) (Miltenyi Biotec, 130-107-912) or Lineage-Biotin cocktail (Miltenyi Biotec, 130-092-613) + antibiotin-FITC (Miltenyi Biotec, 130-113-852), antiCD48-VioBlue (Miltenyi Biotec, 130-102-447), antiSca1-PE (Miltenyi Biotec, 130-116-489), antiCD150-PE-Vio770 (SLAM) (Miltenyi Biotec, 130-104-682), and antiCD117-APC (Miltenyi Biotec, 130-102-492). Propidium iodide (Miltenyi Biotec, 130-093-233) exclusion was used to determine viable cells. HL60 cells were stained with antiCD44-APC (Miltenyi Biotec, 130-113-338). Flow cytometric and data analyses were performed on a BD Accuri or Miltenyi Biotec MACSQuant10 Flow Cytometer. Data were analyzed with FlowJo software (FlowJo LLC), and statistical analysis was performed as below. All experiments were repeated three times, unless otherwise stated.

To measure infiltration of Gr1+ cells into the wound, tissues were harvested 1 day after injury and frozen in optimal cutting temperature compound. Standard immunohistochemistry was performed on frozen sections using biotinylated antiGr-1 (BD Pharmingen, clone RB6-8C5, no. 553125; 1:200) as the primary antibody and horseradish peroxidaseconjugated streptavidin (Jackson ImmunoResearch, no. 016-030-084; 1:500) as the secondary antibody. Nuclei were counterstained by Mayers hematoxylin, and slides that were incubated with 1% bovine serum albumin instead of primary antibody were used as negative controls. Immunostaining of tissue sections was imaged with an FSX100 microscope (Olympus). Identification of neutrophils was confirmed by cell and nuclear morphology. Paraffin embedding, sectioning, and hematoxylin and eosin (H&E) stains were performed by the UCSD Tissue Technology Shared Resource Histology Core.

The MRSA strain USA300 LAC was grown on Baird-Parker agar for selection, with individual colonies inoculated in tryptic soy broth and grown to mid-log phase. Bacteria were washed in sterile PBS. One hundred microliters of whole blood from ECRG4 KO or WT mice was inoculated with 105 colony-forming units (CFUs) (starting concentration of 1 106 CFU/ml), and samples were incubated at 37C for 3 hours. Serial dilutions of the samples and initial inoculum were prepared in PBS and plated on Baird-Parker agar for enumeration. n = 4 mice per group with three technical replicates per mouse.

The acute promyelocytic leukemia promyeloblast human cell line HL60 (ATCC CCL-240) was purchased from the American Type Culture Collection (ATCC) and maintained as recommended in Iscoves modified Dulbeccos medium with 20% fetal bovine serum in an atmosphere of air (95%) and carbon dioxide (5%) at 37C with replacement of medium and passaging at a cell density between 1 105 and 1 106 viable cells/ml every 2 to 3 days.

The full-length human ECRG4 open reading frame was amplified by PCR of a pCMV6-XL4-c2orf40 plasmid (OriGene, no. SC104814) encoding the human ECRG4 transcript (NM_032411) using primers 5-AGTCCTCGAGCCCCGCCGCCATGGCTG-3 (forward) and 5-ATTCGGATCCATGGTTAGTAGTCATCGTA-3 (reverse) and cloned into the Xho I and Bam HI cloning sites of pLVX-IRES-ZsGreen1 vector (Clontech, no. 632187) to generate a bicistronic expression vector (lv-ECRG4) that encodes and expresses ECRG4 and green fluorescent protein (GFP). Sequencing confirmed identity of the final plasmid, and the pLVX-IRES-ZsGreen1 plasmid without ECRG4 was used to prepare control GFP+ cells (lv-vector). Lentivirus was prepared using a lentivirus packaging system (Clontech) in Lenti-X 293 cells as described by the manufacturer. Viral titers obtained ranged from 2.3 107 to 4.0 107 used within 3 days on target cells.

HL60 cells were transfected using empty (lv-vector) or ECRG4 (lv-ECRG4) lentivirus using RetroNectin reagent (Takara Inc.) as described by the manufacturer. Five days later, GFP+ cells were sorted at the cell sorting facility of the Moores Cancer Center at UCSD and expanded. Two weeks later, GFP+ cells were selected a second time by cell sorting, expanded, and passaged, and aliquots of both sorts were frozen in serumdimethyl sulfoxide.

In two experiments, vector and ECRG4-expressing HL60 cells were cultured in 35-mm, six-well culture dishes at a concentration of 50,000 cells per well, and RNA was isolated, digested free of DNA, and submitted to genomics core laboratories of Cedars-Sinai (Los Angeles) for RNA-seq analyses. Bioinformatics analyses were performed from FASTQ files, and FPKM (fragments per kilobase of exon model per million reads mapped) was determined by AccuraScience (Iowa), by the UCSD genomics and Cedars-Sinai core, or with public domain resources including STRING (https://string-db.org), Cytoscape (https://cytoscape.org), and the iDEP.85 web-based tool for RNA-seq data analysis and visualization (http://bioinformatics.sdstate.edu/idep/) as indicated.

RNA was isolated from HL60 cells using an RNeasy mini kit with deoxyribonuclease treatment (Qiagen, no. 74704) according to the manufacturers recommended procedures, and yields and purity were assessed using a NanoDrop2000 Spectrophotometer (Thermo Fisher Scientific). Complementary DNA synthesis was accomplished with 1 g of total RNA using iScript (Bio-Rad #170-8891) according to the manufacturers procedures. CD44 gene expression was analyzed with CD44 primers purchased from OriGene (no. HP200577), and data were normalized to glyceraldehyde-3-phosphate dehydrogenase using forward (CATGAGAAGTATGACAACAGCCT) and reverse (AGTCCTTCCACGATACCAAAGT) primers purchased from Life Technologies.

All statistical analyses were performed using Mstat software (McArdle Laboratory for Cancer Research, University of Wisconsin) or GraphPad Prism (GraphPad Prism Software Inc.). Unpaired two-sample t test, Wilcoxon rank sum test, or two-way analysis of variance (ANOVA) with Bonferroni posttest were used. P < 0.05 was considered statistically significant. Data are presented as means SD of the mean. Sample size calculations were performed with = 0.05 and = 0.2. First derivative of the wound closure plot in Fig. 1A was performed with Prism with default 4 neighbor smoothing.

Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/11/eaay0518/DC1

Fig. S1. ECRG4 regulates the early response to injury.

Fig. S2. HA signaling pathway from KEGG pathway analysis of RNA-seq data.

Fig. S3. Flow cytometric validation of RNA-seq targets relevant to inflammation.

Fig. S4. ECRG4 KO mice have increased CD44 expression on CD45+ leukocytes in blood.

Table S1. Gene Ontology and KEGG pathway visualization of RNA-seq data.

Data file S1. RNA-seq data.

This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial license, which permits use, distribution, and reproduction in any medium, so long as the resultant use is not for commercial advantage and provided the original work is properly cited.

Acknowledgments: We thank A.-M. Hageny, E. Amburn, and K. Sail for their technical support. Funding: This project was supported by the National Institutes of Health, grant KL2TR001444 of CTSA funding through the UCSD CTRI, and a Sun Pharma-SID Innovation Research Fellowship to R.A.D. and NCI R01 CA170140, DoD/ABA W81XWH-10-1-0527, and UCSD Hammond Fund and Division of Trauma Research Re-Investment Fund to B.P.E., A.B., and T.C. The UCSD Tissue Technology Shared Resources Core, supported by the NCI Cancer Center Support grant P30CA23100, performed hemograms and tissue processing with H&E staining. Author contributions: R.A.D., J.L., T.C., A.B., and B.P.E. designed the studies. R.A.D., J.L., and O.C. performed the experiments. R.A.D. wrote the manuscript with editorial advice from A.B. and B.P.E. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are presented in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read more from the original source:
ECRG4 regulates neutrophil recruitment and CD44 expression during the inflammatory response to injury - Science Advances

Recommendation and review posted by Bethany Smith

Cosmetic Skin Care Market 2018: Global Industry Insights by Global Players, Regional Segmentation, Growth, Applications, Major Drivers, Value and Foreseen till 2024

The report provides both quantitative and qualitative information of global Cosmetic Skin Care market for period of 2018 to 2025. As per the analysis provided in the report, the global market of Cosmetic Skin Care is estimated to growth at a CAGR of _% during the forecast period 2018 to 2025 and is expected to rise to USD _ million/billion by the end of year 2025. In the year 2016, the global Cosmetic Skin Care market was valued at USD _ million/billion.

This research report based on Cosmetic Skin Care market and available with Market Study Report includes latest and upcoming industry trends in addition to the global spectrum of the Cosmetic Skin Care market that includes numerous regions. Likewise, the report also expands on intricate details pertaining to contributions by key players, demand and supply analysis as well as market share growth of the Cosmetic Skin Care industry.

Request Sample Report @https://www.mrrse.com/sample/6559?source=atm

Cosmetic Skin Care Market Overview:

The Research projects that the Cosmetic Skin Care market size will grow from in 2018 to by 2024, at an estimated CAGR of XX%. The base year considered for the study is 2018, and the market size is projected from 2018 to 2024.

Leading manufacturers of Cosmetic Skin Care Market:

below:

Global Cosmetic Skin Care Market, Product Analysis

Global Cosmetic Skin Care Market, Application Analysis

In addition the report provides cross-sectional analysis of all the above segments with respect to the following geographical markets:

Global Cosmetic Skin Care Market, by Geography

Request For Discount On This Report @ https://www.mrrse.com/checkdiscount/6559?source=atm

Some important highlights from the report include:

Buy This Report @ https://www.mrrse.com/checkout/6559?source=atm

The Questions Answered by Cosmetic Skin Care Market Report:

And Many More.

Read this article:
Cosmetic Skin Care Market Research Insights 2019 Global Industry Outlook Shared in Detailed Report, Forecast to 2027 - News Times

Recommendation and review posted by Bethany Smith

Physicians primarily consider a womans age at diagnosis and her familys cancer history when determining whether to recommend genetic testing. A woman diagnosed with breast cancer before age 50, for example, or a healthy woman with several close family members who have had breast or ovarian cancer, is more likely to be referred for genetic testing than a postmenopausal woman with breast cancer and no other risk factors.

For the study, Kurian and Stefanick and their colleagues set out to compare the prevalence of cancer-associated mutations in 10 breast-cancer risk genes, including BRCA1 and BRCA2. They compared 2,195 women who were diagnosed with breast cancer at an average age of 73 with 2,322 women without breast cancer.

The data for the study came from more than 4,500 participants in the long-runningWomens Health Initiative. The initiative enrolled more than 160,000 women ages 50 to 79 throughout the United States between 1993 to 1998 to conduct the largest study of postmenopausal health in the country. Stefanick served as chair of the initiatives steering committee for most of the project.

