Genprex Inc. (NASDAQ: GNPX) maintained upside momentum in yesterdays session, and closed the day with gains of 23.44%. This came after news that, independent researchers had found the companys TUSC2 to be a possible novel biomarker for treating thyroid cancer. The results found that, the overexpression of TUSC2 reduced thyroid cancer tumor metastasis. It was also shown to drive up sensitivity to apoptosis by pushing up cytochrome C and SMAC/DIABLO protein levels.

Thestudy further noted that, there was a high chance that TUSC2 was effective intreating thyroid cancer and that, it adds to research on TUSC2 way beyond thenon-small cell lung cancer treatment that the company was earlier looking into.The independent research was published in the International Journal ofMolecular Sciences.

Theresearchers also concluded that from their studies, TUSC2 has a negativeassociation with the aggressiveness of thyroid cancer. As such, it could be anew target and biomarker for thyroid cancer treatment. They also stated that,thyroid carcinoma is one of the most prevalent endocrine cancers and takesdifferent forms. They further noted that, anaplastic carcinoma is rare, but isone of the most dangerous subtypes.People suffering from it usually exhibit increased neck mass, a high rateof metastases and a 95% mortality at only 6 months. On the other hand,papillary thyroid carcinoma is more common, but has good outcomes and iscurable with radioiodine surgery and surgery.

Commentingon this research, Genprex CEO Rodney Varner stated that, the company isencouraged by the data conducted by different institutions on TUS2 that suggestit is helpful in treating multiple cancers.

Fromits price action, GNPX is in an uptrend. The stock opened the day at $1.57 andtraded between a low of $1.37, and a high of $1.75 before closing the day at$1.75. Volumes in the day stood at 21.44 million.

About GenPrex Inc.

GenPrexInc. is a gene therapy company that develops technologies for people sufferingfrom cancer. It is based in Austin, Texas.

Read the original here:
Genprex Inc. (NASDAQ: GNPX) Up, As Independent Research Reveals TUSC2 Could Be A Therapy For Thyroid Cancer - Invest Million

Recommendation and review posted by Bethany Smith

The market has been meticulously and expansively evaluated in a 116-page market research publication added into the repository, titled Global Gene Therapy Market The analysts have put forth brilliant and in-depth research about the current and future status of the global market. The forecast period considered by the analysts in this publication is from 2019 to 2025 and the review period is 20152018. This Global Gene Therapy Market report is a systematically organized compilation based on the growth rate, present market trends, and factors that affect consumers approach towards products and services available in the market.

Request A Sample Copy Of Report: Click Here https://www.reportconsultant.com/request_sample.php?id=3147

Top Key Players: Sangamo, Spark Therapeutics, Dimension Therapeutics, Avalanche Bio, Celladon, Vical, Advantagene

Under the overall analysis of the Global Gene Therapy Market, the researchers have shed light on sales price, sales, and capacity factors. Five key geographies across the world have been assessed in the report, viz., Asia-Pacific, Europe, Middle East & Africa, Latin America and North America. The sales price analysis of the global market has been offered for the year 2018 based on the industry segments. However, a six-year review period of Global Gene Therapy Market has been taken into consideration for assessing global sales price. Commodity sales and other capacity factors have been included featuring the evaluation of the growth rate.

This has been followed by a statistical surveying study of different classifications and applications deemed vital for players operating in the Global Gene Therapy Market. The authors have provided the important definitions and specifications ofthe global market right at the beginning of the report. Standard spheres and micrometers could be the prominent types of market applications. In the sixth chapter, the report has presented a comprehensive analysis of the driving factors, interview prices, and sales of the Global Gene Therapy Market in terms of type. An analytical comparison of different applications apart from the sales factors is offered in the report.

Ask For Discount@ https://www.reportconsultant.com/ask_for_discount.php?id=3147

Segment By Regions/Countries, This Gene Therapy Market Report Covers

South America

North America

Europe

Center East and Africa

Asia Pacific

Table Of Content:

The Global Gene Therapy Market Report Contains:

See the original post here:
Analysis Of Gene Therapy Market 2020-2028 Accentuating Forecast Of Target Market Size, Trends, Consumption And Dominating Players - Briotainment

Recommendation and review posted by Bethany Smith

Monday marks the beginning of the first Jewish Genetic Screening Awareness Week.

And, this being February, there are at least a dozen other awareness efforts just as there were in January and will be come March and the nine months that follow. February is, of course, the month in which we raise awareness about HIV/AIDS, Teen Dating Violence and screen for eating disorders, among a long list of other things.

Now comes Feb. 3-7, the week JScreen hopes will get us to focus on genetic screening and more specifically the need for people here and across the country to take charge of their health and any children they hope to have in the future. To kick things off, the Georgia Legislature is expected to pass a proclamation to highlight the effort midweek.

JScreen, you might recall, is a national nonprofit public health initiative dedicated to preventing Jewish genetic diseases. But the goal is to prevent diseases common in other ethnic groups as well, said Karen Arnovitz Grinzaid, an assistant professor of human genetics at Emory University and JScreens executive director.

The nonprofit, based at Emory University, began in 2010 as a pilot project in Atlanta and has since evolved into a national initiative offering affordable, accessible and comprehensive genetic screening.

RELATED |DeKalb couples personal tragedy becomes crusade for genetic testing

Since its national launch in 2013, Grinzaid said, JScreen has helped thousands, testing people from every state across the country and offering services remotely.

That means once you register for a genetic screen kit atjscreen.org, JScreen will mail the kit to your home. All you have to do is spit in a tube and mail the saliva sample to the lab. A genetic counselor will then report the results either by phone or secure video conference.

For people with health insurance, the cost, regardless of coverage, is $149 and includes the testing and follow-up genetic counseling. The self-pay price is $349.

While the focus is on the Jewish community, screening is encouraged for anyone planning to have a family, Grinzaid said.

JScreen screens for over 200 diseases. For most of these diseases, both parents must carry the same recessive gene in order for their children to be at risk.

So why an awareness week?

Were always trying to raise awareness, but by dedicating a week and calling this out, we can save lives, Grinzaid said. So many people dont hear about genetic screening until they show up pregnant in their doctors office. At that point, if they are a high-risk couple, they dont have as many options to help them plan ahead for a healthy baby. Genetic screening is something people should ideally do before they get pregnant.

Unlike other awareness campaigns, JScreens promises to be very purposeful, focusing each day on a specific theme in hopes that more people will take advantage of screening.

RELATED |A mother and her daughters bare all to help prevent breast cancer

On Monday, organizers will be laser focused on Tay-Sachs, a rare, inherited disorder that destroys nerve cells in the brain and spinal cord.

On Tuesday, theyll turn their focus to college students. While having a baby may be the farthest thing from any students mind, discounted screenings will be provided at colleges and universities across the country so students will have access to important information they need for future family planning.

BRCA awareness will follow on Wednesday. Ashkenazi Jews are at 10 times greater risk to have a mutation in a BRCA gene, increasing their risk for breast, ovarian, prostate and pancreatic cancer.

Then on Thursday, Jews with Sephardi and Mizrahi ancestry, such as Persians, Syrians and Bukharians, are encouraged to be screened.

Finally on Friday, interfaith couples will be the focus. While there are a number of diseases that are commonly found in people with Jewish background, Grinzaid said these diseases also occur in the general population, making screening important for interfaith couples as well.

Thats not all.

Beyond carrier screening, Grinzaid said that JScreen is running the PEACH BRCA study for people with Jewish background who are at risk for carrying a BRCA mutation based on their ancestry. Knowing ones BRCA status can be life-saving.

Were piloting BRCA testing in metro Atlanta, she said. Participation in the study is free, but you must be at least 25 or older, male or female, and have at least one Jewish grandparent and no personal or close family history of related cancers.

Of the 500 available slots, only 100 are left. People interested in learning more about the PEACH BRCA study can log on here:jscreen.org/brca.

Once the study is complete, JScreen will launch a cancer genetic testing program nationally.

For information about any of these programs or to register for a screening kit,log onto jscreen.org.

Sure, the focus for now is on this week, but you can get screened any time and you should. Genetic testing is just that important.

Find Gracie on Facebook (www.facebook.com/graciestaplesajc/) and Twitter (@GStaples_AJC) or email her at gstaples@ajc.com.

Support real journalism. Support local journalism. Subscribe to The Atlanta Journal-Constitution today. See offers.

Your subscription to the Atlanta Journal-Constitution funds in-depth reporting and investigations that keep you informed. Thank you for supporting real journalism.

See the rest here:
Jewish or not, this week could save you a lot of heartache - Atlanta Journal Constitution

Recommendation and review posted by Bethany Smith

Say precision medicine and people think of personalized cancer treatment. But this innovation has already begun to revolutionize primary care tooeven though the jury is still out, in many cases, on whether it makes a clear difference in outcomes.

Just what precision (alias personalized) medicine is isnt always spelled out precisely. But usually it is discussed as prevention or treatment that takes into account individual differences among patients, most often genetic differences. Some people expand the concept to consider individual differences in environment and lifestyle.

In adult primary care, two subsets of precision medicine have attracted the most attention recently: predictive genetic testing and pharmacogenomics.

Predictive genetic testing is what it sounds like: A genetic test that forecasts a persons chance of getting a disease. The term is also applied to germline genetic tests that provide some indication of the predisposition being passed down to offspring. Proponents see predictive genetic testing for certain inherited conditions as a way to unearth risks in people who can then get early treatment or take preventive steps to head off serious and possibly costly conditions. Actor Angelina Jolie put BRCA testing as a predictive genetic test into the public consciousness with her announcement in 2013 that she underwent a double mastectomy after testing positive for a BRCA mutation.

Pharmacogenomics studies show how a persons genes can affect his or her response to medications. Ideally, pharmacogenomic (sometimes called pharmacogenetic) results could end some of the trial and error with drugs and help providers and patients choose the most effective drug right off the bat.

Where federal dollars are concerned, precision medicine has already stepped out of the cancer box. In 2015, President Barack Obama committed $215 million to precision medicine research, including a genomic study of more than a million Americans to extend precision medicine from cancer to other diseases. A year later, the 21st Century Cures Act expanded this funding to $1.5 billion over the next 10 years.

Aided by a multibillion-dollar genomic testing industry, some providers have started testing precision medicine beyond oncology. In 2018, Geisinger Health System in central Pennsylvania made a splash by announcing that it would add DNA sequencing to routine primary care. A small number of other hospitals are starting to monetize these tests. In August 2019, STAT reported that a handful of academic medical centers, including Brigham and Womens Hospital and the Mayo Clinic, have started elective genome sequencing clinics for generally healthy patients willing to pay hundreds, sometimes thousands of dollars in cash for a genetic workup.

Skeptics see carts preceding horses; solid evidence that routine genetic testing results in better outcomes is lacking. As one genome-sequencing clinic leader conceded in the STAT article, such testing can lead to expensive follow-up testing. Not surprisingly, payers have been reluctant to cover sequencing tests of various kinds.

Regulators have breathed life into some kinds of testing and poured cold water on others. Last year, 23andMe was the first testing company to get FDA approval to market a direct-to-consumer genetic test for three (of the more than 1,000 known) BRCA gene mutations linked to increased risk of breast, ovarian, and prostate cancer. But in April 2019, the agency issued a warning letter to Inova Health System in Northern Virginia to stop marketing pharmacogenomics tests it claimed could predict patients responses to antidepressants, opioids, and other drugs. The FDA said it was unaware of data to support these claims.

A survey published two years ago in Clinical Pharmacology and Therapeutics found that clopidogrel, a blood thinner, was the medication most commonly tested for a druggene interaction, followed by simvastatin and warfarin. Nearly 40 academic medical centers and community health systems testing ways to implement pharmacogenomics in clinical practice were surveyed.

Some evidence suggests that traditional screening methods may not identify everyone at risk for certain inherited conditions. In a study published in Science three years ago, researchers at Geisinger and Regeneron (which manufactures Praluent, a drug used to treat familial hypercholesterolemia) found that only about one in four people carrying the familial hypercholesterolemia gene variant met the Dutch Lipid Clinic Network criteria (widely used diagnostic criteria) for genetic testing. Still, evidence for the clinical utility of many pharmacogenomic or predictive genetic tests is pretty scanty at this point.

Right now, for the average primary care provider, there are a relatively limited number of situations where pharmacogenomic testing is clearly beneficial to outcomes in a way thats dramatic, says Greg Feero, MD, a faculty member at Maine Dartmouth Family Medicine Residency and a former senior advisor to the director of the NIHs genomics research division.

For predictive genetic testing, there are a few notable exceptionshereditary breast and ovarian cancer, Lynch syndrome, and familial hypercholesterolemiaif certain criteria such as family history of the condition are met. The CDC has designated genomics applications for these conditions as Tier 1, the highest tier on its evidence-based ranking system of genomic applications by their potential for a positive public health impact.

In a 2017 editorial published in American Family Physician, Vinay Prasad, MD, and Adam Obley, MD, of Oregon Health and Science University said that rigorous meta-analyses havent yet shown that genotype-guided dosing for warfarin, clopidogrel, or antidepressant selection is better than usual care. Prasad is a well-known critic of what he sees as the proliferation of medical treatments and therapies without good evidence behind them. We need to know on a broad scale that [these tests] improve outcomes for patients, and dont just reassure physicians theyre choosing a better drug, Obley tells Managed Care.