The researchers found that about 3.5% of the women with breast cancer in their study had a cancer-associated mutation in at least one of the 10 genes, compared with about 1.3% of women without cancer. When they narrowed their focus to just the BRCA1 and BRCA2 genes in women diagnosed before age 65, they found that about 2.2% of women with breast cancers had cancer-associated mutations, versus about 1.1% of those without breast cancer.

Only about 31% of those women with cancer and 20% of those without cancer, both with BRCA1 or BRCA2 mutations, were likely to have been recommended for testing under the current guidelines of the National Comprehensive Cancer Network.

Now we know that the prevalence of cancer-associated BRCA1 and BRCA2 mutations in women diagnosed with breast cancer after menopause rivals that in women of Ashkenazi Jewish descent a population that is currently encouraged to discuss genetic testing with their doctors, Kurian said. We finally have a read on the likely benefit of testing this most common subgroup of breast cancer patients.

Researchers from Myriad Genetics Inc., the University of California-San Diego and the State University of New York contributed to the study.

The research was supported by Myriad Genetics, the Suzanne Pride Bryan Fund for Breast Cancer Research, the Jan Weimer Faculty Chair in Breast Oncology and the BRCA Foundation.

Read more here:
Older women with breast cancer may benefit from genetic testing - Stanford Medical Center Report

Recommendation and review posted by Bethany Smith

When it comes to fighting rare diseases, the biggest barrier to overcome is often the lack of knowledge around the condition. A free genetic test is hoping to combat this and speed up drug development in inherited retinal diseases.

The small patient populations in rare diseases and resulting lack of understanding about the conditions natural histories has many implications for researchers trying to develop orphan drugs.

Clinical trials become difficult to set up due to the limited experience in conducting studies for these diseases, including the lack of understanding of what endpoints will be most sensitive, says Daniel de Boer, chief executive officer of ProQR Therapeutics, which is developing RNA therapies to treat inherited retinal diseases (IRD).

Standard trial designs are not optimised to obtain adequate safety and efficacy data from small numbers of patients, and trials are frequently conducted on an international scale with various regulatory agency oversights.

Like in many rare diseases, there are some dire statistics in IRDs. There are as many as 300 inherited retinal diseases known today, affecting over two million people but only a fraction of these patients have access to a therapy.

IRDs also require precise and targeted treatments to deliver an accurate genetic diagnosis.

The programme is taking a crowdsourcing approach to gathering the data researches need when working on orphan drugs

From talking to retina specialists, we know that barriers to genetic testing remain a challenge for patients, says de Boer. For instance, at ProQR we are developing RNA therapies for specific mutations causing Lebers congenital amaurosis 10 (LCA10), Usher syndrome type 2 and autosomal dominant retinitis pigmentosa (adRP). However, there are hundreds of genetic mutations that can cause inherited retinal diseases.

Without knowing the exact mutations and the prevalence in which they occur, it can be difficult to design therapies and execute clinical trials for these rare and ultra-rare diseases.

In an effort to give researchers the best possible start when developing treatments for eye diseases, The Foundation Fighting Blindness has founded the My Retina Tracker programme, in partnership with Blueprint Genetics and InformedDNA.

The programme is a global, patient-driven registry for inherited retinal diseases (IRD). It offers free, open access genetic testing and genetic counseling for individuals living in the United States with a clinical diagnosis of IRD.

The genetic counseling consists of reviewing a patients medical and family history, interpretation of genetic variants, correlation with the disease, and medical management recommendations.

The programme also gives individuals the opportunity to contribute to focus groups, patient journey analyses, research studies, and the opportunity to be enrolled in relevant natural history studies and clinical trials.

My Retina Tracker also records subjective information from patients regarding how their disease affects their day to day activities. This recording option is available to doctors, allowing them to enter any additional information during appointments with patients.

In other words, the programme is taking a crowdsourcing approach to gathering the data researches need when working on drugs for IRDs.

Since its establishment in 2017 over 6,000 people with an IRD have participated, with the Foundation FIghting Blindness aiming to test over 20,000 patients within the next few years.

This has created a powerful genotype/phenotype database, says de Boer.

ProQR has recently become the first industry partner for the programme, giving it access to expert physicians and de-identified data from specific participating IRD patients.

This data has the potential to expedite the advancement of new treatments by identifying the mutations causing inherited rare diseases, de Boer explains.

The companys RNA therapies aim to edit RNA, the blueprint for proteins. Targeting RNA does not affect a persons DNA, the source of the genetic code, but instead reduces the risk of permanent side effects.

For inherited retinal diseases, RNA therapies can be administered through intravitreal injections, which is a far less invasive procedure than the retinal surgery required for gene therapies, de Boer says. RNA therapies do not need a vector to enter cells rather, intravitreal injection allows the drug to be distributed to the entire retina, which is where the therapy is needed.

The data can have additional benefits in clinical trial recruitment by identifying patients with these rare diseases.

Data like this is instrumental when recruiting participants for a trial. Treatments for inherited retinal diseases, like our RNA therapies, are specifically designed for a certain genetic mutation. Identifying the exact mutation that causes the disease encourages patients to participate in trials that target their mutation.

There are also benefits in diagnosis a confirmed genetic diagnosis may help patients and doctors better understand prognosis and help guide medical management.

With this information, physicians can determine the correct diagnosis and potential treatment for a patient, says de Boer. The data may match the patients mutation to an existing therapy or an ongoing clinical trial.

In terms of research and the development of therapeutics, it is crucial to increase our knowledge on the prevalence of the specific gene variants that cause an IRD.

Go here to see the original:
Genetic testing hopes to speed up drug development in rare eye diseases - - pharmaphorum

Recommendation and review posted by Bethany Smith

Shari Ungerleider is a firm believer that if a person is going to undergo genetic testing, they should also receive genetic counseling. She says the information gathered from testing is too complicated for a layman to break down, and if read incorrectly can result in a misdiagnosis.

Ungerleider is the project coordinator of Jewish Genetic Disease Consortium (JGDC) and her mission is to educate the medical community, Jewish community and Jewish clergy about genetic diseases.

Also working to get the word out are Nancy Lurie, chief operating officer of the Neuromuscular Disease Foundation (NDF), and Karen Arnovitz Grinzaid, executive director of JScreen. They teamed up with Ungerleider in Los Angeles in February to raise awareness about advancements in genetic testing and options for carriers of recessive diseases.

Theres no way that an OB-GYN or a pediatrician or any other doctor can keep up with genetic science, Ungerleider said. Our philosophy is, refer them to a genetic counselor. If you have a patient that has a problem with their heart, youre going to send them to a cardiologist. So every patient [that receives] genetic testing, [you should] send them to a genetic counselor.

According to the Los Angeles nonprofit GeneTestNow, which provides information on Jewish genetic diseases, a number of these diseases are commonly found in Jewish populations. In general, all ethnic groups have certain conditions that are passed down and if two carriers have the same condition, there is a 1 in 4 chance their child can be affected.

While Tay Sachs and Gaucher disease remain the most widely known recessive genetic diseases among Jews, Lurie said genetic testing awareness has been expanded to interfaith couples, non-Jews and Persian and Sephardic Jews because they can be carriers of various types of neuromuscular diseases. Thats why, she said, its important for everyone, not just Ashkenazi Jews, to get tested.

This generation is much more open to talking about genetic testing, Lurie said. They can learn and pass it on to the people they know best [in their community]. NDF is [educating] through the young adults. The opportunity to educate the clergy is something we really havent been able to do [until now].

Among their many visits around Los Angeles, the trio made presentations to clergy at Sinai Temple and at Wilshire Boulevard Temple.

Theres no way that an OB-GYN or a pediatrician or any other doctor can keep up with genetic science. Our philosophy is, refer them to a genetic counselor. Shari Ungerleider

Ungerleider is passionate about the cause because her son Evan died from Tay Sachs. Ungerleider was tested for Tay Sachs but got a false negative after her doctor misread her test results. Now she fights so that every couple planning for a family can gain access to their genetic information before pregnancy so they can know their options.

I would never knowingly put a child through what Evan [went through], Ungerleider said. The question I sometimes get from people is, Well, do you wish you never had Evan? and the answer is, No, I dont wish I didnt have him. Do I wish I was able to know and spare him with what he went through? Absolutely. I would have changed that in a second. Its a parents responsibility to protect them and take care of them, and that starts the moment after conception. So anything you can do to spare your childs pain if you know, my philosophy is do it. Genetic testing isnt telling you what to do, its providing you with options.

Grinzaid, who was a genetic counselor before she became JScreens executive director, told the Journal many couples are nervous about being screened.

Having to sit with a family and give them bad news, thats hard. I had to do that for many years, Grinzaid said. Sometimes I would sit down with a family and I would know that they could have had genetic testing and known about the risk ahead of time but didnt have access to the testing. If we are able to test people and give them a heads-up ahead of time, thats a gift.

JScreen tests for 226 diseases. Through saliva at home spit tests, Jewish and non-Jewish couples can get tested for $149, regardless of insurance. Then, couples can meet privately with a genetic counselor to hear their options.

We are all about prevention so they can plan ahead, Grinzaid said. We dont screen minors, but [you can get tested] whenever a couple decides to do this, as long as it is before pregnancy. If you are a high-risk couple, there are options. If you are already pregnant, there are options, but there are fewer options.

Grinzaid said that genetic advancements have grown immensely over the past eight years. However, she noted there is a misconception that if a couple is a carrier for the same disease, they have to break up because they cant have a healthy baby. Now, Grinzaid says, there are safe options that allow the couple to stay together and raise a family. Couples can choose to undergo in vitro fertilization (IVF) with preimplantation genetic diagnosis (PGD), they can use an egg or sperm from a screened noncarrier donor or they can choose to adopt children.

The main priority is to get tested early and not fear the results. Even if theyre completely healthy, everybody has a risk of being a carrier for genetic diseases. About 80% of people will be tested as a carrier because there are so many genes on the panel, so [dont] be nervous about being a carrier, Grinzaid said, noting the only problem is when both couples are a carrier for the same disease. One thing that is reassuring is only about 3% of couples in these programs are at risk. I like to reassure them that they are probably going to hear good news.

See more here:
Educating the Community About Jewish Genetic Diseases - Jewish Journal

Recommendation and review posted by Bethany Smith

CALGARY -- When Madden Ellis Garraway was just under two-years-old, he became very sick.

His skin was so dry it bled and he couldnt hold down food, causing his weight dropped to within ounces of his birth weight of seven pounds, six ounces.

Doctors struggled to figure out what was wrong.

We had a large list of things that we were thinking of, and our immunology team and my colleagues who are working with Madden were having trouble arriving at the right one," said Dr. Francois Bernier, head of the Department of Medical Genetics and a professor in the Department of Paediatrics at the University of Calgary's Cumming School of Medicine.

"In fact, we made some attempts to arrive at a diagnosis but we're still unsure. It took a while.

Doctors often struggle with diagnosing unusual health issues, especially those that may require genetic testing.

They often must rely on genome sequencing tests to determine the root cause of a disease and until now, large-scale genome sequencing tests were often sent to labs in the United States for analysis.

Bernier calls it "the diagnostic odyssey," a long, difficult, journey for families waiting while cliniciansfigure out what is causing the underlying health issues.

Madden Garraway in hospital at the age of two. (Photo courtesy the Garraway family)

Maddens family can attest to that.

It was months of waiting, wondering and worrying before Madden's blood was sent to a U.S. lab for genome analysis, where it was learned he suffered from a rare genetic condition called immune dysregulation polyendocrinopathy enteropathy X-linked (IPEX) syndrome.

IPEX is a rare genetic disorder that can be life threatening.

"If we could have learned about that instantly, or within the several weeks that we can do now, that will save a lot of time," said Maddens father, Patrick Garraway.

"We could have got on with his bone marrow transplant sooner."

Madden received a bone marrow transplant from his sister. Now five-years-old, the playful youngster has made a full recovery and no longer requires medication.

"There are so many families waiting for answers to serious medical conditions," said Bernier.

"Access to gene sequencing early in the medical journey can pinpoint the best treatment approaches and therapies to target the illness."

Madden Garraway today at the age of five. (Photo courtesy the Garraway family)

A new partnership struck between the University of Calgary, University of Alberta, and Alberta Precision Laboratorieswill help families and medical professionalsanswer to those diagnostic puzzles sooner.

The partnership is funded by Genome Canada, the Alberta Childrens Hospital Foundation, and other partners. Four other centres in Canada are also undertaking similar programs through Genome Canadas funding, one in B.C., two in Ontario and one in Quebec.

The rest is here:
Rapid genetic testing becomes available to Calgary medical community - CTV News

Recommendation and review posted by Bethany Smith

By Jason Arunn Murugesu

Jochen Tack / Alamy

As consumer genetic testing has risen in popularity, awareness of the value of genetic data has lagged behind. A survey of people in the US has found that 50 per cent would hand over their genetic data for $95 (70), on average.

Forrest Briscoe at Pennsylvania State University and his colleagues surveyed more than 2000 people about the use of genetic data, which can be stored in databases for police use, at direct-to-consumer genetic test firms, and for medical research.

I really felt like we needed updated information about how the public views these databases, says Briscoe. They are growing quickly, in number and size, but the information being used to inform design and governance is outdated.

Advertisement

The participants, a representative sample of the US population, watched a 3-minute video detailing both the commercial value of genomic data and genetic privacy issues. This included a statement that consumer genetic testing firm 23andMe sells access to its databaseto pharmaceutical firms for $140 per individuals data.

The participants were then split into five groups and asked whether they would grant access to their genetic data either as a donation or in exchange for money to one of five types of organisation: a non-profit hospital, a pharmaceutical company, a tech firm, a university research lab and a US federal research agency.

While 38 per cent said they wouldnt share their data, 50 per cent said they would if they were paid, and 12 per cent said they would do it for free.

The type of organisation that would use their data didnt affect willingness to share. That was a surprise, says Briscoe. We think this makes the case for a common governance framework for DNA databases, whoever they are owned by.

Those who said they wanted to be paid, expected a median of $130, but said they would accept $95 if they also received a health and ancestry report based on their genetic data. People who said they would give their data away said they would pay an average of $75 for such a report.

These results demonstrate the growing interest in maintaining a degree of control over personal information, says Tim Caulfield at the University of Alberta, Canada. The public has been told for decades that this research is essential and valuable and potentially profitable. They may be thinking, Okay, I believe you. Pay me.

Journal reference: PLoS One, DOI: 10.1371/journal.pone.0229044

More on these topics:

Continued here:
Half of people in the US would sell their genetic data for $95 - New Scientist News

Recommendation and review posted by Bethany Smith

The Direct-to-Consumer (DTC) Genetic Testing Market report coverage is comprised of various parameters such as the industry size, regional opportunities for market expansion, important participants in the industry, restraining factors as well as driving forces, segmental analysis, and details on competitive landscape.

Request for a sample copy of this report @ https://www.decresearch.com/request-sample/detail/3033

Report Growth Drivers Rising public awareness in North AmericaIncreasing income level in emerging economiesGrowing incidences of genetic disorders globallyIncreasing demand for service personalization in North America and Europe

The main aim of the study is to entail substantial data and updates pertaining to the market and also to educate the audience on the various growth opportunities prevailing in the industry, which may help augment the business space. A deep-dive summary of the Direct-to-Consumer (DTC) Genetic Testing Market in combination with an in-depth set of the market definitions and business sphere overview have been provided in the report.

Make an inquiry for purchasing this [emailprotected] https://www.decresearch.com/inquiry-before-buying/3033

The abstract section is inclusive mainly of the information about the market dynamics. This is further encompassed of the driving factors augmenting the industry share, business constraints, trends characterizing the industry, in tandem with the numerous growth opportunities prevalent in the space.

Information about the pricing evaluation alongside the value chain analysis have been given in the study. Historic figures and estimates pertaining to the industry expansion spanning the projection period are also entailed in the study.

Top CompaniesandMe, Ancestry, Color, EasyDNA, Family Tree DNA, Full Genomes, Genesis HealthCare, Helix, Identigene, Karmagenes, Living DNA, MapMyGenome, MyHeritage, Pathway Genomics

Request for discount @ https://www.decresearch.com/request-discount/3033

What are the key takeaways of this report?

A well-detailed evaluation of the pricing trends has been given in the report, pertaining to the product, application, as well as regional landscapes

A well-detailed analysis of the vendor matrix alongside the important companies that will help to better understand the competitive scenario in the global market

Important insights pertaining to the regulatory spectrum surrounding the industry, along with the investments by many shareholders in the global market

A significantly deep evaluation of the many parameters propelling the overall market growth in combination with their influence on the projection as well as dynamics of the global market

A detailed understanding of the numerous available growth opportunities in the global industry

An extensive evaluation of the various trends prevailing in the global business space

See original here:
Direct-to-Consumer (DTC) Genetic Testing Market: Overview and Share Forecasted t - GroundAlerts.com

Recommendation and review posted by Bethany Smith

As the end of the 2020 legislative session nears, the Florida House and Senate need to resolve key health-care policy and budget issues. Here are seven big issues to watch:

Why its in play Persistence. Oliva, R-Miami Lakes, never faltered in his push for independent practice. Its one of the few issues Oliva didnt get passed in 2019, and he is determined to get it done this year.

Why its in play This is one of a number of proposals that Oliva has championed during his tenure as House speaker, maintaining they will help lower health-care costs for the uninsured and keep people out of emergency rooms. Oliva has opposed expanding Medicaid coverage for uninsured people.

Why its in play Galvano told reporters in December that he has a real heart for this population.

Why its in play The genetic testing issue has been a priority of incoming House Speaker Chris Sprowls, a Palm Harbor Republican who is a cancer survivor. Its unusual for incoming House speakers to file bills; they usually have other members to take on that task.

Why its in play This could be a take-home issue for Senate Appropriations Chairman Rob Bradley, a Fleming Island Republican who faces term limits this year. Bradley last year was successful at chipping away at the amount of supplemental hospital payments and wants more this year.

Why its in play The changes would help Lighthouse Health Plan in the Panhandle, Vivida Health in Southwest Florida and Miami Childrens Health Plan in Southeast Florida, which are provider-sponsored networks that signed five-year contracts with the state in 2018. AHCAs current policy, the provider-sponsored networks argue, impedes their expansion in the market and benefits legacy managed-care plans.

Excerpt from:
Beyond coronavirus: The seven biggest healthcare issues to watch in Florida right now - Orlando Weekly

Recommendation and review posted by Bethany Smith

MENLO PARK, Calif., March 10, 2020 /PRNewswire/ --BillionToOne, Inc., the precision diagnostics company that invented the patent-pending QCT molecular counter platform, announced today that it has closed its follow-on Series A+ funding round of$15 millionwith select global investors. Previous investors, Hummingbird Ventures and NeoTribe Ventures led the investment round with participation from Y Combinator, Libertus Capital, Pacific 8 Ventures, Civilization Ventures, 500 Startups Istanbul, and HOF Capital. This brings the total funding that BillionToOne has raised to more than $32.5 million. The funding will be used to support the commercial expansion of UNITY to all US states as well as the research and development (R&D) of future diagnostics tests including liquid biopsy products.

"Since the launch of UNITY last summer, we faced a significant demand from the prenatal providers from community Ob/Gyns to top academic institutions throughout the US. We are planning to expand the capacity of our CLIA-licensed laboratory by more than 20x and our commercial team size up to 50 account executives to meet the demand," said Oguzhan Atay, Ph.D., co-founder and CEO of BillionToOne. "This additional funding will help us accelerate this expansion process."

Current non-invasive prenatal tests (NIPTs) exclude single-gene inherited disorders like cystic fibrosis and spinal muscular atrophy because they can only detect large chromosomal abnormalities greater than one million base-pairs. Similarly, in today's liquid biopsy tests, certain cancer mutations, such asHER2, one of the most important genes for breast cancer, may need to be as high as 20 percent of the total cell-free DNA of a blood sample to be detected. BillionToOne's platform can quantitatively measure and determine these mutations at much lower levels.

"We are delighted with the surging demand in the market for UNITY. With additional novel clinical products in the pipeline, we are more confident than ever for the future growth of BillionToOne," saidFirat IleriofEurope-based Hummingbird Ventures. "We continue to believe that BillionToOne's sequencing platform is the future of cell-free DNA-based molecular testing." Kittu Kolluri, ex-NEA general partner and the current managing director at Neotribe Ventures, added, "BillionToOne's ability to execute on both R&D and commercial growth has been remarkable. We are pleased to continue to support this growth."

Cell-free DNA testing is the fastest growing diagnostic sector in history. It is currently used in several health care settings, including prenatal genetic testing for chromosomal abnormalities and oncology for blood-based tumor profiling in late-stage cancers.

BillionToOne's first product, UNITY is the first and only prenatal screen that directly assesses the baby's risk for common and severe inherited disorders such as cystic fibrosis, spinal muscular atrophy (SMA), and hemoglobinopathies from a single tube of blood from the pregnant mother. With all other existing carrier screening tests, both mother and father have to be tested for their carrier status to assess the baby's risk for these conditions. The need to test the father poses a significant challenge to many clinics to follow through for financial and logistical reasons, such as unavailability of Medicaid for paternal testing, availability of the father, non-paternity, and other logistical challenges. According to a 2019 publication by UTHealth Genetic Counseling group[1], only 41.5% of male partners could be tested for carrier status when mothers were found to be carriers. This means the "detection rate, i.e., sensitivity, of at-risk babies through the current screening workflow is at most 41.5%."

Screening for cystic fibrosis, spinal muscular atrophy, and hemoglobinopathies is recommended by The American College of Obstetricians and Gynecologists (ACOG) to be offered to all women considering pregnancy or currently pregnant[2]. By eliminating the need for father's testing and directly assessing the baby's risk, UNITY increases the detection rate of at-risk babies from <41.5% to as high as 98.5%, thus significantly improving the clinical outcomes[3].