Prasad and Obley also argued in their editorial that without further proof of improved outcomes, routine genetic testing could just fuel more inappropriate care. Guidelines carve out clear boundaries for who should get tested because there are scenarios in which the risks and benefits of preventive measures arent known, they said, noting that the U.S. Preventive Services Task Force advises against genetic testing for BRCA mutations in women without a family history of BRCA-related cancers.

A small pilot study suggests that genetic testing in primary care may not lead to improved outcomes. In 2017, The Annals of Internal Medicine published the first randomized trial of whole-genome sequencing in primary care. Gene variants were found in 20% of the participants whose genomes were sequenced. But six months later none of them had improved outcomes.

The test produces lots of information, says Obley, who wasnt involved in the study. But its not clear that any patient was managed differently in a way that improved their health.

Without evidence supporting the clinical utility of routine pharmacogenomics or genetic testing, most payers are unwilling to cover them. Some exceptions exist, such as employers that offer routine genetic testing as an employee benefit. In a blog post published in 2018, Color Genomics touted Visa and the German software company SAP as customers. Medicare covers pharmacogenomic testing of two gene variants that predict warfarin responsiveness for beneficiaries enrolled in a randomized, controlled clinical study that meets certain standards.

The high cost of genetic testing has been cited as another reason insurance coverage is limited, but payers may not budge even as testing gets cheaper. The cost of doing the test itself has been declining quite rapidly, says Kathryn Phillips, a health economics professor at University of CaliforniaSan Francisco who researches personalized medicine access, quality, and reimbursement. She has disclosed in recent studies that she is a paid consultant for Illumina, a DNA sequencing company. But she says its hardand its going to take longerto figure out where to use genetics in primary care in healthy populations, and [for insurers] to pay for it.

The current state of evidence and bleak reimbursement prospects havent deterred early adopters from embracing precision medicine in primary care. For Megan Mahoney, MD, chief of general primary care at Stanford Medicine, precision medicine begins with going after data on key determinants of healthnot just genes, but also environmental factors, social determinants, and health behaviors.

In a yearlong pilot of 50 patientsmore than half of whom were at risk for cardiovascular conditionsStanford Medicine care teams created personalized care plans to prevent and manage chronic illness. The plans leveraged data from several sources, including genetic-risk assessments and genetic testing for the three CDC Tier 1 conditions and remote monitoring devices.

Before the pilot, which ended in 2018, Stanford did not offer routine genetic testing in primary care. So far, that hasnt changed. But Stanford is making the genetic-risk assessment tested in the pilot available to its primary care providers, hoping it can increase screening rates for the Tier 1 conditions, says Mahoney. Studies show that many primary care providers are uncomfortable evaluating and addressing genetic risk. Five patients in the pilot discovered through the genetic risk screening that theyre at high risk for breast cancer, demonstrating that this type of tool can help to identify previously unknown risks.

Post-pilot, Stanford is also offering patients with poorly controlled blood pressure connection to a Bluetooth-enabled blood pressure cuff and health coaching as part of a larger study. Genetic testing has dominated the discussion of precision medicine in primary care, but Stanfords experience shows that it isnt the only way to tailor preventive care to individual patients needs.

Even if clinical utility is ultimately shown, folding precision medicine into primary care will likely follow the path of many new developments in medicine: There will be some early adopters, but most practices will have a wait-and-see and depends-on-the-reimbursement attitude.

Educating doctors on how to interpret, use, and communicate genetic testing results to patients will be one of the biggest hurdles. Theyll be learning on the job, says Susanne Haga, associate professor of internal medicine at Duke Universitys medical school, who leads educational activities in genetics and genomics for the Duke Center for Applied Genomics. An obstacle course of other possible barriers awaits: the limited number of certified genetic counselors, concerns about privacy and genetic discrimination, and the potential for the lack of diversity in genomic data sets to exacerbate disparities in care.

Still, Haga sees the convergence of three factors that will force the health care systems hand and usher in precision medicine in primary care: patients increasing ability to influence decisions about their care, the declining cost of testing, and a critical mass of people, numbering in the millions, who will have had their DNA sequenced in genome programs such as Geisingers or several national genomics research initiatives.

Its coming, she says, one way or another.

Visit link:
Precision Medicine in Primary Care: Bespoke. Genetic and Genomic. And Maybe Not Ready. - Managed Care magazine

Recommendation and review posted by Bethany Smith

NEW YORK (PRWEB) January 30, 2020

At-home DNA testing service 23andMe is more than just a tool to discover ancestry - it also offers insight into how genes can impact overall health and wellness. 23andMe offers a wealth of reports that provide genetic health information that can help customers be more proactive about their health. Recently, 23andMe Genetics Trends Expert, Madeline Lynch, and customer Michelle Martinez, teamed with YourUpdateTV to discuss.

A video accompanying this announcement is available at: https://youtu.be/VAKAywAd4VY

A recent survey of 23andMes Health + Ancestry Service customers found that more than three-quarters reported that after receiving their personalized genetic reports they made at least one positive change in their health behavior. Designed by 23andMe and M/A/R/C Research, researchers asked 23andMe Health + Ancestry customers about the overall impact of their 23andMe experience, regardless of their results.

51 percent of respondents reporting theyve set future goals to be healthier. Changes included eating healthier, getting more sleep, and exercising more, among others. Of those who responded to the survey:

For more information and to get started, visit 23andMe.com

Madeline Lynch:Madeline Lynch is the Genetics Trends Expert at 23andMe. She serves as a subject matter expert and company spokesperson for media engagements, the analyst community, online communities, and the general public at large. Her responsibilities on the customer care team include providing input on prioritization and resolution of customer-facing issues and working directly with cross-functional teams to influence and support development of new and existing communications materials and messaging from the perspective of the customer. She holds a BA from University of California, Davis.

About Michelle Martinez:Michelle Martinez is a 51-year-old lab assistant from Arlington, Texas. Michelle was inspired to order a 23andMe Health + Ancestry kit to help prepare for any potential genetic health risks, due to several serious health risks running in her family. When she opened her Genetic Weight wellness report, she saw that she is genetically predisposed to weigh less than average. She thought, "I've been denying my genetics and just falling into bad habits. I'm not being my best self." That report, along with the knowledge of lifestyle and environmental factors that affect one's health, inspired Michelle to make better lifestyle decisions like eating healthier. She has since lost more than 50 pounds and gained confidence in being in her own skin. She believes that her weight loss journey is one of patience and acceptance with and of herself -- no matter her size.

About 23andMe:23andMe, Inc. is the leading consumer genetics and research company. Founded in 2006, the mission of the company is to help people access, understand and benefit from the human genome. The company was named by TIME as a Genius Company in 2018 and featured as Fast Company's #2 Most Innovative Health Company in 2018. 23andMe has millions of customers worldwide, with more than 80 percent of customers consented to participate in research. 23andMe, Inc. is located in Sunnyvale, CA. More information is available at http://www.23andMe.com.

About YourUpdateTV: YourUpdateTV is a social media video portal for organizations to share their content, produced by award-winning video communications firm, D S Simon Media (http://www.dssimon.com). It includes separate channels for Health and Wellness, Lifestyle, Media and Entertainment, Money and Finance, Social Responsibility, Sports and Technology.

Share article on social media or email:

See original here:
How Genetic Testing with 23andMe Can Improve Your Health - PR Web

Recommendation and review posted by Bethany Smith

The "Molecular Diagnostics Market Share & Global Forecast, By Application, Technology, End User, Regions, Companies" report has been added to ResearchAndMarkets.com's offering.

Increasing prevalence of Infectious diseases such as Influenza, HPV, Hepatitis, HIV and Tuberculosis despite rise in sanitation practices globally. In the past, antimicrobials medicines were used to fight powerful infectious disease but slowly in today's time antimicrobial agent is not able to give the desired results because the problem of drug resistant occurs in many people across the world.

Nowadays, a new diagnostic procedure is being followed to fight infectious disease like molecular diagnostic test is very effective which is quite fast and precise. The number of cancer patients is increasing very fast, so it is believed that in the coming time the molecular diagnostic test market will be growing at rapid pace. Global Molecular Diagnostics Market is likely to surpass US$ 22.5 Billion by the end of year 2025.

There are various reasons that will propel the market growth in forecast year; rising incidence rate of infectious disease, increasing incidence rate of cancer of all type, increasing people awareness regarding molecular diagnostic, rapid technological growth, widely acceptance of personalized medicine, rising healthcare infrastructure, increasing healthcare per capita expenditure across the developed and developing nation, accuracy of diagnosis, growing population of cardiovascular and neurological disorder etc. In addition, increasing prevalence of genetic disorder will further boost the market in forecast period of time.

The report titled Molecular Diagnostics Market Share & Forecast, By Application (Infectious Diseases, Blood Screening, Oncology, Genetic Testing, HLA (Tissue Typing), Microbiology, Cardiovascular Diseases, Neurological Diseases, Pharmacogenomics and Others), By Technology (PCR, Transcription-Mediated Amplification (TMA), Hybridiazation (In-situ Hybridiazation & FISH), DNA Sequencing & NGS, Microarray and Others), By End User (Hospitals & Academic Laboratories, Clinics and Commercial Laboratories, Others), By Regions [United States, Europe (Expect Russia), India, China, Japan, Brazil, South Korea, Mexico, Russia and ROW], Companies (Roche, Abbott, Myriad Genetics, Qiagen, BioMrieux and Others) provides a complete analysis of Molecular Diagnostics Market.

Market Insight by Application

The report provides comprehensive analysis of molecular diagnostic test market by application into ten parts: Infectious Diseases, Genetic Testing, Blood Screening, Oncology, HLA (Tissue Typing), Microbiology, Neurological Diseases, Pharmacogenomics, Cardiovascular Diseases, and Others. This report also provides key opportunities market and specific factors are given by each application market.

Market Insight by Technology

Here the market is fragmented into six parts; PCR, Transcription-Mediated Amplification (TMA), Hybridiazation (In-situ Hybridiazation & FISH), DNA Sequencing & NGS, Microarray and Others. Besides, many factors are analyzed that influence the growth, challenges and opportunities of market in technological context.

Market Insight by End User

The report provides complete insight of market by End User segments: Hospitals & Academic Laboratories, Clinics & Commercial Laboratories and Others. According to the publisher, Hospitals & Academic Laboratories will hold the largest market in global molecular diagnostic test market in forecast period of time.

Market Insight by Regions

This report covers the complete regional profile by 10 geographical market; United States, Europe, India, China, Japan, Brazil, South Korea, Mexico, Russia and Rest of World (ROW).

Key Topics Covered:

1. Executive Summary

2. Global Molecular Diagnostic Market

3. Market Share - Global Molecular Diagnostics

3.1 By Application

3.2 By Technology

3.3 By Countries

3.4 By Companies

4. Application - Molecular Diagnostics Market

4.1 Infectious Diseases

4.1.1 Hospital Acquired Infections (HAI)

4.1.2 HIV / HCV Testing

4.1.3 STD Testing

4.1.4 HPV Testing

4.2 Blood Screening

4.3 Oncology / Cancer

4.3.1 Breast

4.3.2 Colorectal

4.3.3 Prostate

4.3.4 Others

4.4 Genetic Testing

4.5 HLA (Tissue Typing)

4.6 Microbiology

Story continues

4.7 Cardiovascular Diseases

4.8 Neurological Diseases

4.9 Pharmacogenomics

4.10 Others

5. Technology - Molecular Diagnostics Market

5.1 PCR

5.2 Transcription-Mediated Amplification (TMA)

5.3 Hybridiazation (In-situ Hybridiazation & FISH)

5.4 DNA Sequencing & NGS

5.5 Microarray

5.6 Others

6. Region - Molecular Diagnostics Market

6.1 United States

6.2 Europe

6.3 India

6.4 China

6.5 Japan

6.6 Brazil

6.7 South Korea

6.8 Mexico

6.9 Russia

6.10 Rest of World (ROW)

7. End Users - Molecular Diagnostics Market

7.1 Hospitals & Academic Laboratories

7.2 Clinics and Commercial Laboratories

7.3 Others

8. Roche Diagnostics - Company Analysis

8.1 Merger & Acquisitions

8.2 Sales Analysis

9. Abbott Laboratories - Company Analysis

9.1 Merger & Acquisitions

9.2 Sales Analysis

10. Myriad Genetics - Company Analysis

10.1 Merger & Acquisitions

10.2 Sales Analysis

11. Qiagen - Company Analysis

11.1 Merger & Acquisitions

11.2 Sales Analysis

12. BioMrieux's Inc - Company Analysis

12.1 Merger & Acquisitions

12.2 Sales Analysis

13. Market Drivers

13.1 Various Developments in the Molecular Diagnostics Landscape

13.2 Integral to Traditional Labs

13.3 Improved Assay / Test Efficiencies

13.4 Targeting Antibiotic Resistance

13.5 Next Generation Ultrasensitive Molecular Diagnostics

13.6 Increasing Investment in Genomics & Proteomics Research

13.7 Technological Advances in Molecular Diagnostics

13.8 Increasing Acceptance of the Personalized Medicine

13.9 Growing Molecular Diagnostics for Food Safety

14. Challenges

14.1 Dearth of Trained Professionals

14.2 Regulatory Issues

14.3 Various Factors Slowing Growth of Molecular Diagnostics

14.4 Reimbursement Capabilities

14.5 Quality Checkpoints, Awareness & Acceptance

For more information about this report visit https://www.researchandmarkets.com/r/j3on5s

View source version on businesswire.com: https://www.businesswire.com/news/home/20200130005474/en/

Contacts

ResearchAndMarkets.comLaura Wood, Senior Press Managerpress@researchandmarkets.com For E.S.T Office Hours Call 1-917-300-0470For U.S./CAN Toll Free Call 1-800-526-8630For GMT Office Hours Call +353-1-416-8900

Follow this link:
Global Molecular Diagnostics Market is Likely to Surpass US$ 22.5 Billion by the End of Year 2025 - ResearchAndMarkets.com - Yahoo Finance

Recommendation and review posted by Bethany Smith

AMHERST, Mass. Allison Vorderstrasse, a faculty member and Ph.D. program director at New York University, has been named the dean of the College of Nursing at the University of Massachusetts Amherst. She will begin her appointment on July 1.

Vorderstrasse currently serves as a faculty member and director of the Florence S. Downs Ph.D. Program in Nursing Research and Theory Development at New York University (NYU) Rory Meyers College of Nursing. The appointment was made by John J. McCarthy, provost and senior vice chancellor for academic affairs.

Dr. Vorderstrasse emerged as the best in an exceptionally well-qualified pool of candidates. I look forward to working with her as she leads the College of Nursing into its 67th year, McCarthy said.

An adult nurse practitioner with clinical experience, Vorderstrasse received her doctorate and masters degrees in nursing at the Yale University School of Nursing, with specialties in chronic illness self-management research and diabetes. She received her bachelors degree in nursing from Mount Saint Mary College in Newburgh, N.Y.

As a researcher, Vorderstrasse focuses on development and implementation of innovative behavioral interventions for diabetes and cardiovascular disease that could expand preventive and self-care management support for adults at risk for, or living with, chronic diseases. Her contributions to chronic disease prevention have identified that genetic testing for chronic conditions may improve risk reduction in certain groups. She was among the first researchers to demonstrate that virtual environments are an effective way to provide self-management education and support to improve outcomes for patients with diabetes and cardiovascular disease.

Prior to joining the faculty at NYU, Vorderstrasse was an associate professor of nursing and faculty lead for precision health research at the Duke University School of Nursing. She taught at the Duke University School of Nursing from 2009 to 2014. In 2014, she received the Duke University School of Nursing Distinguished Teaching Award. She was inducted as a fellow of the American Academy of Nursing in 2015, and in 2017 received the International Society of Nurses in Genetics Founders Award for Excellence in Genomic Nursing Research.

While at NYU, Vorderstrasse led curriculum and program changes in its nursing Ph.D. program that included a new entry point for post-bachelor to Ph.D. students to facilitate earlier entry into careers in research without sacrificing academic rigor in the program. She has worked with global partners to establish a global track option for Ph.D. students that will launch in the fall of 2020. She also focused on faculty and student culture and wellness as a part of her leadership at NYU.

View original post here:
Allison Vorderstrasse Named Dean of UMass Amherst College of Nursing - UMass News and Media Relations

Recommendation and review posted by Bethany Smith

Illumina (ILMN) came out with quarterly earnings of $1.70 per share, beating the Zacks Consensus Estimate of $1.59 per share. This compares to earnings of $1.32 per share a year ago. These figures are adjusted for non-recurring items.

This quarterly report represents an earnings surprise of 6.92%. A quarter ago, it was expected that this genetic testing tools company would post earnings of $1.40 per share when it actually produced earnings of $1.93, delivering a surprise of 37.86%.

Over the last four quarters, the company has surpassed consensus EPS estimates four times.

Illumina, which belongs to the Zacks Medical - Biomedical and Genetics industry, posted revenues of $953 million for the quarter ended December 2019, surpassing the Zacks Consensus Estimate by 0.63%. This compares to year-ago revenues of $867 million. The company has topped consensus revenue estimates four times over the last four quarters.

The sustainability of the stock's immediate price movement based on the recently-released numbers and future earnings expectations will mostly depend on management's commentary on the earnings call.

Illumina shares have lost about 5.3% since the beginning of the year versus the S&P 500's gain of 1.4%.

What's Next for Illumina?

While Illumina has underperformed the market so far this year, the question that comes to investors' minds is: what's next for the stock?

There are no easy answers to this key question, but one reliable measure that can help investors address this is the company's earnings outlook. Not only does this include current consensus earnings expectations for the coming quarter(s), but also how these expectations have changed lately.

Empirical research shows a strong correlation between near-term stock movements and trends in earnings estimate revisions. Investors can track such revisions by themselves or rely on a tried-and-tested rating tool like the Zacks Rank, which has an impressive track record of harnessing the power of earnings estimate revisions.

Ahead of this earnings release, the estimate revisions trend for Illumina was unfavorable. While the magnitude and direction of estimate revisions could change following the company's just-released earnings report, the current status translates into a Zacks Rank #4 (Sell) for the stock. So, the shares are expected to underperform the market in the near future. You can see the complete list of today's Zacks #1 Rank (Strong Buy) stocks here.

It will be interesting to see how estimates for the coming quarters and current fiscal year change in the days ahead. The current consensus EPS estimate is $1.55 on $907.18 million in revenues for the coming quarter and $6.99 on $3.90 billion in revenues for the current fiscal year.

Investors should be mindful of the fact that the outlook for the industry can have a material impact on the performance of the stock as well. In terms of the Zacks Industry Rank, Medical - Biomedical and Genetics is currently in the top 31% of the 250 plus Zacks industries. Our research shows that the top 50% of the Zacks-ranked industries outperform the bottom 50% by a factor of more than 2 to 1.

Want the latest recommendations from Zacks Investment Research? Today, you can download 7 Best Stocks for the Next 30 Days. Click to get this free reportIllumina, Inc. (ILMN) : Free Stock Analysis ReportTo read this article on Zacks.com click here.

View original post here:
Illumina (ILMN) Q4 Earnings and Revenues Top Estimates - Yahoo Finance

Recommendation and review posted by Bethany Smith

As per a report Market-research, the Genetic Testing Services economy is likely to see a CAGR increase of XX% within the forecast period (2019-2029) and reach at a value of US$ at the ending of 2029. The macro economic and micro elements which are predicted to influence the trajectory of this market are examined from the market analysis that was presented.

Light onto the material throws Providers, vendors, manufacturers, and market participants at the value string of their industry that is Genetic Testing Services . Whats more, its particular influence on the market and the political and economic scenarios of regions are discussed within the analysis.

Critical Details included from this record:

Request Sample Report @https://www.mrrse.com/sample/15214?source=atm

Competitive Outlook

Light onto the throws Business prospects of players operating from the industry that is Genetic Testing Services . The item pricing plans, marketing stations that were preferred and product portfolio of most players, and promote presence of every and every provider is contained in the title. The players comprise Business 4, Business two, Business 3, and Business.

Regional Assessment

The marketplace research that is introduced sheds light onto the Marketplace Scenario in numerous markets. Additionally, the effects of the governmental and regulatory policies to this market in every regions prospects is examined from the report.

companies profiled in the report are Laboratory Corporation of America Holdings, Quest Diagnostics Incorporated, Genomic Health, Inc., NeoGenomics Laboratories, Inc., Eurofins Scientific, Ambry Genetics, Hoffmann-La Roche Ltd, Illumina, Inc., CENTOGENE AG, and 23andMe, Inc.

The global genetic testing services market has been segmented as follows:

Global Genetic Testing Services Market, by Test Type

Global Genetic Testing Services Market, by Service Provider

Global Genetic Testing Services Market, by Application

Global Genetic Testing Services Market, by Geography

Request For Discount On This Report @ https://www.mrrse.com/checkdiscount/15214?source=atm

The report Suits the questions pertaining Into the Genetic Testing Services economy:

Reasons Genetic Testing Services Market Report Sticks out

Buy This Report @ https://www.mrrse.com/checkout/15214?source=atm

Read more:
Trends in the Ready To Use Genetic Testing Services Market 2019-2021 - Dagoretti News

Recommendation and review posted by Bethany Smith

Genetic testing, also known as DNA testing, is used to identify changes in DNA sequence or chromosome structure. Genetic testing can also include measuring the results of genetic changes, such as RNA analysis as an output of gene expression, or through biochemical analysis to measure specific protein

The Global Direct Patients Genetic Testing Industry estimated to be Increasing awareness about the risk of genetic diseases and growing proactive tendency among the public about prevention and efficient management of chronic diseases mainly drive the market. However, high cost of testing service is one of the major factors expected to hamper the growth of the global market.

Get Sample Copy of this Report Visit @ https://www.orianresearch.com/request-sample/1381456

Direct Patients Genetic Testing Industry 2020 research analysts provide an elaborate description of the value chain and its distributor analysis. This Market study Research Report provides comprehensive data that enhances the understanding, scope, and application of this report. The study also consists of data regarding the consumption aspect of the Direct Patients Genetic Testing Market. It provides details regarding the consumption volume as well as value of the product.

Major Key Players in Direct Patients Genetic Testing Market are:-

Key Benefits of the Report:

Inquire more or share questions if any before the purchase on this report @ https://www.orianresearch.com/enquiry-before-buying/1381456

On the basis of type, the market is split into:

On the basis of technology, the market is split into:

The market estimates and forecasts have been verified through exhaustive primary research with the Key Industry Participants (KIPs), which typically include:-

Research Methodology:-

The market is derived through extensive use of secondary, primary, in-house research followed by expert validation and third party perspective, such as, analyst reports of investment banks. The secondary research is the primary base of our study wherein we conducted extensive data mining, referring to verified data sources, such as, white papers, government and regulatory published articles, technical journals, trade magazines, and paid data sources.

For forecasting, regional demand & supply factors, recent investments, market dynamics including technical growth scenario, consumer behavior, and end use trends and dynamics, and production capacity were taken into consideration. Different weightages have been assigned to these parameters and quantified their market impacts using the weighted average analysis to derive the market growth rate.

Order a copy of Global Direct Patients Genetic Testing Market Report @ https://www.orianresearch.com/checkout/1381456

Why to Buy this Report:-

Table of Content:-

Customization Service of the Report:-

Orian Research provides customisation of reports as per your need. This report can be personalised to meet your requirements. Get in touch with our sales team, who will guarantee you to get a report that suits your necessities.

About us: Orian Researchis one of the most comprehensive collections of market intelligence reports on the World Wide Web. Our reports repository boasts of over 500000+ industry and country research reports from over 100 top publishers. We continuously update our repository so as to provide our clients easy access to the worlds most complete and current database of expert insights on global industries, companies, and products. We also specialize in custom research in situations where our syndicate research offerings do not meet the specific requirements of our esteemed clients.

Contact Us:-

Ruwin Mendez

Vice President Global Sales & Partner Relations

Orian Research Consultants

US +1 (415) 830-3727| UK +44 020 8144-71-27

Email: [emailprotected]

See the article here:
Global Direct Patients Genetic Testing Market Analysis and Forecast to by Top Key Players, Trend, Size, Industry Growth, Demand, Applications, Share...

Recommendation and review posted by Bethany Smith

Abstract

Women harboring heterozygous germline mutations of BRCA2 have a 50 to 80% risk of developing breast cancer, yet the pathogenesis of these cancers is poorly understood. To reveal early steps in BRCA2-associated carcinogenesis, we analyzed sorted cell populations from freshly-isolated, non-cancerous breast tissues of BRCA2 mutation carriers and matched controls. Single-cell whole-genome sequencing demonstrates that >25% of BRCA2 carrier (BRCA2mut/+) luminal progenitor (LP) cells exhibit sub-chromosomal copy number variations, which are rarely observed in non-carriers. Correspondingly, primary BRCA2mut/+ breast epithelia exhibit DNA damage together with attenuated replication checkpoint and apoptotic responses, and an age-associated expansion of the LP compartment. We provide evidence that these phenotypes do not require loss of the wild-type BRCA2 allele. Collectively, our findings suggest that BRCA2 haploinsufficiency and associated DNA damage precede histologic abnormalities in vivo. Using these hallmarks of cancer predisposition will yield unanticipated opportunities for improved risk assessment and prevention strategies in high-risk patients.

Breast cancers arising in women who inherit heterozygous mutations in BRCA2 are associated with a high prevalence of genomic alterations and aggressive clinical behavior (1, 2). Because of the high risk of these cancers in BRCA2 mutation carriers, many such women elect to undergo bilateral mastectomy for breast cancer prevention. However, despite the unmet need for more effective breast cancer prevention approaches in this setting, the stepwise evolution from an otherwise normal BRCA2 heterozygous mutant (BRCA2mut/+) cell to an invasive malignancy has not been defined. Homozygous loss of BRCA2 is embryonically lethal (35), and acute loss in cultured cells rapidly leads to DNA damage and growth arrest or cell death (68). These observations suggest a multistep pathogenesis in which homozygous BRCA2 loss is not the earliest genetic event but rather that the wild-type BRCA2 allele may remain intact as early genetic changes accumulate. Critically, however, this scenario leaves unresolved the nature and enabling mechanism for early cancer evolution. Haploinsufficiency for BRCA2 has been proposed as a possible driver of early pathogenesis, but direct evidence for such an effect in the normal human mammary gland is inconsistent. Furthermore, heterozygous genetically engineered mouse models (GEMMs) of BRCA2 are not tumor prone and therefore represent a poor model of precancerous evolution in this setting (35, 8, 9). While the BRCA1 tumor suppressor shares many of these features (9, 10), the pathogenesis of BRCA1- versus BRCA2-associated breast cancers may differ in important ways, as the former are primarily hormone receptor (HR) and HER2-negative tumors, while the latter are primarily HR positive (11).