UNITY is available for commercial order in all US States except for New York State, as well as globally in select international countries. For more information visit unityscreen.com.

CONTACTS:

Oscar Cabot, Head of Marketing ocabot@billiotoone.com

Shan Riku, VP of Product, sriku@billiontoone.com

About BillionToOne

BillionToOne, headquartered in Menlo Park, California, is a precision diagnostics company with a mission to make molecular diagnostics more accurate, efficient, and accessible for all. The company's patent-pending QCT molecular counter platform is the only technology platform that can accurately count DNA molecules to the single-count level. BillionToOne's first product, UNITY, is the first and only noninvasive prenatal screening that tests fetal cell-free DNA for cystic fibrosis (CF) and spinal muscular atrophy (SMA) through a single sample of the mother's blood. BillionToOne was co-founded by Oguzhan Atay, Ph.D., and David Tsao, Ph.D. For more information, visit http://www.billiontoone.com or http://www.unityscreen.com.

[1] Choates et.al., "It takes two: uptake of carrier screening among male reproductive partners" Prenatal Diagnosis, 2019; 1-6

[2] ACOG Committee Opinion Number 691, March 2017 (reaffirmed 2019)

[3] Tsaoet.al., "A novel high-throughput molecular counting method with single base-pair resolution enables accurate single-gene NIPT" Scientific Reports 9, 14382 (2019)

[4]Westinet.al., "Clinical validity of single-gene non-invasive prenatal testing for sickle cell disease and beta-thalassemia." (manuscript in preparation)

Related Files

nature_publication (1).pdf

Related Images

billiontoone-inc-www-billiontoone.jpg BillionToOne, Inc - http://www.billiontoone.com

Related Links

Unity Screen

BillionToOne, Inc

View original content to download multimedia:http://www.prnewswire.com/news-releases/billiontoone-inc-announced-today-that-it-has-closed-its-follow-on-series-a-funding-round-of-15-million-301020957.html

SOURCE BillionToOne, Inc

Read more from the original source:
BillionToOne, Inc., announced today that it has closed its follow-on Series A+ funding round of $15 million - P&T Community

Recommendation and review posted by Bethany Smith

The landscape of the consumer genomics market now would have been barely recognizable a decade ago. One study by scholar Andelka Phillips, then at the University of Oxford, found that as of January 2016, at least 246 genetics testing companies across the globe were selling their wares directly to customers online.

What is a consumer to believe? A few years ago, Helix, originally a spin-out of genomics giant Illumina (which makes many of the chips and machines used to analyze DNA), unveiled a DNA app store allowing third-party companies to sell products off its DNA testing. While these included the Mayo Clinic GeneGuide, a test that requires the sign-off of a physician and, with the help of Mayo Clinic professionals, interprets your genetic material for insights into things like disease risk and carrier screening, they also included the Vinome wine explorer, which claimed your genetic data could help predict what wine youd like, a concept that University of North Carolina geneticist Jim Evans described to the publication STAT as completely silly. Helix has since announced a shift away from this consumer-initiated model, but there is still a lot of confusion over what genetic testing can and should be able to tell us.

Read the original post

Excerpt from:
Online DNA tests: How can we sort the rubbish from the real science? - Genetic Literacy Project

Recommendation and review posted by Bethany Smith

Researchers in the United Kingdom have confirmed that a stem cell transplant has cured a second person of HIV.

In 2007, Timothy Ray Brown became the first person ever whom doctors declared to be cured of HIV. At the time, they referred to him publicly as the Berlin patient.

His journey toward a cure was not straightforward. After having received an HIV diagnosis in the 1990s, Mr. Brown received antiretroviral treatment the usual course of action for an HIV infection.

However, later on, he also received a diagnosis of acute myeloid leukemia, for which he eventually required a stem cell transplant.

As he was looking for a suitable donor match, his doctor had the idea to try an experiment. He looked for a donor with a specific genetic mutation that made them practically immune to HIV.

Receiving stem cells from this donor, it turned out, not only treated Mr. Browns leukemia but also cured the HIV infection.

Now, as a study featuring in The Lancet shows, another person has officially been cured of HIV, also thanks to a stem cell transplant.

In this second case, the person received a stem cell transplant with cells that did not express the CCR5 gene, which produces a protein that helps the virus enter cells.

The cells without the CCR5 gene were part of a bone marrow transplant, which the person was undergoing as a treatment for Hodgkin lymphoma.

Following the transplant, and at 30 months after the person ceased antiretroviral therapy, doctors confirmed that the HIV viral load remained undetectable in blood samples.

This finding means that whatever traces of the viruss genetic material might still be in the system, they are so-called fossil traces, meaning that they cannot lead to further replication of the virus.

The specialists confirmed that HIV also remained undetectable in samples of cerebrospinal fluid, semen, intestinal tissue, and lymphoid tissue.

We propose that these results represent the second ever case of a patient to be cured of HIV, says the studys lead author, Prof. Ravindra Kumar Gupta, from the University of Cambridge in the U.K.

Our findings show that the success of stem cell transplantation as a cure for HIV, first reported 9 years ago in the Berlin patient, can be replicated.

Prof. Ravindra Kumar Gupta

However, Prof. Gupta emphasizes that [i]t is important to note that this curative treatment is high risk and only used as a last resort for patients with HIV who also have life threatening hematological [blood] malignancies.

Therefore, this is not a treatment that would be offered widely to patients with HIV who are on successful antiretroviral treatment, the researcher goes on to caution.

Commenting on these findings, other researchers involved in the study express the hope that, in the future, scientists may be able to use state-of-the-art gene editing tools as part of interventions meant to treat and cure HIV.

Dr. Dimitra Peppa, who is from the University of Oxford in the U.K. and co-authored the study, notes that [g]ene editing using the CCR5 has received a lot of attention recently.

Nevertheless, she points out, there is still a long way to go before such therapies may become viable.

There are still many ethical and technical barriers e.g., gene editing, efficiency, and robust safety data to overcome before any approach using CCR5 gene editing can be considered as a scalable cure strategy for HIV, she says.

Visit link:
2nd person cured of HIV thanks to stem cell transplant - Medical News Today

Recommendation and review posted by Bethany Smith

Year after year for two decades, Nancy Wexler led medical teams into remote villages in Venezuela, where huge extended families lived in stilt houses on Lake Maracaibo and for generations, had suffered from a terrible hereditary disease that causes brain degeneration, disability and death.

Neighbors shunned the sick, fearing they were contagious.

Doctors wouldnt treat them, Dr. Wexler said. Priests wouldnt touch them.

She began to think of the villagers as her family, and started a clinic to care for them.

They are so gracious, so kind, so loving, she said.

Over time, Dr. Wexler coaxed elite scientists to collaborate rather than compete to find the cause of the disorder, Huntingtons disease, and she raised millions of dollars for research.

Her work led to the discovery in 1993 of the gene that causes Huntingtons, to the identification of other genes that may have moderating effects and, at long last, to experimental treatments that have begun to show promise.

Now, at 74, Dr. Wexler is facing a painful and daunting task that she had long postponed. She has decided its time to acknowledge publicly that she has the disease shes spent her life studying and that killed her mother, uncles and grandfather.

There is such stigma, and such ostracization, Dr. Wexler, a professor of neuropsychology at the College of Physicians and Surgeons at Columbia University, said in a lengthy interview. I think its important to destigmatize Huntingtons and make it not as scary. Of course it is scary. Having a fatal disease is scary and I dont want to trivialize that. But if I can say, Im not stopping my life, Im going to work, were still trying to find a cure, that would help. If I can do anything to take the onus off having this thing, I want to do it.

Among her greatest concerns are the thousands of Venezuelans from the families full of the disease, whose willingness to donate blood and skin samples, and the brains of deceased relatives, made it possible to find the gene. But they live in an impoverished region, and, Dr. Wexler said, they are still outcasts. The clinic that she and her colleagues opened has been shut down by Venezuelas government.

We share DNA, Dr. Wexler said. Theyre part of my family. They are super-stigmatized. So I thought, this is part of my decision to come out, about me which I still find hard to do without breaking into tears.

If treatments now being tested do pan out, she said in an editorial in The New England Journal of Medicine, the Venezuelan patients should get them, for free.

Shes a remarkable human being whos been an incredible leader of a scientific initiative, said Dr. Francis Collins, director of the National Institutes of Health, who was among those she recruited to help find the Huntingtons gene.

Although Dr. Wexler has not talked about her diagnosis until now, it is no surprise to friends or colleagues. For at least a decade, her symptoms were noticeable. Her gait is unsteady, her speech is sometimes slurred, her head and limbs move uncontrollably at times. She loses her temper. She needs a walker to get around outside the Manhattan apartment she shares with Dr. Herbert Pardes.

But her mind is sharp and her will is strong, and she has chosen to deal with the disease or not deal with it on her own terms and in her own good time.

Weve been close friends for 37 years and it has been very hard to not have this as a topic we can share, Dr. Collins said. But shes a private person, and I think we all understood she was not ready to go there.

Part of her coming out includes appearing in a new documentary film, The Gene, produced by Ken Burns and Barak Goodman, to air on PBS this spring. Film shot later, not part of the documentary, shows her exuberantly touring a facility that makes an experimental drug being developed by Roche that she is hoping will work and become available in time to help her. The studies she led made development of the drug possible, but she is too old to qualify for the clinical trials testing it. Results are not expected until 2022.

In the film, a researcher shows her a vial of the drug. She kisses the vial and hugs the researcher. Thats my disease there, she says. Youre curing it!

The specter of the disease has been hanging over Dr. Wexler since 1968, when she was 22. One morning, a police officer accused her mother, Leonore, of being drunk as she crossed a street in Los Angeles on the way to jury duty. She had not realized she was staggering.

Leonore Wexlers father and all three of her brothers had died from Huntingtons. She was a geneticist, a field she had chosen in hopes of finding a way to save her brothers, Dr. Wexler said.

Huntingtons is caused by a dominant gene: If one parent has the disease, every child has a 50/50 chance of having it, too. The disease is rare. About 30,000 people in the United States have it, and another 200,000 are at risk. It is the disease that killed the folk singer Woody Guthrie in 1967.

At the time of Leonores diagnosis, there was no test for the gene. People who knew they were at risk could only wait to see whether they fell ill. The symptoms usually appear when patients are in their 30s or 40s after theyve already had children. Leonore was 53 at her diagnosis, past the average.

Depression, irritability and other psychological problems can occur, along with the uncontrolled movements. Patients lose the ability to speak, but remain painfully aware of their decline.

After Leonores diagnosis, her ex-husband, Milton Wexler, told their daughters, Nancy and her older sister, Alice, about the disease and that they were at risk of getting it, too. Despite the odds, he insisted that they would be spared.

But looking back at that day, Dr. Wexler said she felt that, in an instant, three generations had been wiped out: Her mother, herself and the children she had hoped to have. She and her sister decided that they would not have children. To this day, Dr. Wexler said it is a decision that she very much regrets.