We sought to unveil the earliest steps in the pathogenesis of BRCA2-associated breast tumors through detailed analysis of histologically normal glands from women harboring germline deleterious mutations who elected to undergo bilateral prophylactic mastectomy. Genomic analysis of individual cells revealed frequent polyclonal chromosomal damage, which was most prevalent among the subset of epithelial cells that are the suspected cells of origin of these cancers. Corresponding defects in replication stress and DNA damage checkpoint responses in these same cells collectively define a previously unappreciated phenotype for BRCA2 that precedes histologic abnormalities in the human breast. The discovery of these precancerous hallmarks paves the way for improving clinical risk prediction and cancer prevention in this population.

We carried out detailed analysis of noncancerous glands from BRCA2 carriers who elected to undergo bilateral prophylactic mastectomy, using as control tissues from women matched for age, menopausal status, and hormonal exposure electing cosmetic breast surgery (Fig. 1A and table S1). None of these women had a previous breast cancer diagnosis or chemotherapy exposure, and no occult cancers were detected upon histologic analysis of the tissues we analyzed (table S1). We used established markers to carry out flow cytometrybased isolation and sorting of the three major epithelial cell subpopulations: mature luminal (ML), luminal progenitor (LP), and basal epithelial cells (Fig. 1A). Notably, data from GEMMs and gene expression analyses of human tumors have suggested that the cell of origin of BRCA1-associated breast cancer is the LP cell (12, 13), while BRCA2-associated tumors may arise from an LP-related cell or a more ML cell (14).

(A) Workflow depicts dissociation and isolation of human breast epithelial cells from BRCA2 carrier (BRCA2mut/+) prophylactic mastectomy and control [wild-type (WT)] elective mammoplasty cases for subsequent analyses, as indicated. Dot plot at center shows representative flow cytometry sorting via CD49f and EpCAM of ML, LP, and basal epithelial cells. FACS, fluorescence-activated cell sorting. (B) Summary of single-cell whole-genome sequencing (WGS) analysis of flow-sorted, primary uncultured breast epithelial cells. Copy number variation (CNV) calls for individual cells (rows) across the genome (x axis; Chr, chromosome) are shown, with gains and losses boxed. Cell types and genotypes are indicated at the top left, and individual patient ID numbers are indicated at the right. In total, 252 sequenced breast epithelial cells from BRCA2mut/+ (n = 5) and control (n = 2) tissue specimens are depicted. (C) Bar chart depicting the prevalence of CNVs in LP (L) and basal (B) cells of BRCA2 carrier and control (WT) patients. Color code depicts the number of CNVs identified per cell. (D) LP cells from BRCA2 carriers are significantly more likely to harbor CNVs than basal cells. P value is determined by 2 test.

Among the earliest events in cancer evolution are thought to be polyclonal somatic genomic alterations. Accordingly, we looked for the presence of somatic copy number variations (CNVs) at high resolution through single-cell whole-genome sequencing (WGS) of uncultured, flow-sorted primary LP and basal epithelial cells from BRCA2 carriers and controls. Low-coverage WGS provides sufficiently high resolution to identify subchromosomal CNVs as small as 10 Mb, and our methodology for single-cell whole-genome amplification and analysis has been previously validated (15, 16). We carried out WGS to an average depth between 0.1 to 0.05 and then used two independent algorithms (HMMcopy and DNAcopy) to assign and confirm copy number changes across the genome (15, 16). Previous studies using this methodology have demonstrated that in unselected individuals, the proportion of cells with any such CNVs is very low (<5% of cells) in normal epithelial and brain tissues (16). In contrast, among nearly 100 individual LP cells from a cohort of BRCA2 carriers analyzed by WGS, we observed that 27% demonstrated one or more CNVs of >10 Mb (Fig. 1, B to D). Applying this methodology to an equal number of basal breast epithelial cells from the same individuals also revealed a substantial excess of cells harboring CNVs (13%), although significantly less than the proportion of CNV-positive LP cells (P = 0.04) (Fig. 1, B to D). By comparison, a parallel WGS analysis of sorted LP and basal cells from noncarriers revealed a single CNV in 90 cells (Fig. 1, B and C). As further validation of our sequencing and analysis pipelines, we reanalyzed existing data from normal skin and brain cells sequenced on the same platform. The overall sequence quality was comparable between these cells and the breast epithelial cells, and we confirmed the low prevalence of CNV-positive cells in 142 skin and brain cells sequenced (fig. S1). Thus, breast epithelia, and particularly, LP cells from noncancerous breast tissue of BRCA2 carriers harbor frequent subchromosomal aneuploid events (Fig. 1D and fig. S2A).

One notable CNV we observed was duplication of the entire chromosome 1q arm, which is a common genomic abnormality in breast cancer (Fig. 2A) (17). Most of the identified CNVs were subchromosomal haploid losses, consistent with the widespread pattern of losses observed in BRCA2-associated breast cancer (Fig. 2A and fig. S2B) (1). In some cases, identical losses were shared between multiple cells of the same patient, a finding that could conceivably correspond to early clonal evolution (Fig. 2B). None of the losses in any cell involved the BRCA2 locus on chromosome 13 (Fig. 1B and fig. S2, B to E). Previous analyses of germline BRCA2-associated breast cancers have demonstrated that most genetic loss-of-heterozygosity (LOH) events for BRCA2 itself are >10 Mb and therefore would have been detected by our analysis (18). This observation suggests that the wild-type BRCA2 allele is intact in our cases, implying that accumulation of subchromosomal aneuploidy may be a haploinsufficient phenotype. To confirm the integrity of the wild-type allele, we performed targeted polymerase chain reaction (PCR) amplification of the locus surrounding the patient-specific BRCA2 mutation from individual cells. Although efficiency for detection of either allele was low, we did not observe a bias toward detection of the mutant allele alone in the cells analyzed (Fig. 2C and table S2). Together, these findings imply that subchromosomal aneuploidy is an early and potentially haploinsufficient phenotype in BRCA2mut/+ breast epithelia.

(A) Representative segmentation plots of individual LP (n = 4) and basal (n = 2) cells harboring CNVs from four BRCA2 mutation carriers. Y axis depicts normalized WGS read counts across the genome (x axis). Red dots indicate region of gain, whereas blue dots indicate losses. Patient ID numbers are indicated at the right. (B) Segmentation plots of three LP cells that share a clonal loss (red box) in a BRCA2 carrier (patient 131). Zoomed-in images of the clonal loss are shown at the right. (C) Representative chromatograms from single-cell PCR-based Sanger sequencing of genomic DNA in a BRCA2mut/+ LP cell. The presence of a heterozygous single-nucleotide polymorphism (SNP) and the superimposition of sequences adjacent to the frameshift mutation suggest that LOH has not occurred.

The presence of viable aneuploid cells in BRCA2mut/+ tissues suggested ongoing DNA damage and/or a deregulated stress/damage response. Thus, we next used an independent method to directly assess DNA damage in single cells, the comet assay. This assay uses cells embedded in agarose that are lysed and then subjected to electrophoresis, causing broken DNA structures to migrate toward the anode, thus forming a comet tail (19). We briefly cultured freshly collected cells from BRCA2 carriers or controls under ultralow attachment conditions (48 to 72 hours) to select for epithelial progenitor cells before plating (20). Consistently, cells from BRCA2 carriers demonstrated increased DNA breaks at baseline compared to controls (Fig. 3A). In addition, inducing replication stress by treatment with hydroxyurea (HU) led to further increases in DNA damage in BRCA2mut/+ cells, potentially reflecting the established role of BRCA2 in protection of stalled replication forks (Fig. 3A) (21).

(A) Representative images of comet assays performed on primary human breast epithelial cells isolated from control (WT) and BRCA2mut/+ tissues. Red lines highlight tail of broken DNA. Graph below summarizes data from n = 3 patients per genotype (50 cells per patient). Cells were either untreated (Unt) or treated with HU for 4 hours. Data are depicted as fold change in tail DNA intensity. P values are determined by unpaired t test. ***P < 0.001 and ****P < 0.0001. Error bars indicate SD. (B) Representative confocal immunofluorescence staining of primary breast epithelial cells for p-CHEK1 (Ser317) shows increased nuclear staining following HU treatment only in control (WT) but not in BRCA2mut/+ cells. Graph at the right summarizes nuclear fluorescence of individual cells (dots) (n = 4 patients for control and n = 3 patients for BRCA2mut/+; four fields counted per condition per patient). P values are determined by unpaired t test. ***P < 0.001 and ****P < 0.0001. Horizontal lines indicate means and SDs. Scale bars, 20 m. (C) Chromatograms depicting Sanger DNA sequencing of a cytospin of primary breast cells assayed in (B) from a BRCA2mut/+ patient harboring BRCA2 5799_5802delCCAA (p.Asn1933Lysfs). The superimposition of sequences adjacent to the frameshift mutation suggests that LOH has not occurred. (D) Heat map of RNA sequencing (RNA-seq) data from freshly sorted cells shows differential expression of RSRD (replication stress response deficiency) genes (24) in BRCA2mut/+ LP cells (n = 7 patients) compared to control (WT) LP cells (n = 9 patients). Columns correspond to individual patients.

We then examined the response to this genomic stress by analyzing phosphorylation of CHEK1, a central coordinator of the response to replication stress and DNA damage (22, 23). Cytospins of primary epithelial progenitor cultures prepared as above were stained for phosphorylated CHEK1 at baseline or following 4 hours of exposure to HU. As anticipated, control primary epithelia exhibited increased CHEK1 phosphorylation within 4 hours of HU treatment (Fig. 3B). In contrast, however, cells from BRCA2 carriers exhibited a failure to activate CHEK1 in response to HU, despite normal levels of total CHEK1 protein (Fig. 3B and fig. S3A). DNA sequencing of these cells revealed the presence of both wild-type and mutant BRCA2 alleles (Fig. 3C). These findings provide further support for a haploinsufficient phenotype of BRCA2 in the response to genomic stress.

Because we observed a deregulated genomic stress response in vitro, we wanted to know whether this also occurs in vivo. Thus, we carried out RNA sequencing (RNA-seq) analysis of freshly sorted LP and basal epithelial cell populations from BRCA2 carrier tissues or controls (Fig. 1A). Analysis of these data revealed enrichment in BRCA2mut/+ LP cells of an established signature reflecting a failure of the ATR (Ataxia telangiectasia mutated and Rad3-related)/CHEK1 (checkpoint kinase 1)mediated replication stress checkpoint in nontransformed mammary epithelial cells (Fig. 3D and fig. S3B) (24). This replication stress response deficiency signature is known to predict future cancer risk (24), and it contains some of the top most differentially expressed genes between BRCA2mut/+ and control LP cells (Fig. 3D). Among these are genes of potential relevance to HR-positive breast cancer (which comprise 80% of BRCA2-associated breast cancers), including the estrogen receptor target gene HOXC4 and the GATA transcription factorbinding partner gene ZFPM1 (Fig. 3D) (25, 26). Furthermore, evaluation of differentially expressed programs through gene set enrichment analysis (GSEA) revealed the highly significant deregulation of a radiation response signature in BRCA2mut/+ LP cells (fig. S3C) (27). Notably, the differential expression of this signature between BRCA2mut/+ and control cells was far more significant within the LP compared to the basal population, in keeping with the more frequent occurrence of CNVs among LP cells (fig. S3C). Again, consistent with haploinsufficiency for BRCA2, the RNA-seq data showed no evidence for exclusive expression of the mutant allele in BRCA2mut/+ LP cells (fig. S3D). Thus, BRCA2mut/+ LP cells exhibit evidence of aberrant replication stress and DNA damage responses in vivo.

We then turned to examine the downstream consequences of the DNA damage detected in LP cells of BRCA2 carriers. A hallmark genetic event that cooperates with BRCA2 deficiency in cancer pathogenesis is loss of TP53, suggesting that activation of TP53 may be an early barrier to malignant progression in this setting (28). We therefore hypothesized that the failed CHEK1-dependent replication stress response we observed might ultimately lead to DNA double-strand breaks and thereby trigger TP53 activation through a CHEK1-independent pathway (29). Recent studies suggest that CHEK1 is not required for TP53 activation in primary breast epithelial cells following DNA damage (30). RNA-seq analysis did suggest activation of TP53 in BRCA2mut/+ LP cells, evidenced by the increased expression of multiple direct TP53 target genes (Fig. 4A) (31, 32). This in vivo effect was associated with a strong transcriptional profile indicating suppression of nuclear factor B (NF-B) signaling, including numerous cytokine and inflammatory factors associated with the senescence-associated secretory phenotype (SASP) (Fig. 4, B to D). TP53 is known to suppress the NF-B/SASP response (33, 34), and this effect is emerging as a relevant component of TP53-dependent tumor suppression given that accumulation of SASP-expressing cells is an established driver of tumorigenesis (35). We independently validated the corresponding alterations in NF-B protein expression, demonstrating that the NFKB1 (p50) and NFKB2 (p52) subunits were expressed at lower levels in BRCA2 carrier tissues compared to controls (Fig. 4C). Furthermore, knockdown of BRCA2 in nontransformed mammary epithelial cells via lentiviral short hairpin RNA attenuated expression of the same cytokine and NF-B target genes that were down-regulated in BRCA2mut/+ progenitor cells in vivo (fig. S4A). Similar to the damage response signature (fig. S3C), deregulation of the SASP program was selective for LP cells in BRCA2 carriers, as no significant suppression of SASP was observed in the corresponding basal epithelial cells of these same patients (fig. S4B). These results suggest that DNA damage and TP53 activation in BRCA2mut/+ LP cells are associated with suppression of the NF-B/SASP response.

(A) Bar charts show the mean expression levels of canonical TP53 target genes in freshly sorted BRCA2 carrier LP cells (n = 7 patients) compared to controls (WT; n = 9 patients), assessed by RNA-seq. Error bars denote SEM. P values are determined by Mann-Whitney test. *P < 0.05 and **P < 0.01. XPC, Xeroderma pigmentosum group C-complementing protein; FPKM, Fragments Per Kilobase of transcript per Million mapped reads. (B) Heat map depicts down-regulation of NF-B/SASP pathway genes in BRCA2 carrier LP cells compared to controls (WT), assessed by RNA-seq as in (A). Columns correspond to individual patients. Direct NF-B target genes are highlighted in red. (C) Western blot analysis shows that NFKB1 (p50) and NFKB2 (p52) subunits are expressed at lower levels in BRCA2mut/+ breast tissues compared to control (WT) tissues (n = 3 patients per genotype). -Tubulin serves as a loading control. (D) Negative enrichment of a SASP signature in GSEA of RNA-seq data from freshly sorted LP cells of BRCA2 carriers (n = 7 patients) and controls (WT; n = 9 patients). NES, normalized enrichment score; FDR, false discovery rate.

Deregulated DNA damage and senescence/SASP responses in BRCA2 LP cells might be expected to alter the proportion of these cells over time (36). We thus sought to address whether there were differences in the proportions of progenitor or other epithelial subpopulations in BRCA2mut/+ tissues compared to controls. We collected a larger cohort of tissues from BRCA2 carriers (n = 26) and controls (n = 28), then performed flow cytometric analysis on these specimens, and plotted the proportions of each epithelial subpopulation as a function of age for each cohort (Fig. 5A). In noncarrier controls, no significant age-associated changes in the prevalence of these subpopulations were noted. In contrast, BRCA2 carriers showed an age-associated expansion in the proportion of LP cells and a decline in the basal cell fraction (Fig. 5B and fig. S5, A and B). These differences were not accounted for by demographic factors such as parity or menopausal status, as these factors were not associated with significant differences in epithelial cell proportions (fig. S5, C and D). Thus, DNA damage and suppression of a senescence-associated program in BRCA2mut/+ LP cells are accompanied by an age-associated expansion of this progenitor cell compartment (36).

(A) Representative flow cytometry analysis showing distinct epithelial subpopulations (basal, LP, and ML) isolated from breast tissues of control (WT) and BRCA2 mutation carriers following sorting via CD49f and EpCAM staining. Numbers indicate percentages of each epithelial cell subpopulation. (B) Linear regression analysis of LP and basal cell proportions by age for controls (WT) (n = 26 patients) and BRCA2 carriers (n = 28 patients). The LP/basal ratio by patient provides additional validation as it accounts for technical factors that may have subtle effects on absolute cell numbers. (C) TUNEL (terminal deoxynucleotidyl transferasemediated deoxyuridine triphosphate nick end labeling) staining of representative control (WT) and BRCA2 carrier tissues. Summary data obtained by counting four fields for five patients per genotype are shown. ****P < 0.0001 by Fishers exact test.

Last, we hypothesized that altered epithelial cell proportions and a deregulated NF-B/SASP program in BRCA2 carrier tissues may be associated with differences in cell proliferation and/or survival in vivo (36). We did not observe strong differences in proliferation assessed by Ki67 staining between these BRCA2 carrier breast tissues and controls, prompting us to ask whether differences in cell survival might contribute to the age-associated expansion of the LP population in this context. We therefore carried out TUNEL (terminal deoxynucleotidyl transferasemediated deoxyuridine triphosphate nick end labeling) staining, an established marker of apoptosis, in BRCA2 carrier tissues and controls. The proportion of TUNEL-positive cells is well documented in normal human breast epithelial tissues, and we observed a similar prevalence of these cells in the control tissues we tested (Fig. 5C) (37). In contrast, however, BRCA2 mutation carrier tissues consistently showed a paucity of TUNEL-positive luminal epithelial cells across all patients tested, in keeping with established links between checkpoint and NF-B suppression and a defective apoptotic response (Fig. 5C) (38, 39). Collectively, our findings suggest that noncancerous BRCA2mut/+ breast tissues exhibit BRCA2 haploinsufficiency and an age-associated accumulation of DNA-damaged luminal epithelial progenitor cells bearing altered checkpoint and survival responses (Fig. 6).

Epithelial progenitor cells of heterozygous germline BRCA2 carriers exhibit DNA damage, failed replication stress, and damage responses, together with attenuated apoptosis. LOH analyses suggest that these findings may reflect a haploinsufficient phenotype for BRCA2 in vivo.

This study advances our understanding of early changes in BRCA2mut/+ breast tissues, defining unanticipated phenotypes in this setting with implications for both cancer risk assessment and prevention. Most of the tissues we studied were deemed to be histologically normal by highly experienced breast pathologists, suggesting that the alterations we report precede clinically defined cellular abnormalities (tables S1 and S3). We present evidence that a failed replication stress response and DNA damage in BRCA2mut/+ tissues result from haploinsufficiency for BRCA2 rather than homozygous loss of function. While the presence of haploinsufficiency for either BRCA1 or BRCA2 in vivo has been controversial, our findings are in accord with data suggesting that LOH for the wild-type BRCA2 is not universal in BRCA2-associated cancers (40). Our observations are also in keeping with a recent report that the BRCA2 protein is selectively susceptible to degradation by environmental aldehydes (41), an effect that could contribute to a haploinsufficient phenotype in cells with only one functional BRCA2 allele. Nonetheless, we analyzed a relatively small number of cells and tissues, and it is difficult to definitively rule out LOH in a subset of cells. Thus, our study suggests, rather than confirms, haploinsufficiency for BRCA2 as a potential initiating event for these cancers.

A prominent feature of the phenotype we have uncovered is frequent subchromosomal aneuploidy, most prevalent within the LP cell population. LP cells are a potential target cell for BRCA2-associated carcinogenesis in the breast, and indeed we observe instances of apparently clonally related genomic alterations among these cells. While our study does not prove that they are direct cancer precursors, these alterations could conceivably represent the earliest somatic genetic abnormalities that underlie these malignancies. Notably, all the CNVs we identified were subchromosomal and therefore are to be distinguished from whole-chromosome gains and losses that are typically later events and associated with TP53 inactivation (42).

Although the early genomic changes we observed are likely to include many passenger events, they, nevertheless, may provide a quantifiable hallmark of the preneoplastic BRCA2 carrier state. Tracking the prevalence of DNA-damaged cells in the clinical setting could possibly improve risk prediction for these women, who are faced with the difficult choice of whether to undergo mastectomy long before cancer develops. Last, the BRCA2 haploinsufficient phenotype we report may portend particular vulnerabilities of certain BRCA2mut/+ cancer precursor cells. Accordingly, this work provides a foundation for future studies seeking to identify improved pharmacologic approaches to cancer prevention in this setting.

Fresh human breast tissues were obtained from the Massachusetts General Hospital with approval by the local Institutional Review Board and signed informed patient consent (protocols 93-085 and 2008-P-1789). Samples were either normal breast tissues from reduction mammoplasties (confirmed by pathology) or noncancerous breast tissues from prophylactic mastectomies of known BRCA1 or BRCA2 mutation carriers. All BRCA1/2 carrier status was determined through clinical germline genetic testing performed by commercial providers before tissue collection.

Tissue samples were minced and digested with collagenase/hyaluronidase (STEMCELL Technologies) in complete EpiCult-B medium supplemented with hydrocortisone (0.48 g/ml; STEMCELL Technologies) overnight at 37C. The resulting suspensions were either cryopreserved or further sequentially digested with 0.25% trypsin, dispase (5 mg/ml), and deoxyribonuclease I (1 mg/ml). Single-cell suspensions were collected by filtration through a 40-m cell strainer.

Cells were blocked with rat immunoglobulin (Jackson ImmunoLabs) and antibody to Fc receptorbinding inhibitor (eBioscience) before incubation with the following primary antibodies: phycoerythrin (PE)conjugated anti-human CD31 (BD Pharmingen), PE-conjugated anti-human CD45 (BD Pharmingen), PE-conjugated anti-human CD235a (BD Pharmingen), BV650-conjugated anti-human epithelial cell adhesion molecule (EpCAM) CD326 (BioLegend), and biotin-conjugated anti-human ITGA6 (eBioscience). Where required, cells were incubated with allophycocyanin-Cy7conjugated streptavidin (BD Pharmingen). Cells were either stained with 4,6-diamidino-2-phenylindole (DAPI) for viability or fixed with 1% paraformaldehyde and stained with the Zombie Aqua Fixable Viability Kit (BioLegend). Viable cells were sorted on a FACSAria flow cytometer (Becton Dickinson). Data were analyzed using FlowJo software (Tree Star).

Microaspirated single cells were transferred into PCR tubes containing lysis buffer [water + proteinase K (400 ng/l) + 17 M SDS], and DNA was amplified by nested PCR using primers flanking BRCA2 mutations. Sanger sequencing was performed by the Center for Computational and Integrative Biology DNA Core Facility at the Massachusetts General Hospital.

Primer sequences for patient 128 (Val3079PhefsX4) are as follows: first PCR, TGGCGTCCATCATCAGATTT (forward) and TCAGAGGTTCAAAGAGGCTTAC (reverse); second PCR, CAGATTTACCAGCCACGGGA (forward) and GCCAACTGGTAGCTCCAACTAA (reverse). Primer sequences for patient 140 (6027del4) are as follows: first PCR, GGGCCACCTGCATTTAGGAT (forward) and TGAGCTGGTCTGAATGTTCGT (reverse); second PCR, GCAGGTTGTTACGAGGCATT (forward) and CCTGGACAGATTTTCCACTTGC (reverse).

Single-cell suspensions from patient samples were plated in ultralow adherence plates in Dulbeccos modified Eagles medium/F12 medium containing insulin (5 g/ml), epidermal growth factor (10 ng/ml), basic fibroblast growth factor (5 ng/ml), heparin (4 g/ml), hydrocortisone (500 ng/ml), B27, GlutaMAX, and penicillin-streptomycin. Cells were either treated with HU (10 mM; Sigma) for 4 hours or left untreated and washed with phosphate-buffered saline (PBS), and alkaline comet assays were performed using a Trevigen Comet Assay kit according to the manufacturers instructions. Olive tail movement was quantified with ImageJ, and 50 individual cells were quantified per condition.

Immunofluorescence for paraffin sections and TUNEL staining were performed by Dana-Farber/Harvard Cancer Center Specialized Histopathology Core. For immunofluorescence in cells, fixation was performed with methanol for 10 min, followed by permeabilization in 0.1% Triton X-100 for 2 min. Blocking was performed with 10% horse serum for 30 min, and cells were further incubated with primary p-CHEK1 antibody (Novus Biologicals) for 2 hours, washed with wash buffer (PBS + 10% horse serum + 0.1% Triton X-100), incubated with appropriate secondary antibody for 1 hour, and stained with DAPI. All immunofluorescence images were captured by a confocal microscope (Leica TCS SP8) and were analyzed by ImageJ.

Snap-frozen tissues were homogenized using Precellys 24 homogenizer (Bertin Technologies). For total protein extraction, cells were lysed in radioimmunoprecipitation assay buffer [10 mM tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% sodium deoxycholate, 0.1% (w/v) SDS, 1% (v/v) NP-40, proteinase inhibitor cocktail, and phosphatase inhibitor cocktail] for 30 min on ice. Western blotting was performed using NFKB1 p50 (Santa Cruz Biotechnology) and NFKB2 p52 (Millipore) antibodies by standard protocol.

Fresh tissues were dissociated as described above, and single cells were isolated by microaspiration. Genomic DNA was amplified and sequenced as described in (16). Fastqs were aligned using bwa-mem, with resulting bams sorted and duplicates marked using Picard. Coverage was then computed over 500-kb bins across the entire genome. The count for each bin was then divided by the sum across all bins for the relative sample (to correct for library size) and then by the median for that genomic bin across all samples from the same batch. The coverage profiles were then transformed into .wig files and fed into the R package HMMcopy for segmentation and CNV calling. HMMCopy was run with e = 0.9999999 and nu = 5, with all other parameters set to default. A noise statistic termed VS was computed in the same manner as (16), with cells with values greater than or equal to 0.5 being excluded from the analysis. CNVs that mapped to the Y chromosome were less than 10 Mb in size or had an absolute log2 ratio of less than 0.4 that were excluded from the analysis.