Determined to find a cause and cure, or at least a treatment, Milton Wexler started the Hereditary Disease Foundation to raise money and recruit researchers. Nancy, who received a doctorate in psychology, nonetheless decided to devote her career to Huntingtons and its genetics.

Leonore Wexlers condition worsened. She tried to commit suicide, but Milton Wexler saved her by calling an ambulance. Dr. Wexler said she thought her father later regretted that decision, because her mother suffered for years afterward, in nursing homes.

As she became increasingly ill, I dressed her, carried her, helped her brush her teeth and go to the bathroom, fed her and, mostly, held her and kissed her, Dr. Wexler wrote in an essay published in 1991. Her eyes still haunt me with their sadness and fear.

Leonore Wexler died on Mothers Day in 1978, 10 years after the diagnosis.

The following year, Nancy Wexler made her first trip to Venezuela to study a large extended family, first described in 1955 by a Venezuelan doctor, Americo Negrette. The family was thought to have the worlds highest prevalence of Huntingtons disease. She knew that to find the gene, scientists would need DNA samples from as many affected people and their healthy relatives as possible.

The scientists, arriving by boat, found patients everywhere, some of them children, with the classic writhing and flailing signs of the disease, which was known locally as el mal.

Dr. Wexler told them that she and they were related, that her family had the disease, too. She showed them a tiny scar on her arm where shed had a skin sample taken, as she was asking them to do.

I fell in love with them, she said.

For 20 years, she returned with teams that ultimately collected 4,000 blood samples. They traced the path of the disease through 10 generations in a family tree that included more than 18,000 people.

Working with Nancy in Venezuela was a real testament to how an individual can take a team and get absolutely water out of a brick, said Dr. Anne B. Young, a professor and former chief of neurology at the Massachusetts General Hospital, who made 22 trips to Venezuela with Dr. Wexler. She was able to take all of us and drive us, 16 hour days out in the field where it was 96 degrees and 90 percent humidity.

Dr. Wexler was a powerful presence.

She was just totally charismatic, and when you walked into the room she would hug you and look you in the eye and listen to everything you said, Dr. Young said. She never thought about herself. She was always thinking about what she could learn from the other person. People just became totally devoted to her. Everybody felt theyd take a bullet for her.

In 1983, just four years after the first trip, the team found a marker, a stretch of DNA that was not the gene itself but nearby. It took a half dozen high-powered research groups handpicked by Dr. Wexler and her father 10 more years to find the gene itself, on chromosome 4, one of the 23 pairs of chromosomes found in most cells in the body.

The discovery was a landmark in genetics, one that scientists say would never have happened without Dr. Wexler.

Biomedical research wasnt a team sport in the 1980s, not until Nancy got involved, and then it had to be, Dr. Collins said.

Dr. Wexler and her father were relentless, he said, by insisting the research groups work together.

Each group was driven by a strong-egoed principal investigator, Dr. Collins said. You can imagine things didnt always go smoothly. But there was no way you could go to Nancy and say, I cant work with this person.

Milton Wexler had been a psychotherapist to the stars, and tapped some of his celebrity clients to help his cause.

During the annual meetings in Santa Monica, there might be a dinner at Julie Andrews house or Carol Burnetts house, Dr. Collins said. We were all starry-eyed. It was quite a perk for us nerds.

Dr. Wexler brought people with Huntingtons and their family members to the research meetings, to describe what life was like with the disease. Many of the scientists had never seen Huntingtons up close.

You couldnt listen to that as a researcher and not be impressed by the seriousness of the task, Dr. Collins said. This was not some academic exercise.

Concern for Dr. Wexler herself also drove the teams.

We knew the clock was ticking for her and for Alice, Dr. Collins said. It was a matter of watching Nancy all the time and wondering if shes escaped the curse or is it going to fall on her, too.

The gene contains the blueprint for a protein that the researchers named Huntingtin. Its role in the brain is not understood. But in people with the disease, a series of three DNA building blocks represented by the letters CAG is repeated too many times. The repeats lead to an abnormal form of Huntingtin, which poisons nerve cells in the brain.

Finding the gene made it possible to develop a test that could tell people at risk whether they would develop the disease. The discovery posed a wrenching ethical and emotional quandary that persists to this day.

Do people really want to know that a disabling and fatal disease lies in wait for them, when there is no cure, not even a treatment that can slow it down?

Researchers feared that the information would make people hopeless and depressed, and even drive some to suicide.

A breakthrough therapy, making testing worthwhile so that treatment could start early to head off the disease, has yet to arrive.

Given her drive for knowledge, many people assumed that Dr. Wexler would be among the first to take the test. But she never did. Nor has her sister.

I dont think I could have lived with that knowledge, Dr. Wexler said. I think I assumed I wouldnt get it, because I was fine.

It was easier to live with ambiguity, she said, adding, Denial is important.

As she moved through middle age, she felt all eyes were on her and resented it.

Everybody watched me like a hawk, she said.

Gradually, the symptoms appeared. She became aware of them only when she saw herself on video or even in the mirror, and would think, Oh gee, why am I moving? There was no single moment of realization; there were many. It is not uncommon for people to recognize they have the disease only when they see photos or videos of themselves, Dr. Young said.

Every time I saw myself on video, I looked a little bit worse, Dr. Wexler said.

Others noticed the movements, the spilled drinks, the wobbly handwriting.

I love her so much that I had trouble convincing myself that she had it, said Dr. Young, who is an expert on the disease. I would try to make it go away in my mind. And I think a lot of people did.

But some colleagues bluntly asked Dr. Wexler if she had the disease. A few went so far as to tell her she did. She would say she did not, only to be told that denial was a symptom. If she happened to cross her legs, some accused her of trying to hide tremors. She found it infuriating.

Dr. Pardes warned the meddlers to back off. People learned to avoid the subject.

It was always the big elephant in the room, Dr. Young said. It made everything uncomfortable for all her best friends, who just withdraw a little bit because they dont want to hurt her.

Her sister encouraged her to open up.

I think that one thing her coming out about it will show is that getting a diagnosis of Huntingtons disease is not a death sentence, Alice Wexler said. Its something people can live with for a long time, if they have the right medical care and social services. She has been living her life in a productive way, and still will.

And so she is, reviewing grant applications, raising money for research and attending scientific conferences. Dr. Wexler holds out hope for the work on new drugs. There is still much to be learned, she says, and she still has a great deal of work to do.

Enjoy life while you can, she advises. Find what gives you some pleasure and go for it. Dont get kidnapped by this.

See original here:
Haunted by a Gene - The New York Times

Recommendation and review posted by Bethany Smith

Swept up in a pancreatic cancer diagnosis is inevitably a sense of fear and sadness.

But at Penn, researchers are bringing new hope to this disease. And with patients like Nick Pifani, its clear that theyre moving in the right direction.

Pifani, from Delran, New Jersey, first noticed some lingering stomach upset in February 2017. He called his family doctor, concernedespecially given that he was an otherwise healthy marathon runner who was only 42. He was sent to a gastrointestinal specialist. A few weeks later, some crippling stomach pain sent him back to the emergency room and he received an MRI that showed a mass on his pancreasStage Three, inoperable, he was told.

He was treated with chemotherapy, along with radiation and, eventually, and after receiving advice from doctors at Penn, his tumor was removed. Thereafter, he realized he had a PALB2 mutationa cousin of the BRCA gene mutation. At that moment, his long-term needs changed and he found himself seeking specialized care at Penn, where he met Kim Reiss Binder, assistant professor of medicine at the Hospital of the University of Pennsylvania (HUP).

Im a planner; I want to understand what [my] potential options are, Pifani says. [Reiss Binder] asked why I was there to see her and I explained and quickly I could tell she wasoutside of her being remarkably intelligenta great listener and a compassionate doctor.

I have a feeling she worries about me more than I do, he laughs.

Pifani has now been in remission for two years and four months; he sees Reiss-Binder every three months for checkups. His survival story is inspiring and a sign of momentum, even if a world without pancreatic cancer is still frustratingly out of reach.

Pancreatic cancer is the third-leading cause of cancer-related death in the United States, outmatched only by lung cancer (No. 1) and colorectal cancer (No. 2). A person diagnosed with pancreatic cancer is still unlikely to survive past five yearsonly 9%of survivors do, giving it the highest mortality rate among every major cancer.

In short, pancreatic cancer seldom paves the way for optimistic narratives. Some of the hope that has surfaced, though, is thanks to some talent, dedication to the cause, and hard work at Penn.

A key point of progress in the battle against the disease was made in 2002, when former Assistant Professor of Medicine David Tuveson established a standard model for examining human development of this disease in mice. This model has allowed for a reliable way to study the disease and has influenced progress made here at Penn and elsewhere since.

Theres been a burst of activity in translational research, from bench to bedside, explains Ben Stanger, the Hanna Wise Professor in cancer research and director of the Penn Pancreatic Cancer Research Center (PCRC) at the Abramson Cancer Center.

And theres a lot of momentum with community building, a dramatic increase in patient volumes, and a dramatic increase in what we know about the cancer, he says of the status of pancreatic cancer today.

Reiss Binder, meanwhile, explains that one mark of progress at Penn and beyond has been learning about people like Pifani, who have the PALB2 gene, and why they respond differently to treatments than those without it. Platinum-based chemotherapies, for example, are especially effective for people with the PALB2 gene who are battling pancreatic cancer. An ongoing trial at Penn has tested and found some success with using PARP inhibitorstaken orally as an enzyme that fixes single-stranded breaks of DNAas a maintenance therapy in that same PALB2 demographic after theyve had chemotherapy. These are less toxic than chemotherapy for patients with the same mutations.

Its all been slow progress toward better treatments, but there has been progress.

This is the tip of the iceberg for a disease that we historically have treated with perpetual chemotherapy,Reiss Binder says. We owe it to patients to find better options to suppress the cancer but not ruin their quality of life.

The consensus on why pancreatic cancer is so deadly? It just cant be spotted fast enough.

Pancreatic cancer often presents well after it has developed and metastasized, and does so in a way that is not easy to recognize as cancer. Common symptoms include, for example, stomach upset and back pain. And by the time a harder-to-ignore symptom of the cancer surfaces, a sort of yellowing of the skin (a result of a bile duct blockage), its likely too late to stop the cancer in its tracks.

One approach to improved detection being tested at Penn, by Research Assistant Professor of Medicine Erica Carpenter, is a liquid biopsydrawn from a standard blood test. Current means to test for pancreatic cancerimaging through an endoscopic tubeare invasive and expensive, meaning a common liquid test could transform how many cases are detected early.

Carpenter explains that circulating tumor cells (CTCs) can shed from a tumor thats adjacent to the wall of a blood vessel; whats shed then shows up in a blood test. The cells, if detected, can explain more about the nature of the tumor, giving doctors an opportunity to examine characteristics of cancerous cells and decide how to effectively treat a tumor if it cant be surgically removed. It also allows interpretations of disease burden and the effectiveness of medicationsthrough genome sequencingthat imaging does not.