Total RNA from sorted cell populations was extracted using an RNeasy FFPE kit according to the manufacturers instructions. Libraries for ribosomally reduced RNA were prepared by the Harvard Biopolymers Facility using directional RNA-seq Wafergen protocol. Libraries were sequenced on Illumina HiSeq 2000 at Next-Generation Sequencing Core at Massachusetts General Hospital. Transcripts per million (TPM) values were computed using Salmon and batch-corrected using ComBat. The two samples with the lowest total counts were excluded from the analysis. GSEA was run on the ComBat-corrected TPM values using phenotype permutation and default parameters. The heat maps in Fig. 4 (B and D) were made using the ComBat-corrected TPM values, subset to the comparison of interest, and transformed into z scores by gene.

P values were determined using Students unpaired t test, unless indicated otherwise.

Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/5/eaay2611/DC1

Supplementary Materials and Methods

Fig. S1. Analysis of single-cell WGS data from normal human skin and brain cells.

Fig. S2. Identification and characterization of CNVs in freshly collected BRCA2mut/+ breast epithelial cells.

Fig. S3. Characterization of replication stress response deficiency and haploinsufficiency in BRCA2mut/+ breast epithelial cells.

Fig. S4. Suppression of NF-B/SASP response associated with loss of BRCA2.

Fig. S5. Proportions of mammary epithelial cell subsets in BRCA2 carrier and control tissues.

Table S1. Characteristics of patients undergoing WGS of breast tissues.

Table S2. Summary of single-cell site-specific PCR/sequencing data.

Table S3. Characteristics of patients undergoing RNA-seq of breast tissues.

Reference (43)

This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial license, which permits use, distribution, and reproduction in any medium, so long as the resultant use is not for commercial advantage and provided the original work is properly cited.

Acknowledgments: We thank the HSCI-CRM Flow Cytometry Core Facility for assistance with cell sorting and the MGH DF/HCC Specialized Histopathology Service Core for immunostaining experiments. We thank the Biopolymers Facility at Harvard Medical School for library processing of RNA samples and the MGH Next Generation Sequencing Core for performing RNA-seq. We are grateful to the MIT BioMicroCenter for performing genome sequencing reactions. Funding: This work was supported by DOD/CDMRP grant BC140903 (to L.W.E.), the Tracey Davis Breast Cancer Research Fund (to L.W.E.), the Weissman Family MGH Research Scholar grant (to L.W.E.), the Susan G. Komen Foundation grant PDF16380794 (to M.K.-Y.), a Terri Brodeur Breast Cancer Foundation grant 2016D001483 (to M.K.-Y.), and the Howard Hughes Medical Institute (to A.A.). Author contributions: M.K.-Y., A.A., and L.W.E. conceived and designed the study. M.C.S. contributed patient samples. M.K.-Y., R.E.S., and S.V.S. designed and performed the experiments and interpreted the data. H.R., R.M., and V.V. performed the experiments. M.K.-Y., S.V.S., E.Z., A.D., and M.Y. performed the data analysis. M.K.-Y., A.L., K.N.R., S.R., and M.L. performed the bioinformatic analysis and interpreted the data. L.W.E., A.A., and M.L. conceived the experiments, interpreted the data, and provided the funding. L.W.E. and M.K.-Y. wrote the manuscript. All authors approved the final submitted manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read the original here:
Aneuploidy and a deregulated DNA damage response suggest haploinsufficiency in breast tissues of BRCA2 mutation carriers - Science Advances

Recommendation and review posted by Bethany Smith

OSAKA An Osaka University team said it has carried out the worlds first transplant of cardiac muscle cells created from iPS cells in a physician-initiated clinical trial.

In the clinical project to verify the safety and efficacy of the therapy using induced pluripotent stem cells, Yoshiki Sawa, a professor in the universitys cardiovascular surgery unit, and colleagues aim to transplant heart muscle cell sheets over the course of three years into 10 patients suffering from serious heart malfunction caused by ischemic cardiomyopathy.

As part of its first step in the project, the team conducted an operation on a patient this month, which was a success. The patient has since moved to the general ward at a hospital.

The cells on the degradable sheets attached to the surface of the patients hearts are expected to grow and secrete a protein that can regenerate blood vessels and improve cardiac function. The iPS cells have already been derived from healthy donors blood cells and stored.

Each sheet is around 4 to 5 centimeters wide and 0.1 millimeter thick.

The team will continue to monitor the patient over the next year.

I hope that (the transplant) will become a medical technology that will save as many people as possible, as Ive seen many lives that I couldnt save, Sawa said at a news conference.

The researchers said Monday they decided to conduct a clinical trial instead of a clinical study in hopes of obtaining approval from the health ministry for clinical applications as soon as possible.

The trial involves stringently evaluating risks, particularly cancer probabilities, and the efficacy of transplanting some 100 million cells per patient that may include tumor cells.

This is the second iPS cell-based clinical trial in Japan. The first was conducted on eye disease patients by the Riken research institute.

More:
Osaka University transplants iPS cell-based heart cells in world's first clinical trial - The Japan Times

Recommendation and review posted by Bethany Smith

A team based at Osaka University stated how it had succeeded in carrying out the first transplant of cardiac muscle cells, around the globe, developed from iPS cells in a clinical trial which as physician-initiated.

A professor in Osaka Universitys cardiovascular surgery unit, Yoshiki Sawa, along with his colleagues at the university, intend to transplant heart muscle cell sheets into 10 individuals experiencing severe heart malfunction as a result of ischemic cardiomyopathy, in a clinical trial, to validate the safety and the effectiveness of the therapy with the use of induced pluripotent stem cells.

On the surface of the hearts of the partaking individuals, the cells on the degradable sheets are attached. It is predicted that these cells will develop to release a protein that can allow for the regeneration of blood vessels as well as the improvement of the cardiac function.

Already, the iPS cells have been taken, and then stored, from the blood cells donated by healthy individuals

On Monday, the researchers stated how they chose to carry out a clinical trial in a clinical researchs stead as they had hoped to attain, as early as possible, authorization from the health ministry for clinical applications.

There are severe evaluating risks involved in the clinical trial. These may include the possibility of cancer as well as the efficacy of transplanting many million cells per patient, which may consist of tumor cells.

In Japan, this will be marked as the second clinical trial based on iPS. The first clinical trial of such kind was carried out on patients suffering from eye-linked ailments. This was done so by the Riken research institute.

Read the original:
Osaka University-based team successfully conducts first transplantation of cardiac muscle cells around the globe - Medical Herald

Recommendation and review posted by Bethany Smith

A handful of the buzzy products of Peter Thomas Roth are at the center of a strongly-worded lawsuit, one that accuses the New York-based skincare company which boasts about its richly nourishing and technologically advanced offerings of peddling pseudoscience and falsifying the effectiveness of its hyaluronic acid-soaked skin creams and rose stem cell-formulated face masks in an attempt to stand out in the fiercely competitive $135 billion-plus skincare market and cater to the rising demand for anti-aging products among consumers.

According to the complaint that Peter Thomas Roth, LLC (Roth) customers Kari Miller and Samantha Paulson filed in a California state court in December 2018, Roth is running afoul of the law by making false claims about the capabilities of [its] products, at least some of which are among its best-selling products on Sephoras website. The plaintiffs assert that even in an industry known for hype, Roths outrageous marketing practices stand out among those of their competitors, as Roths claims about their [products] are not just hype; rather, they are demonstrably false.

Specifically, Miller and Paulson state that two of Roths product lines,the influencer-endorsed Rose Stem Cell line and the Water Drench line, are at the center of their suit, as both lines have allegedly been marketed and sold in conjunction with false and deceptive representations [about their] active ingredients rose stem cells and hyaluronic acid, respectively that have enabled Roth to profit enormously while its customers are left with overpriced, ineffective skin care products.

For instance the plaintiffs assert that in connection with its Water Drench line of products Roth represents that the active ingredient, hyaluronic acid, will draw moisture from the atmosphere into the users skin, and will hold 1,000 times its weight in water for up to 72 hours. This is impossible, they claim, as hyaluronic acid is incapable of absorbing anywhere near 1,000 times its weight in water, even when it is in its anhydrous (i.e., waterless; completely dry) form.

The judge notes that Roth softened the claim with the words up to in connection with the absorption power of thehyaluronic acid, but he also claims that subtle qualifications do not overcome the thrust of the ad, which is thatthe ad was one thousand times its weight in water.

As for Roths line of Rose Stem Cell products, which the brand claims are are capable of repairing, regenerating, and rejuvenating human skin andstimulating cellular turnoveras a result of the inclusion of rose stem cells, the plaintiffs argue that there is absolutely no evidence thatrosestem cells can provide such benefits. They allege thatRothis clearly attempting to capitalize on the recent media attention that has been given to medical research of human stem cells, with the goal of confusing consumers and causing them to erroneously believe that they will receive significant health benefits by using the Rose Stem Cell Products.

Such pseudo-science has enabled Roth to sell over-priced products to a growing market for skin care products, whileenjoying an unlawful advantage over [its] competitors, the plaintiffs assert in the suit, which has since been transferred from California state court to federal court.

In a couple of recent developments in the case, Judge William Alsup of the U.S. District Court for the Northern District of California denied the plaintiffs bid for class action approval, a move that would enable other individuals who have purchased the allegedly misrepresented products to join in their suit and any ultimate settlement sum. According to Judge Alsups January 22 decision, The plaintiffs can obtain their requested liability determination [for their false advertising claims] and statewide injunction against Roths challenged ads without certifying a class.

Meanwhile, in a separate January 22 order, the judge decided on Roths motion for summary judgment, refusing (for the most part) to issue a final decision resolving the plaintiffs claims ahead of trial because there are still issues of fact to be determined, namely whether Roths marketing claims are deceptive.

According to Judge Alsup, it is unclear how a reasonable consumer might view the marketing claims that Roth uses in connection with its Rose Stem Cell Mask namely, the labels, rose stem cells, cutting edge bio-technology, bio-repair, regenerates, and rejuvenates. While some reasonable consumers might interpret this [language] as mere puffery, and thus, not objective, actionable statements, others could sensibly conclude that rose stem cells actually repair human skin, which the plaintiffs argue is untrue, thereby, making the marketing claims deceptive.

In terms of Roths Water Drench line of products, the judge states that the plaintiffs contend the reasonable consumer would believe that hyaluronic acidactually canattract and retain one thousand times its weight in water, and in fact, a jury could find that, based on the ad, reasonable consumers would expect that hyaluronic acid absorbs and retains about one thousand times its weight in water.As such, these issues must go before a jury, which, Judge Alsup says will look forward to an in-court demonstration in which a certain amount of hyaluronic acid is placed in a beaker, one thousand times that weight in water is placed in another beaker, and the contents are combined, all watching to see if all the water will be absorbed.

*The case is Kari Miller, et al., v. Peter Thomas Roth, LLC, et al.,3:19-cv-00698 (N.D.Cal.)

Read this article:
Consumer Claims Over Peter Thomas Roth's Alleged "False Advertising" of Skincare Products to Go to Jury - The Fashion Law

Recommendation and review posted by Bethany Smith

Are you over tired-looking winter skin? IMAGE has teamed up with Allure Beauty and Nail Spa to give TWO lucky readers the chance to win an Image SkincareRenewal Ritual Collection to transform your skin and get you spring-ready.

With spring just around the corner, it's time to start prepping our skin for those dewy make-up looks we'll be rocking.

The harsher weather has dried out and puffed up our face and lips so much we're in serious need of a skin transformation.

Enter Allure beauty and Nail Spa, which is giving away two Image SkincareRenewal Ritual Collections worth a whopping 140 to two very lucky IMAGE readers.

Image is just one of the premium brands Allure stocks in its Drumcondra salon. It offers a wide range of luxurious Image Skincare facials, like its O2 Lift Facial, which is ahydration and oxygen combination that promotes divine hydration,infusing oxygen, plant-derived anti-ageing stem cells, peptides and a high concentration of enzymatic botanicals into the skin leaving it luminous, refreshed and rejuvenated.

There are a number of peels on offer using Image products, like the Ormedic Lift treatment that promises to recharge the youthfulness factor within the skin and increase internal hydration, or the Acne Lift, which is abeta and alpha-hydroxy acid cocktail giving antibacterial, anti-inflammatory and antiseptic benefits to fragile compromised and reactive skin.

And now you can treat yourself at home, and get your face spring-ready with thisRenewal Ritual Collection. There is one prize for each person.

WHATS INSIDE:

For your chance to win this transformative collection, enter the form below before midnight on Friday, February 14, 2020.

*Click here for IMAGE competition terms and conditions.

For more information on Allure treatments, see here.

Read more from the original source:
Win an Image Renewal Ritual Collection worth 140 from Allure - image.ie

Recommendation and review posted by Bethany Smith

SAN FRANCISCO, Jan. 29, 2020 /PRNewswire/ -- The story of Alzheimer's disease is familiar and heartbreaking. As neurons degenerate and die, patients slowly lose their memories, their thinking skills, and ultimately, their ability to perform basicday-to-day tasks.

For years, clinical trials investigating potential treatments for Alzheimer's disease have come up short. That's why researchers at Gladstone Institutes are delving deeper into the question of what drives this complex disease.

Now, a team led by Senior Investigator and President EmeritusRobert Mahley, MD, PhD, has received $4.8 million from the National Institutes of Health (NIH) to study a promising culprit: apoE4, a protein associated with increased risk of Alzheimer's disease.

ApoE4 is one of the forms of apolipoprotein E, a protein that aids repair processes in neurons injured by aging, stroke, or other causes. The most common form is called apoE3, but apoE4 is not rare: it is found in one-quarter of the human population and in about two-thirds of all Alzheimer's patients, which makes it the most important genetic risk factor for the disorder.

"ApoE4 dramatically rewires cellular pathways in neurons and impairs their function," Mahley said. "Our goal is to understand how this rewiring occurs and identify potential new treatment strategies to negate the detrimental effects."

ApoE3 and apoE4 differ at only a single point in the sequence of their amino acid building blocks. But that single change gives apoE4 a very different shape from apoE3, making it more susceptible to being broken down into smaller fragments within a neuron.

"Our work suggests that these apoE4 fragments are toxic to neurons and cause sweeping changes to the collection of proteins expressed within a neuron," Mahley said. "We suspect that their toxicity may underlie much of the neurodegeneration seen in Alzheimer's disease."

A Powerful Partnership

With the new NIH funding, Mahley hopes to illuminate the specifics of apoE4's toxicity in unprecedented molecular detail. Key to this work is his new partnership with Senior InvestigatorNevan Krogan, PhD, and Gladstone Mass Spectrometry Facility Director Danielle Swaney, PhD, who together have extensive expertise in studying how proteins interact with each other.

To get to the bottom of apoE4's impact, they will use a technique called affinity purification mass spectrometry (AP-MS)to first determine which proteins, out of the thousands found in a single cell, interact directly with apoE4 fragments.

"AP-MS is an important first step because it will allow us to define physical interactions between proteins that may underlie the functional deficits observed in neurons that express apoE4," Swaney said. The AP-MS work will be performed in mouse-derived neuronal cells that are similar to human neurons.

In addition to AP-MS, the collaborators will use other advanced protein analysis techniques perfected in Krogan's lab to better understand the cellular processes that are dysregulated in apoE4-expressing neurons. This additional protein work will be performed in neurons derived from human induced pluripotent stem (hiPS) cells. These stem cells are produced from human skin cells, using the procedure developed byShinya Yamanaka, MD, PhD, a Gladstone senior investigator and 2012 Nobel prize winner.

"We are quite excited to be involved in this project," Krogan said. "My lab has successfully applied AP-MS and other cutting-edge proteomic and genetic techniques to many different diseases, and we now hope to enable a much deeper understanding of apoE4."

When combined, results from the APMS work and the additional protein analyses will reveal a list of key proteins involved in processes that are specifically altered in apoE4 neurons compared to apoE3 neurons.

From that list, Mahley and Swaney will select top candidates for further investigation in neurons grown from hiPS cells. Senior InvestigatorYadong Huang, MD, PhD, who has also studied apoE4 extensively, will provide guidance on the use of the hiPS cells.

Using a gene-editing tool called CRISPR, the researchers will see if they can reverse the detrimental effects of apoE4 by activating or inhibiting genes that control their top candidate proteins in the hiPS cell-derived neurons. Finally, they will validate the findings in mice.

"By the end of the project, we hope to narrow down our list to just a few target genes or proteins that protect or restore neuronal health when we activate or inhibit them in live mice with the apoE4 gene," Swaney said. "They could then be explored as potential targets for Alzheimer's treatment in humans."

New Hope for Alzheimer's Disease

Mahley and Swaney already have some ideas about where this work may lead. Earlier this year,they publishedevidence that apoE4 broadly impacts the mitochondriaorganelles that produce the energy that powers a celland perturbs normal energy production.

"Anything could be a target at this point, but I'm particularly interested in the possibility of small-molecule drugs that could protect mitochondria from toxic apoE4 fragments," Mahley said.

Still, mitochondria are just one aspect of the bigger picture. Mahley suspects that what we call "Alzheimer's disease" is actually a collection of related conditions with different underlying causes for different patients.

"Ultimately, I think the treatment of Alzheimer's disease will be similar to the treatment of high blood pressure, in that two, three, sometimes four drugs are needed to control the disorder," he said. "So, we may need a mitochondrial protector, we may need a drug that will correctapoE4's shapeso that it is more like apoE3, and more."

Understanding the complex effects of apoE4as well as the other Alzheimer's disease-associated factorsbeing explored at Gladstonecould one day enable just such a comprehensive approach.

Media Contact:Megan McDevittmegan.mcdevitt@gladstone.ucsf.edu415.734.2019

Related Images

team-of-researchers-who-received.jpg Team of Researchers who Received the Grant Gladstone Senior Investigator and President Emeritus Bob Mahley (center) will collaborate with the director of the Gladstone Mass Spectrometry Facility, Danielle Swaney (left), and Senior Investigator Nevan Krogan (right) to uncover the mechanisms of apoE4 toxicity in Alzheimer's disease.

Related Links

Gladstone Release

View original content to download multimedia:http://www.prnewswire.com/news-releases/gladstone-scientists-funded-by-nih-to-dive-deep-into-apoe4s-role-in-alzheimers-disease-300995752.html

SOURCE Gladstone Institutes

See original here:
Gladstone Scientists Funded by NIH to Dive Deep Into ApoE4's Role in Alzheimer's Disease - P&T Community

Recommendation and review posted by Bethany Smith

Robots are pathetic. You need only watch a robot soccer fail compilation to see that humans ancient quest to build synthetic replicas of ourselves out of nuts, bolts and wiring has been a bust. Every new, groundbreaking robot inevitably turns out to be an ungodly abomination, either physically inept or utterly incapable of social interaction. Our latest attempt at a full-on humanoid, Sophia, looks like a pre-loved department store mannequin and sounds like a 2007-era chatbot dialed to the VERY DEPRESSED setting. Shed be a walking repudiation of brainless techno-optimism, if she could actually walk.

Even attempts to build simpler, dog-like droids, such as Boston Dynamics Spot, have produced robots barely worthy of the name. They dont look much better than what youd expect from an adult Erector set enthusiasts weekend garage projects. Some people find these things terrifying, but I take my cues from the manufacturers, who seem incredibly proud when one of their creations performs a task as easy as opening a door.

Imitating human intelligence in software has also proven a task more difficult than expected. Despite the well-financed wet dreams of companies like Uber, the automotive industry has begun to quietly admit that truly self-driving cars are going to happen in decades, not just a few years from now. The Blue Brain project, which received a billion euros from the EU in 2013 and promised to simulate a human brain by 2019, did not succeed. Blue Brain seems to have had some success building a 3D atlas of a mouse brain, but the projects supercomputer, which takes up an entire room, is heaving and groaning under the strain of doing the same for a human mind. Valiant efforts to simulate a transparent, one millimetre nematode called C. elegans, ongoing since 2004, have yielded similarly slow progress. C. elegans has 302 neurons. The human brain has 86 billion.

These stuff-ups are endlessly amusing to me. I dont want to mock the engineers who pour thousands of hours into building novelty dogs made of bits of broken toasters, or even the vertiginously arrogant scientists who thought they could simulate the human brain inside a decade. (Inside a decade! I mean, my god!) Well, okay, maybe I do want to mock them. Is it a crime to enjoy watching our cultures systematic over-investment in digital Whiggery get written down in value time and time again?

On the other hand, maybe the people doing this stuff have just figured out that attaching the terms robot or artificial intelligence to whatever youre up to is a great way of attracting investment from rich idiots. Sometimes I feel naive for thinking anyone takes these wild claims seriously, but that is precisely the power of a good ideology. The promises of robotics and AI are so seductive that people suspend their critical faculties. Whether you are a business like Uber striving to eliminate the messy and expensive production input known as human beings, or a normal person desperate for easy transportation or someone to keep your elderly relatives company, the way we talk about robots and AI suggests these smart solutions are just around the corner. Even people with their heads screwed on properly dont seem to understand how credulously the media hypes up their coverage of AI.

What these doomed overreaches represent is a failure to grasp the limits of human knowledge. We dont have a comprehensive idea of how the brain works. There is no solid agreement on what consciousness really is. Is it divine? Is it matter? Can you smoke it? Do these questions even make sense? We dont know the purpose of sleep. We dont know what dreams are for. Sexual dimorphism in the brain remains a mystery. Are you picking up a pattern here? Even the seemingly quotidian mechanical abilities of the human body running, standing, gripping, and so on are not understood with the scientific precision that you might expect. How can you make a convincing replica of something if you dont even know what it is to begin with? We are cosmic toddlers waddling around in daddys shoes, pretending to work at the office by scribbling on the walls in crayon, and then wondering where our paychecks are.

The world is an astonishing place, and the idea that we have in our possession the basic tools needed to understand it is no more credible now than it was in Aristotles day, writes philosopher Thomas Nagel. But accepting this epistemic knuckle sandwich doesnt mean abandoning the pursuit of robotics.

Enter the frogbot, a living machine synthesized by a research team at the Allen Discovery Center at Tufts University in Boston.

Frogbots (called xenobots by their creators, a stupid name I refuse to use), are tiny little artificial animals made out of stem cells from the African clawed frog. They cant do much yet move around on two stumpy legs, carry tiny objects in a pouch but to me, they are stranger and scarier than any robot weve made out of metal and plastic.

A "frogbot" developed by researchers at Tufts University.

There are three basic steps to the frogbot process. First, stem cells that will develop into frog skin and frog heart are grown in a dish. (The proto-heart cells produce rhythmic contractions, which is how the finished frogbots move around.) Second, a computer runs an algorithm that simulates thousands and thousands of different frogbot designs in a virtual environment to see which ones are capable of whatever action you want them to perform. Finally, the designs that are likely to work are physically produced from clusters of stem cells using microsurgery, then let loose in another dish to see what they actually do. So far, they do pretty much whatever we want them to do, within reason.

This is very cool. Even though frogbots are tiny and stupid at the moment, they impress me way more than the conga line of faildroids weve managed to cobble together so far. Of course it makes sense to use materials from existing animals; weve been doing this using selective breeding techniques since the dawn of time. What are pigs or cows or sheep but frogbots built over thousands of years? The key innovation here is modelling selective evolution quickly, instead of standing around like idiots for millenia, waiting for hundreds of generations of dogs to fuck.

It makes perfect sense. Why try to reinvent the wheel when you could simply hijack biological processes that already exist? This is a classically human way of solving a problem, cleverer and yet also lazier than the futile pursuit of purely artificial robotics. A big congratulations to the scientists who figured this out, using only keen wit, a positive attitude, and a gigantic pile of money from the U.S. military research agency.

Yes, naturally this exciting new field of science is being used to develop weapons of war. This, not simply the prospect of new intelligences, is the upsetting thing about groundbreaking developments in robotics and AI. Will frogbots be a military invention that simply slides into everyday life, like the internet, canned food, and microwaves? Or will they be used to administer dangerous MKULTRA hallucinogens to innocent populations America decides are in its way? In a world controlled by a small and powerful elite that can essentially do whatever it wants, were forced to be suspicious of new technologies. Will the frogbot become bigger, smarter, and stronger? Yes, probably. Will it be my comrade? Thats another question entirely.

Eleanor Robertson is a writer and editor from Sydney, Australia.

Read more:
Robots don't have to be so embarrassing - The Outline

Recommendation and review posted by Bethany Smith

I have often heard the saying, "You were probably too young to remember this, but . . ." I can honestly say that I can recall quite a bit from my childhood even though I can't seem to recall what I had for breakfast yesterday. I remember a lot, including some things that I wish were fuzzy.

I know this sounds strange, but I remember my dad leaving. I was barely two years old, so obviously I was at an age when I could not fully comprehend what I was experiencing at the time, but I already knew I missed my dad and I wanted him to come home. Divorce is a topic I am very familiar with, both personally and professionally. There are countless people who seek counseling in various areas of their life and to me; that is just another day at the office. However, my story hits a different type of nerve for me. It is a story that I had processed in my own therapy, but this is the first time I am sharing it with the public, so (deep breath) . . . here we go.

As I mentioned before, my dad left when I was about eighteen months old. Just as I was trying to adapt to these changes as best as a toddler could, I met my dad's new "friend" and her kids. I remember she took my hand and walked me around where she worked. I am sure a lot was going on behind the scenes between my parents, but again I was too young to put things together at the time. Fast forward to age four or five, I was introduced to a new friend: anger! Oh, and nightmares. Plenty of them. One recurring nightmare was my dad leaving me. I would wake up screaming and crying, filled with a mixture of sadness, anger, shame, and guilt. My mom would come running into my room to comfort me as I sobbed against her shoulder.

Looking back now, I realized that the word that truly defined what I was feeling was powerless. My mom decided that she needed to do everything in her power to help me. So, she went to the bookstore and found several books that were supposed to help kids deal with their parents' divorce. She would read them to me, but they often told stories of children that I could not relate to, or they were often telling me how I should feel, rather than allowing me the space to access my own feelings. It was frustrating and overwhelming.

It is fascinating how quickly we can adapt. I started to get used to going back and forth between my two homes. However, it was only for a short period of time that I felt "okay." Fast forward again to around age ten. Just as I was starting to accept all the changes including separate homes, blended families, and different sets of rules, I had to endure a long and terrifying custody battle. I felt like my parents were playing tug of war with me in the middle! The anger that I thought had disappeared came back in full force and even brought additional feelings, including shame, grief, sadness, low self-esteem, people-pleasing tendencies, just to name a few. That voice I was working so hard on developing was silenced as I decided to just say or do what I thought would please my parents as well as others. I not only lost my voice, but I lost myself.