Ultimately, this gives doctors the potential to track the growth of a tumor before its fully developed, all through one tube of blooddetected through an innovative use of technology.

David Issadore, associate professor of bioengineering and electrical and systems engineering in the School of Engineering and Applied Science, has worked since 2017 to develop a chip that detects cancer in the blood, using machine learning to sort through literally hundreds of billions of vesicles and cells, looking for these CTCs. The chip retrieves data and the machine learning developed interprets that data, attempting to make a diagnosis that not only finds pancreatic cancer but also provides information about its progressionand, importantly, whether a patient might benefit from surgery.

Right now, that test has a 24-hour turnaround, he says, but could eventually advance to having a one-hour turnaround. That would be a remarkable mark of progress for discovering the disease earlier when the chip enters a commercial stage.

Pancreatic cancer is a tough disease, and catching it early is hard, Issadore acknowledges. So, we think optimistically but also very cautiously, knowing what a challenging disease its been to make progress on, which is what drew us to the disease in the first place.

Im not an oncologist, he adds, but Im a bioengineer, and people like us who have a different perspective, the hope is we can do something truly [novel] to shift the [state of the disease].

He would eventually like to test the chip in people with other types of cancers, like lung, bladder, and liver.

For now, Penn still uses imaging as the standard of care but Carpenter is confident that blood testing is where were heading, starting with at-risk patients with diabetes and other risk factors.

The most important thing with this would be that when you put a patient on therapy, its good to know as early as possible how likely it is theyre going to respond, she explains. Tumor markers are increasingly valuable because you can avoid toxicity of the therapy, the expense of it, and most importantly you then have the opportunity to put the patient on something that might have more of an effect for them.

The challenge, she adds, is in pancreatic cancer we dont have that many effective therapies.

Another challenge, she adds, is to find the presence of exosomes, small pieces of tumor cells released into the blood stream, which she says are found in abundance among people with pancreatic cancer and could particularly be targeted among people living with diabetes or an intraductal papillary mucinous neoplasm (IPMN). So, at-risk candidates who may not present with the disease currently but are at risk. Several clinical studies and trials are currently taking place at Penn evaluating this.

A related area of interest is determining if people with diabetes, in particular, are developing cancer as part of the diabetes, or developing diabetes from the cancer. Risk factorsdiabetes, genetic markers, etc.continue to be an important area of study with pancreatic cancer.

Immunotherapy is rapidly changing the way patients are treated. And interest in immunotherapy for pancreatic cancer is growing exponentially.

But, its complicated.

We are still learning about the immune system in pancreatic cancer, explains Gregory Beatty, assistant professor of medicine and director of the Pancreatic Cancer Clinical Trials Program within the PCRC.

On one hand, we know that inflammation in the pancreas is a driver of pancreatic cancer. But we also know that T cells in the immune system can attack pancreatic cancer, he says.

The challenge that has surfaced is that T cells in patients living with pancreatic cancer are often weakened or slowed down; they dont divide or proliferate very well; and they have a hard time finding the cancer. That makes harnessing them for therapy a challenge. One idea, though, is to engineer ones own T cells (as inCAR T therapy), while theyre still healthy, to detect and kill pancreatic cancer cells.

Penn recently completed a trial in ovarian cancer, mesothelioma, and pancreatic cancer, using CAR T cells engineered to recognize a protein called mesothelin, which is expressed by pancreatic cancer. The team found that the T cells, when injected into the blood of patients, were safe but had limited activity.

These CAR T cells can kill pancreatic cancer in the lab really well. But why they dont do so in patients still remains a mystery, Beatty says.

It does prove that pancreatic cancer evades the immune system extraordinarily well.

Penn investigators have also done work on CD40, a protein expressed in a wide range of immune cells, explains Robert H. Vonderheide, director of the Abramson Cancer Center, who has been working with Mark O'Hara, an assistant professor of Hematology-Oncology, on CD40 therapeutics. Patients are responding to treatment with CD40a protein that activates T cells to work more steadfastly and seek out cancer cells.

It seems to make chemo work better, Beatty explains.

This is a very promising treatment for convincing the immune system to attack pancreatic cancer, Beatty adds, And in the lab, we are finding ways to make it work even better.

The larger idea is to build on a backbone of chemo and CD40 in the future to help coax T cells to work better. Overall, a major thrust of treatment for patients at the PCRC is focused on unraveling ways to use immunotherapy while developing the next-generation of strategies for patients with BRCA 1 and 2 genes who are receiving PARP inhibitors.

The stress of a pancreatic cancer diagnosis can be dizzying. It is, says Pancreatic Nurse Navigator Trish Gambino, a cause to act fast.

We really believe pancreas cancer is a medical emergency much like a heart attack, she says. As a nurse navigator, I try to get newly diagnosed patients with pancreatic cancer expeditiously to the correct provider for staging and treatment.

Because of that, she says, patients are often still digesting their diagnosis while also juggling appointments, choosing a doctor, making decisions about care, settling personal matters, and communicating with insurance companies. Gambino, one of eight nurse navigators hired to put organization and compassion on the frontlines, takes multiple incoming callsas many as fiveper day from people who have been diagnosed and sound shell-shocked.

I get so many of these calls per week saying, Trish, I just went to the doctor and they told me I have a pancreatic mass on my CAT scan. And I dont know what to do, she says. A lot of times patients dont know what they need.

Her job is one of compassion but also pragmatism. She listens and places their concerns in context and individualizes her approach to moving patients in the right direction, laying out all the options and giving them a sense of order and control over their narrative.

It really does take a village to try to get people through this, Gambino explains, noting how overwhelming the cancer experience can be. When you have pancreas cancer, its not just the medical oncologist, the radiation oncologist, the surgeon, the dietician, the social worker, the nurse navigator, the infusion nurses, the nurse practitionerstheyre all there and the response is often Who is everybody? They need someone who can lead the team for them.

She says that Penn is especially well-regarded for its interdisciplinary teamseven factoring in diet and financial wellnessand their ability to act swiftly. Penn, for instance, performs more than 150 pancreatic cancer surgeries per year and is practiced at itnot typical of every hospital and a draw for newly diagnosed patients who are eligible for resection.

Looking ahead, Stanger is optimistic about advances in screening and immunotherapy treatmentparticularly research funded by the Parker Institute for Cancer Immunotherapy, started by Sean Parker, a cofounder of Facebook. Penn is one of 10 sites of major investment for research and was the impetus for the investment in pancreatic cancer.

Hes also encouraged that the research community surrounding pancreatic cancer is collaborative, he says, with many doctors recognizing the enormous challenge of the disease and working together well.

Celebrity diagnoses, like that of Alex Trebek, als0lend some hope in the messaging of how the disease is presented to the world today.

I talk to people almost every day, and when we talk about pancreatic cancer they say, Oh, thats a really bad one, he says. One thing I respect about Alex is he came out and was very forthcoming and he spoke with a great deal of confidence and hope in the medical community and gave a positive message that said, Im going to do my best to beat this.

Pifani, meanwhile, more than two years out from his surgery, is feeling optimistic. Hes mostly resumed a normal lifewith occasional side effects that linger, of course, and scans every six months. He runs marathons and spends time with his wife and kids. And, a member of the Survivor Council at the Pancreatic Cancer Action Network and sponsorship chair for the Philadelphia affiliate, he shows up to community events built around raising awareness of the disease and advocating research and caregiver support.

At Penn, he says, he feels like hes in the right place with his carethat hes in the best hands if something does happen, and recognizing the diseases ongoing presence in his life.

I got a long way to go, he says, but were off to a good start.

Homepage photo: Gregory Beatty, assistant professor of medicine and director of the Pancreatic Cancer Clinical Trials Program within the Penn Pancreatic Cancer Research Center, examines a blood sample.

Read more:
Penn is fighting pancreatic cancer - Penn: Office of University Communications

Recommendation and review posted by Bethany Smith

Deep Tech is a new subscriber-only podcast that brings alive the people and ideas in our print magazine. Episodes will be released every two weeks. Were making the first four installments, built around our 10 Breakthrough Technologies issue, available for free.

Three-year-old Ipek Kuzu has an extremely rare genetic mutation that disrupts a protein needed for DNA repair, causing the loss of brain cells. Now shes become only the second person in the world to receive a customized antisense oligonucleotide drug designed to compensate for the DNA mistake by allowing her cells to splice together a functional version of the protein. The drug took Boston-based pediatrician and geneticist Tim Yu only months to create, heralding a new era of individualized genomic medicine. But it cost $2 million to manufacture and testleading to questions about how soon hyper-personalized treatments for rare genetic disorders can be made accessible and affordable. Journalist Erika Check Hayden got to know the Kuzu family, and in this episode she chronicles Ipeks journey, with help from Ipeks father Mehmet and Technology Review biomedicine editor Antonio Regalado.

Show notes and links:

If DNA is like software, can we just fix the code?, from the March/April 2020 print issue, p. 46

Hyper-personalized medicine, from the March/April 2020 print issue, p. 18

Sign up for The Download your daily dose of what's up in emerging technology

Two sick children and a $1.5 million bill: One family's race for a gene therapy cure, from the November/December 2018 print issue, October 23, 2018

Episode Transcript

Audio ID: This is MIT Technology Review.

Mehmet Kuzu: Around five to six months, they said she has something called ataxia telangectasia. And they said this doesnt have any cure. The initial days were very tough. We were crying all the time. So then after a while, we started investigating what can be done.

Wade Roush: Mehmet Kuzus three-year-old daughter, Ipek, has a rare genetic mutation that could end her life by age 25. But now shes getting a so-called antisense drug that her doctors engineered specifically for her. Which makes Ipek one of the first patients being swept up in a new wave of hyperpersonalized medicine. Journalist Erika Check Hayden wrote about the Kuzu family in the latest issue of Technology Review. And today, she helps us understand where this breakthrough came from, and how soon it might be scaled up. Im Wade Roush, and this is Deep Tech.

[Theme music]

Were right at the beginning of a revolution in individualized genomic medicine. And if you want to know what that revolution sounds like, this is a good place to start.

[Sound of Illumina sequencing machines]

Thats one of the hundreds of high-speed gene sequencing machines at the Broad Institute of MIT and Harvard. Here at the Broads genomics platform in Cambridge there are so many of these machines that the institute can read the equivalent of 30 whole human genomes every 10 minutes.

There arent a lot of research centers with that kind of power. But in many places around the world its now possible to scan a babys full genome for just a few hundred dollars, and locate DNA coding errors that can cause rare conditions like ataxia telangectasia.

Thats how doctors diagnosed Ipek Kuzu when she was just six months old. The mistake in her DNA means her cells cant make a protein called ATM thats essential for DNA repair. Over the long run that causes the loss of brain cells, which means Ipek has some trouble walking and doesnt talk as much as a typical three-year-old.

Today Ipek is receiving an antisense drug made just for her. Its designed to compensate for the DNA mistake and restore production of ATM. Which makes her only the second person in the world to get this kind of treatment. The first was another little girl named Mila Makovec. She has different genetic disorder called Batten disease that causes blindness, seizures, and other neurodegenerative problems. And Mila got her own customized antisense drug starting in 2018.

But to understand how her doctors came up with these two medicines, and why this whole field of hyperpersonalized medicine is so hot that the editors of Technology Review decided to put it on this years list of 10 breakthrough technologies, we first have to jump back a few years, to 2016.

[CNBC Squawk Box news clip]

CNBC male anchor: Ionis Pharmaceuticals, in pre-market trading, is higher. The FDA has approved a drug called Spinraza. Spinraza.

CNBC female anchor: Its not Spine-raza?

CNBC male anchor: Maybe it is. Because its for spinal muscular atrophy. Its the first drug approved to treat the rare and fatal disease.

Wade Roush: Spinal muscular atrophy affects about 1 in 10,000 babies. So its not nearly as rare as Batten Disease or ataxia telangectasia. But Spinraza is literally the key to all of the more recent work to make customized antisense drugs for Mila and Ipek. So lets take a minute to go over how it works.

What made Spinraza a big deal is that it was one of the first successful medicines made using an antisense oligonucleotide. In other words, a customized strand of RNA.

Antonio Regalado: If you can imagine, inside a cell, there's the DNA.

Wade Roush: This is Antonio Regalado, the editor for biomedicine at Technology Review.

Antonio Regalado: And it kind of sends out these messages into the nucleus made of RNA and those are used as the templates to make proteins. And so antisense is a drug that acts at the level of RNA. They're going to stick to that RNA message and they could block it.

Wade Roush: Keep it from being translated.

Antonio Regalado: Keep it from being translated, or modify the translation in some fashion.

Wade Roush: In the cells of healthy people, theres a protein called SMN that helps motor neurons survive and grow. A gene called SMN1 carries the instructions for making that protein, and people with spinal muscular atrophy have a mutation that disables that gene. But it just so happens that human DNA also contains a second copy of the gene, called SMN2. This second copy is typically inactive, thanks to a small error that keeps the RNA message from being spliced together into a proper template. The Spinraza molecule contains a short segment of antisense RNA that prevents the splicing error. And that allows the body to start making the motor neuron protein.

Ionis Pharmaceuticals is the company that makes Spinraza, and they put a lot of work into figuring out how to get their molecule into cells in the brain and the nervous system, where it can do its work.

Antonio Regalado: And they finally mastered it and came up with pretty much kind of a miracle drug for one of these rare brain diseases that affects kids, spinal muscular atrophy. And so from that example, people then said, well, why can't we use antisense for other diseases that are similar?

And what we learned was that there was a doctor in Boston named Timothy Yu, who was an expert in sequencing genomes of sick children. And there was one girl named Mila Makovec. And her parents had come to him. He'd sequenced the genome. And then he just realized, I don't have to stop here. Once I've identified this defect, I don't have to stop. I could potentially make a drug. And so that's exactly what he did.

Wade Roush: It turned out that Milas disease was caused by a splicing error very similar to the one that causes spinal muscular atrophy, except that in Milas case it disrupts a different protein called CLN7. Tim Yus idea was to take the backbone of the Spinraza molecule and attach a customized strand of antisense RNA. With this new business end, so to speak, the drug would enable Milas cells to start making functional copies of the CLN7 protein.

Antonio Regalado: That was probably at that point just the clearest, starkest, most stunning example of this hyper personalized medicine. Because in this case, it was really for one person. So we were very interested in this phenomenon, because it's a reflection of what technology can do. And then in the middle of last year, a pretty prominent journalist, Erika Check Hayden, came to us and she was also interested and wanted to do some work to find the cases, find the families and write more stories about it. And as it developed, we decided, well, let's put this on our list of breakthrough technologies, because it really is. And so Erika ended up writing the piece and she did a lot of work to find the patients. One of the great things she did was to find this Kuzu family, which happens to be right here in Cambridge.

Wade Roush: Erika, could you introduce yourself and tell us a little bit about you?

Erika Check Hayden: Sure. My name is Erika Check Hayden. I'm a journalist based in San Francisco. And I also run the science communication program at the University of California, Santa Cruz.

Wade Roush: When you set out to start reporting this piece, did you feel like it was important to go beyond the first sort of headline-making case of Mila Makovec and look for additional patients who were going through this process to see how broadly applicable the whole idea is?

Erika Check Hayden: I do think that while people have been very impressed by Mila's case and by the drug that Tim Yu made for her, which is called milasen, I think there's also been this question of are we gonna be able to do this for other patients? And if so, you know, who is going to be treatable via this method? And so if I'm going out and finding other families that are hopefully replicating that success, I think is a really important statement about how impactful this approach might eventually be.

Wade Roush: So this is where the Kuzu family comes in. So could you tell us a little bit about them and how you got in touch with them?

Erika Check Hayden: So the Kuzu family, they originally came from Turkey and the father in the family, Mehmet Kuzu, is now a software engineer at Google. And they were living in Silicon Valley when their daughter Ipek was born. And soon after she was born, she was diagnosed with this disease called ataxia telangectasia, which is also called A-T disease. And when that happened, they set about trying to understand if there was anything they could do to treat the disease or slow the disease. And that's what led Mehmet down this path that eventually led him to work with Tim Yu.

Mehmet Kuzu: I sent the genetic report of our daughter. Then he said, oh, there's a potential here, but there are two main problems. He said this might cost around like two million, and the insurance will not cover it. The second problem, it might cause damage because, we have a theoretical idea, but biology is complicated. So at the end of the day, it might be worse than what is expected.

Wade Roush: Right. So for the Kuzu family, while it was obviously bad news that your kid is getting diagnosed with A-T disease, there is this amazing foundation or non-profit led by Brag Margus, the A-T Children's Project, that has all this data and also apparently has some fundraising clout. And they wind up helping to finance a lot of this research and even finance Ipeks treatment.

Erika Check Hayden: Right. And I think that's part of why this particular project was able to move so fast, because Brad Margus and the A-T Children's Project had done a lot of work over the years to fundraise and educate their community about the potential for treating this disease, so that when they found something that he actually thought could work, they were able to raise $1.4 million in a relatively short amount of time to fund the development of this unique drug.

Mehmet Kuzu: I think he understood to the promise of it. And then he agreed to financially support us. But the problem is this money in the pool is coming from many families. So we should have a fair selection. Then they found three kids that young in age, like three, two, two, three, four, with the right mutation type, and they got skin samples from all of them, and tested it. They were able to do it quickly.

Wade Roush: Mehmet can recount all these events pretty calmly. But I think its worth underscoring what a roller coaster the familys been on. The backing of the AT Childrens Project opened a window for Tim Yu to design and manufacture an antisense drug. But the required safety testing is so expensive that only there was only enough money to do that for one patient. There was a two in three chance that Ipek would not be that patient. And even if she did get selected, there was no way to know whether the treatment would be effective. Mila Makovec had been having fewer seizures since she started getting her antisense treatment, but doctors still werent 100 percent sure that it was because of the medicine. On top of all that, there was still the risk of unintended side effects.

Mehmet Kuzu: and then at the end of the day, Ipeks cells responded the best among these three candidates. Now, once we know we are selected, now we concentrate on second issue: do we really want to take this risk of, like, making things worse? And then I thought, like, most probably something good will happen. Of course there is a probability of, a possibility [of failure]. But imagine if that happens: science will learn from this. And her kind of sacrifice, and that would help, too, many other people.

Erika Check Hayden: It's been just incredible over the past few years to meet these families, understand what they're doing, how they're doing it. I've just been really struck by everything they've been able to accomplish. And also the mindset that they bring to this where, you know, you'll talk to, or I will talk to, parents who are doing this for their kids and they've had scientists tell them, 'You've got to be prepared for the possibility that this isn't going to help your kid. You know, you might be doing all of this work on behalf of some other future child. This might not come in time to help your own child.' And they persist and are really driven.

Wade Roush: Ok. So in the same way that Tim Yu helped to create this unique drug called milasen for Mila Makovec, he's created a drug called atipeksen for Ipek. If that drug if that drug works, how will it help Ipek?

Erika Check Hayden: If this drug works, basically what it's going to do is correct the way that Ipek's cells interpret her genetic information so that she will make a functioning copy of the ATM protein. Now, how we will know if this is working is a bit of a tricky question. So, Tim Yu and other doctors are going to try a variety of methods to see if they can tell whether the drug is actually helping her. So, for instance, they will look at things like can they see evidence in Ipek's body that the drug is actually making corrected versions of the protein? They will look for evidence that she isn't declining in the ways that we might expect her to if she wasn't getting treatment to help control her disease. But it might be tricky to tell whether it actually works or not.

Mehmet Kuzu: She had three injections until this point because they are starting with very low dose and escalating itAnd fortunately, we haven't seen any adverse effects in the first three. But like, of course, knowing if this is really working or not, they told us that it will take time. Maybe we need a year to understand if it's really working. But at least we have seen that no bad thing happened. At hospital she's going on the full anesthesia. They're putting on a mask. And after the injection they are taking bloods every four hours, three or four times. These are very stressful for her. She's fighting not to have this mask. She's crying a lot. Uh, but once discharge happens, once we come home, she forgets about everything. She just plays with her toys.

Wade Roush: Right. And this is one of the things you mentioned in your piece. Not only will it be tricky to see whether it's working or not, but we're talking about by definition an n of one study where there's only one patient. So you don't get the kinds of large numbers that help researchers feel more confident that a drug is safe and effective.

Erika Check Hayden: I think what we still don't know very well yet is which diseases are going to be helped most by this approach, or even if any of these individual customized treatments can cure a patient. So if you talk to Mila's mom, Julia Vitarello, she is very convinced that that drug has helped Mila. But I think accumulating that data to the level where we really know that this is a worthwhile approach, you know, that's probably going to take a while.

And to take a step back, I think that's part of the reason why these drugs are only being used right now in patients that have really severe progressive diseases, because you are taking a certain risk by giving a treatment to a patient when you haven't done the kinds of safety testing that we might be used to for a drug that would normally go through an FDA approval process. In fact, there are some people who object to even using the word treatment because we don't necessarily know that these drugs are going to cure the patients.

So in the meantime, I think everybody would like to see far more patients at least be able to try this. And so there's this question as to whether it's only going to be patients who have the resources to raise that money or access that money that are going to benefit. And I don't think anybody wants that to be the case.

Wade Roush: Are there any signs that the drug industry is looking at how to scale up some of these treatments? And, you know, maybe create a pipeline for hyper personalized drugs?

Erika Check Hayden: So we're seeing things like Ionis, their co-founder Stan Crooke has started a foundation called the n-Lorem Foundation that's going to try to develop these treatments for patients. The reason is that developing a drug for one patient that costs millions of dollars and doesn't really have a very large market is not something that's necessarily going to be attractive to a company. But I think people think there is a direction that could evolve where, you know, if the drug industry is better able to manufacture these drug templates or backbones and more easily switch out the part of the drug that's the business end that's doing the targeting of different genetic diseases to where that becomes much more large scale, much more customizable, much cheaper. You know, then you might see a model where this is much more economical, affordable, reimbursed by insurance companies, because right now this is not and obviously that's a major cost barrier.

Wade Roush: Do you think this is a time for patients with rare genetic disorders and families of those patients to feel more hopeful? Or is it just too early realistically for this to affect lots of people who are already suffering from these conditions?

Antonio Regalado: Right. It goes back to the question, should this be a breakthrough technology? Because right now, it's not helping that many people. We're talking about helping one person. Or we're talking about helping two or three very few people. Very few. And that's a strike against the idea, frankly. Like, why? Why should we invest resources into this when it helps so few people? Why should we call it a breakthrough technology? Well, the reason to is, it's sweet. Technically, it's sweet. And it paints a path towards a future where it like you can do a lot more with genetic drugs.

Wade Roush: So you can imagine a future not 100 years away, but maybe 10 years away, where this can be scaled up and broadened out to more patients.

Antonio Regalado: Yeah, absolutely. I mean, will the drugs work? How well will they work? It's kind of an open question. But yeah, we've already gone from one case to five cases next year no doubt it it'll be 10 and then a hundred and then thousands. Most likely. I want to raise something else, which this whole scenario is not fair. Because there's a lot of people with rare diseases and a lot of kids dying of rare disease in every neighborhood and every corner and every precinct of the country, of the world. So who has the opportunity to have this chance?

Wade Roush: Well, who does so far?

Antonio Regalado: Well, it is a very small subset of parents who for whatever reason have the ability to wrap their head around the science, to find where the opportunity is, and to raise quite a lot of money. And this is not bake sale money. This is two million dollars. Three million dollars. You have to really have a way to do that, and it favors people with a big network. That's why we're seeing people, you know, entrepreneurs from Silicon Valley or other people who just for whatever reason, manage to pull it off.

Wade Roush: If this kind of inequity persisted, it would definitely become a huge point of criticism around this whole area of therapy. But maybe you could look at these parents as the pioneers.

Antonio Regalado: Right. Exactly. A lot of the parents will say, well, in addition to trying to help my child, I also want to invest and try and create the process by which everybody else can be helped because they also have a lot of empathy for the next person. The idea is to help everybody. The pathway to doing that is not clear yet.

Wade Roush: All right. Well, whether this is a breakthrough or not, it raises so many interesting and thorny questions that it's perfect fodder for Technology Review.

Antonio: It's definitely a breakthrough, man. It's definitely a breakthrough.

Wade Roush: Okay. Thanks Antonio.

[Theme music]

Thats it for this edition of Deep Tech. This is a podcast were making exclusively for MIT Technology Review subscribers,to help bring alive some of the people and ideas youll find in the pages of our website and our print magazine. But the first four episodes cover our annual 10 breakthrough technologies issue, and were making those episodes free for everyone.

Deep Tech is written and produced by me and edited by Michael Reilly, with editorial help this week from Jennifer Strong. Our theme is by Titlecard Music and Sound in Boston. Special thanks this week to David Cameron, Howard Gelman, Erika Check Hayden, Mehmet Kuzu, Antonio Regalado, and Jane Wilkinson. Im Wade Roush. Thanks for listening, and we hope to see you back here for our next episode in two weeks.

See original here:
Podcast: A family on the frontier of hyper-personalized medicine - MIT Technology Review

Recommendation and review posted by Bethany Smith

Two rare white giraffes, a mother and her male calf, were killed by poachers in Kenya'sIshaqbini Hirola Conservancy, the park's director said Tuesday.

Mohammed Ahmednoor saidin a statement released on Twitter that the carcasses of the two animals had been discovered in a skeletal state, meaning that the crimes were committed some time ago.

SAD NEWS: @IshaqbiniHirola Community Conservancy, Garissa County loses two famous white giraffes to poachers.

For more info, heres the press release. @KWS @USAIDKenya @EUinKenya @denmarkinkenya @Nature_Africa @KWCAKenya @africa_ci @SwedeninKE pic.twitter.com/Nwp1F0VexF

The giraffe and its calf, which both are affected by a condition known as a leucism, were first discovered by the park in 2017.

This is a very sad day for the community of Ijara and Kenya as a whole. We are the only community in the world who are custodians of the white giraffe. Its killing is a blow to tremendous steps taken by the community to conserve rare and unique species and a wakeup call for continued support to conservation efforts, Ahmedoor said.

This is a long term loss given that genetics studies and research which were significant investment into the area by researchers, has now gone to the drain. Further to this, the white giraffe was a big boost to tourism in the area, he added.

Only one known giraffe with the condition now remains, according to Ahmedoor.

Africa's nature conservation areas are often targeted by poachers due to the high international value of some parts harvested from the carcasses of rare and endangered animals.

Read the original here:
Poachers kill Kenya's only white female giraffe and her calf: report | TheHill - The Hill

Recommendation and review posted by Bethany Smith

Women around the world

There are many remarkable Southeast Asian women who work in important areas in research institutions, governments, universities and pharmaceutical companies. This project aims to celebrate these amazing women and to inspire young women to take up careers in research and research-related fields.

Professor Mallika Imwong

Mallika Imwong is Head of Mahidol Oxford Tropical Medicine Research Units Molecular Malaria Laboratory, and a Professor in the Department of Molecular Tropical Medicine and Genetics, Mahidol University. Mallika is the recipient of both a Wellcome Trust Training Fellowship and a Wellcome Trust Intermediate Fellowship. Her research has focussed on how drug resistance emerges and spreads in malaria parasites in Asia and Africa, on the true epidemiology of malaria in low transmission settings, and on the biology of relapse of vivax malaria.

Research is very important to me, she says. Its a way of mediation. To set up a good research question is extremely important in my field. My approach is to first form my own opinion about the subject, then I study what other peoples insights are and finally combining the two.

Perceptions of the field shes working in have come a long way in her home country, Thailand. Malika says, Thirty years ago when I was younger, many people didnt understand what we were doing on a daily basis. If you told your family thats what you wanted to do, theyd ask: how can you have that for a career? People know more now as theres more awareness about science and health.

Mallika organizes the Thai Science Camp every year which attracts around 150 high school students. They spend a few days learning what scientists. People may know how to become a medical doctor or to be a teacher but few know how to become a scientist. Not many people know how much joy it gives to immerse yourself in the subject youre studying.

Where Mallika sees herself in a decade from now? Needless to say, I would like to leave a mark in research. Malaria kills 400,000 people per year, and Im hoping that I can contribute to its elimination in any way possible, especially in Thailand as its my country.

Professor Mallika Imwong

Mallika organizes the Thai Science Camp every year which attracts around 150 high school students.

Dr. Vilada Chansamouth

Vilada Chansamouth is a Lao government doctor working in the Microbiology Laboratory, Mahosot Hospital, Vientiane and a researcher at the Lao-Oxford-Mahosot Hospital-Wellcome Trust Research Unit.

In 2019, Vilada received the prestigious Wellcome International Training Fellowship and started her DPhil in Clinical Medicine with the University of Oxford. Her research involves evaluating the impact of a Lao-language mobile phone application on adherence to antibiotic prescribing guidelines.

Vilada says that being a researcher is a tough job, especially in countries like Laos where women mostly are in charge of household work and taking care of children. However, this has improved a lot now, especially in the capital where some families share responsibilities. She says, I think that to improve this, it is vital that the family knows the passion of the female researcher and how much she can do to help others. In some countries, female researchers just remain single and being incredibly happy and theres nothing wrong about this.

But according to Dr. Vilada, there are certain misconceptions about her profession. Some people think this is not a real job, its something that anybody can do if they have time and this work is for people who are more available or for those who can speak English and good in mathematics. This is partly correct because everybody can do it but we need to put much more effort to produce quality of research.

Finally, when asked what advice can she give women thinking about a career in research, Vilada says, Just go for it! If you have a current job now, you dont have to quit your job to be a researcher, you can do research within your current job, starting from exploring around, talking to people and keeping an open eye on what people doing in the field you are interested in.

Vilada Chansamouth

Mallika organizes the Thai Science Camp every year which attracts around 150 high school students.

Sanann Nou, University Research Company, Cambodia

Currently, Sanann is working as part of a malaria elimination project for the University Research Co. Llc. She was previously the head of Public Engagement at the Pailin site of the Mahidol Oxford Tropical Medicine Research Unit working on a malaria elimination study. Before joining MORU, she worked with FHI360.

I have organized many community engagement events around malaria and other health issues in my career. At MORU from 2016 to 2019, I led a project called Village Drama Against Malaria which won the 2019 University of Oxford Vice-Chancellor Choice Award for Public Engagement. What I loved most about the VDAM project how children conveyed the messages and educate their own parents, relatives, and neighbors about malaria treatment and prevention.

When asked about what are the biggest difficulties in her field of work as a woman, she notably disregards the woman aspect and highlights whats generally difficult to basically anyone working in rural areas or neglected diseases. As you know, malaria occurs in forests and remote villages. To conduct research, you must be on location. But its hard to reach these areas; the road conditions are extremely bad, there are dangerous river crossings and most places dont have internet access.

Sanann Nou

Currently Sanann is working as part of a malaria elimination project for the University Research Co. Llc.

See the rest here:
International Women's Day 2020: Celebrating Southeast Asian women in research - On Health - BMC Blogs Network

Recommendation and review posted by Bethany Smith

The Body Worlds exhibit currently on display at the Oregon Museum of Science and Industry gives visitors an up-close into how the human body functions. In conjunction, OMSI is featuring portraits by a Portland photographer that explore the correlation between beauty and aging.

Beyond the 60th Sense was inspired by the 2017 Womens March and the #MeToo movement that followed. Pedro Oliveira decided that he wanted to tell the stories of fierce women over age 50 by taking portraits of them and letting their own words tell how they faced issues of body empowerment, ageism, and sexuality.

Some of the stories inspire, like that of 105-year-old Isabel (above), who cant really explain the secret behind her longevity: I smoked up to my 80s and always ate pork, and everything I felt like. It has more to do with genetics and happiness than anything else.

Oliveira, who is originally from Brazil, started taking commercial photos five years ago after leaving a career in computer science. He has a degree in communications from Portland State University. He says he hopes his photos get people to think differently about female beauty, getting away from the idea that beauty belongs only to the young.

Beyond the 60th Sense continues through Sept. 13 at OMSI, 1945 S.E. Water Ave.

-- Grant Butler

gbutler@oregonian.com

503-221-8566; @grantbutler

Subscribe to Oregonian/OregonLive newsletters and podcasts for the latest news and top stories.

Read more from the original source:
OMSI photo exhibit shows the beauty, fierceness of older women - OregonLive

Recommendation and review posted by Bethany Smith