I also learned some interesting techniques from my mom. She created "games" for us to play including what we called "give me the bad stuff," which is where I would think of all the different things that were bothering me, shout, "I don't like this," while bundling them up into an invisible ball, and then handing them to my mom who would then pretend to throw them out the door or window.

My mom would tell me that I am just a kid, so I did not need to hold on to all this "yucky stuff" inside. It was the first time in a while that I felt like I had a voice. It was wonderful! I would also scream into or hit my pillow as if it were a punching bag. Pretty creative stuff, right? As my mom always says, "It takes a village," and boy was she right! I lucked out by having such an amazing support system at my elementary school.

My guidance counselor established a support group for children of divorced or divorcing parents, and it truly helped to normalize what I was feeling. I was able to speak to peers my own age going through the same things, which was helpful as many of my close friends could not relate to what I was experiencing. I was given safe, nonjudgmental outlets to express myself, and little by little I felt better.

So why am I sharing my story? Well, today as a therapist, I listen to other children's stories. Divorce is definitely not pretty, but it does not have to be so ugly! Whether the parents decide to "stay together for the children" or go their separate ways, children are getting pulled into the chaos. Sometimes, children will pretend they don't know what is going on or act as if they don't care, but trust me when I say it all leaves an impact.

My book, My Parents Are Getting a Divorce . . . I Wonder What Will Happen to Me, is an interactive workbook that was created by my mother and me during the terrifying custody battle that took place between my parents. I felt it was imperative that I assist as many children as possible to help them explore and uncover their innermost thoughts and feelings regarding their parents' divorce. Within the pages of the book, children are encouraged to write and draw as well as ask questions to get in touch with what is inside that needs to be healed.

Continue reading here:
Divorce as Seen Through the Eyes of a Child - SWAAY

Recommendation and review posted by Bethany Smith

Stem Cell Therapy Market: Snapshot

Of late, there has been an increasing awareness regarding the therapeutic potential of stem cells for management of diseases which is boosting the growth of the stem cell therapy market. The development of advanced genome based cell analysis techniques, identification of new stem cell lines, increasing investments in research and development as well as infrastructure development for the processing and banking of stem cell are encouraging the growth of the global stem cell therapy market.

To know Untapped Opportunities in the MarketCLICK HERE NOW

One of the key factors boosting the growth of this market is the limitations of traditional organ transplantation such as the risk of infection, rejection, and immunosuppression risk. Another drawback of conventional organ transplantation is that doctors have to depend on organ donors completely. All these issues can be eliminated, by the application of stem cell therapy. Another factor which is helping the growth in this market is the growing pipeline and development of drugs for emerging applications. Increased research studies aiming to widen the scope of stem cell will also fuel the growth of the market. Scientists are constantly engaged in trying to find out novel methods for creating human stem cells in response to the growing demand for stem cell production to be used for disease management.

It is estimated that the dermatology application will contribute significantly the growth of the global stem cell therapy market. This is because stem cell therapy can help decrease the after effects of general treatments for burns such as infections, scars, and adhesion. The increasing number of patients suffering from diabetes and growing cases of trauma surgery will fuel the adoption of stem cell therapy in the dermatology segment.

Global Stem Cell Therapy Market: Overview

Also called regenerative medicine, stem cell therapy encourages the reparative response of damaged, diseased, or dysfunctional tissue via the use of stem cells and their derivatives. Replacing the practice of organ transplantations, stem cell therapies have eliminated the dependence on availability of donors. Bone marrow transplant is perhaps the most commonly employed stem cell therapy.

Osteoarthritis, cerebral palsy, heart failure, multiple sclerosis and even hearing loss could be treated using stem cell therapies. Doctors have successfully performed stem cell transplants that significantly aid patients fight cancers such as leukemia and other blood-related diseases.

Get Discount on Latest Report @CLICK HERE NOW

Global Stem Cell Therapy Market: Key Trends

The key factors influencing the growth of the global stem cell therapy market are increasing funds in the development of new stem lines, the advent of advanced genomic procedures used in stem cell analysis, and greater emphasis on human embryonic stem cells. As the traditional organ transplantations are associated with limitations such as infection, rejection, and immunosuppression along with high reliance on organ donors, the demand for stem cell therapy is likely to soar. The growing deployment of stem cells in the treatment of wounds and damaged skin, scarring, and grafts is another prominent catalyst of the market.

On the contrary, inadequate infrastructural facilities coupled with ethical issues related to embryonic stem cells might impede the growth of the market. However, the ongoing research for the manipulation of stem cells from cord blood cells, bone marrow, and skin for the treatment of ailments including cardiovascular and diabetes will open up new doors for the advancement of the market.

Global Stem Cell Therapy Market: Market Potential

A number of new studies, research projects, and development of novel therapies have come forth in the global market for stem cell therapy. Several of these treatments are in the pipeline, while many others have received approvals by regulatory bodies.

In March 2017, Belgian biotech company TiGenix announced that its cardiac stem cell therapy, AlloCSC-01 has successfully reached its phase I/II with positive results. Subsequently, it has been approved by the U.S. FDA. If this therapy is well- received by the market, nearly 1.9 million AMI patients could be treated through this stem cell therapy.

Another significant development is the granting of a patent to Israel-based Kadimastem Ltd. for its novel stem-cell based technology to be used in the treatment of multiple sclerosis (MS) and other similar conditions of the nervous system. The companys technology used for producing supporting cells in the central nervous system, taken from human stem cells such as myelin-producing cells is also covered in the patent.

Global Stem Cell Therapy Market: Regional Outlook

The global market for stem cell therapy can be segmented into Asia Pacific, North America, Latin America, Europe, and the Middle East and Africa. North America emerged as the leading regional market, triggered by the rising incidence of chronic health conditions and government support. Europe also displays significant growth potential, as the benefits of this therapy are increasingly acknowledged.

Asia Pacific is slated for maximum growth, thanks to the massive patient pool, bulk of investments in stem cell therapy projects, and the increasing recognition of growth opportunities in countries such as China, Japan, and India by the leading market players.

Request TOC of the Reportfor more Industry Insights @CLICK HERE NOW

Global Stem Cell Therapy Market: Competitive Analysis

Several firms are adopting strategies such as mergers and acquisitions, collaborations, and partnerships, apart from product development with a view to attain a strong foothold in the global market for stem cell therapy.

Some of the major companies operating in the global market for stem cell therapy are RTI Surgical, Inc., MEDIPOST Co., Ltd., Osiris Therapeutics, Inc., NuVasive, Inc., Pharmicell Co., Ltd., Anterogen Co., Ltd., JCR Pharmaceuticals Co., Ltd., and Holostem Terapie Avanzate S.r.l.

About TMR Research:

TMR Research is a premier provider of customized market research and consulting services to business entities keen on succeeding in todays supercharged economic climate. Armed with an experienced, dedicated, and dynamic team of analysts, we are redefining the way our clients conduct business by providing them with authoritative and trusted research studies in tune with the latest methodologies and market trends.

Visit link:
Stem Cell Therapy Market Predicted to Accelerate the Growth by 2017-2025 - Jewish Life News

Recommendation and review posted by Bethany Smith

The 2019 novel coronavirus (2019-nCoV) outbreak has sparked a speedy response, with scientists, physicians, and front-line healthcare professionals analyzing data in real-time in order to share findings and call out misinformation. Today, The Lancet published two new peer-reviewed studies: one which found that the new coronavirus is genetically distinct from human SARS and MERS, related viruses which caused their own outbreaks, and a second which reports clinical observations of 99 individuals with 2019-nCoV.

The first cases of the coronavirus outbreak were reported in late December 2019. In this new study, Nanshan Chen and colleagues analyzed available clinical, demographic, and laboratory data for 99 confirmed coronavirus cases at the Wuhan Jinyintan Hospital between Jan 1 to Jan 20, 2020, with clinical outcomes followed until 25th January.

Chen and colleagues reported that the average age of the 99 individuals with 2019-nCoV is around 55.5 years, where 51 have additional chronic conditions, including cardiovascular and cerebrovascular (blood flow to the brain) diseases. Clinical features of the 2019-nCoV include a fever, cough, shortness of breath, headaches, and a sore throat. 17 individuals went on to develop acute respiratory distress syndrome, resulting in death by multiple organ failure in 11 individuals. However, it is important to note here that most of the 2019-nCoV cases were treated with antivirals (75 individuals), antibiotics (70) and oxygen therapy (75), with promising prognoses, where 31 individuals were discharged as of 25th January.

Based on this sample, the study suggests that the 2019 coronavirus is more likely to affect older men already living with chronic conditions but as this study only includes 99 individuals with confirmed cases, it may not present a complete picture of the outbreak. As of right now, there are over 6,000 confirmed coronavirus cases reported, where a total of 126 individuals have recovered, and 133 have died.

In a second Lancet study, Roujian Lu and their fellow colleagues carried out DNA sequencing on samples, obtained from either a throat swab or bronchoalveolar lavage fluids, from eight individuals who had visited the Huanan seafood market in Wuhan, China, and one individual who stayed in a hotel near the market. Upon sequencing the coronaviruss genome, the researchers carried out phylogenetic analysis to narrow down the viruss likely evolutionary origin, and homology modelling to explore the virus receptor-binding properties.

Lu and their fellow colleagues found that the 2019-nCoV genome sequences obtained from the nine patients were very similar (>99.98% similarity). Upon comparing the genome to other coronaviruses (like SARS), the researchers found that the 2019-nCoV is more closely related (~87% similarity) to two bat-derived SARS-like coronaviruses, but does not have as high genetic similarity to known human-infecting coronaviruses, including the SARS-CoV (~79%) orMiddle Eastern Respiratory Syndrome (MERS) CoV (~50%).

The study also found that the 2019-nCoV has a similar receptor-binding structure like that of SARS-CoV, though there are small differences in certain areas. This suggests that like the SARS-CoV, the 2019-nCoV may use the same receptor (called ACE2) to enter cells, though confirmation is still needed.

Finally, phylogenetic analysis found that the 2019-nCoV belongs to the Betacoronavirus family the same category that bat-derived coronaviruses fall into suggesting that bats may indeed be the 2019-nCoV reservoir. However, the researchers note that most bat species are hibernating in late December, and that no bats were being sold at the Huanan seafood market, suggesting that while bats may be the initial host, there may have been a secondary animal species which transmitted the 2019-nCoV between bats and humans.

Its clear that we can expect new findings from the research community in the coming days as scientists attempt to narrow down the source of the 2019-nCoV.

Read this article:
Rapid analysis shows that the 2019-nCoV coronavirus resembles viruses from bats - Massive Science

Recommendation and review posted by Bethany Smith

The 2019 novel coronavirus (2019-nCoV) outbreak has sparked a speedy response, with scientists, physicians, and front-line healthcare professionals analyzing data in real-time in order to share findings and call out misinformation. Today, The Lancet published two new peer-reviewed studies: one which found that the new coronavirus is genetically distinct from human SARS and MERS, related viruses which caused their own outbreaks, and a second which reports clinical observations of 99 individuals with 2019-nCoV.

The first cases of the coronavirus outbreak were reported in late December 2019. In this new study, Nanshan Chen and colleagues analyzed available clinical, demographic, and laboratory data for 99 confirmed coronavirus cases at the Wuhan Jinyintan Hospital between Jan 1 to Jan 20, 2020, with clinical outcomes followed until 25th January.

Chen and colleagues reported that the average age of the 99 individuals with 2019-nCoV is around 55.5 years, where 51 have additional chronic conditions, including cardiovascular and cerebrovascular (blood flow to the brain) diseases. Clinical features of the 2019-nCoV include a fever, cough, shortness of breath, headaches, and a sore throat. 17 individuals went on to develop acute respiratory distress syndrome, resulting in death by multiple organ failure in 11 individuals. However, it is important to note here that most of the 2019-nCoV cases were treated with antivirals (75 individuals), antibiotics (70) and oxygen therapy (75), with promising prognoses, where 31 individuals were discharged as of 25th January.

Based on this sample, the study suggests that the 2019 coronavirus is more likely to affect older men already living with chronic conditions but as this study only includes 99 individuals with confirmed cases, it may not present a complete picture of the outbreak. As of right now, there are over 6,000 confirmed coronavirus cases reported, where a total of 126 individuals have recovered, and 133 have died.

In a second Lancet study, Roujian Lu and their fellow colleagues carried out DNA sequencing on samples, obtained from either a throat swab or bronchoalveolar lavage fluids, from eight individuals who had visited the Huanan seafood market in Wuhan, China, and one individual who stayed in a hotel near the market. Upon sequencing the coronaviruss genome, the researchers carried out phylogenetic analysis to narrow down the viruss likely evolutionary origin, and homology modelling to explore the virus receptor-binding properties.

Lu and their fellow colleagues found that the 2019-nCoV genome sequences obtained from the nine patients were very similar (>99.98% similarity). Upon comparing the genome to other coronaviruses (like SARS), the researchers found that the 2019-nCoV is more closely related (~87% similarity) to two bat-derived SARS-like coronaviruses, but does not have as high genetic similarity to known human-infecting coronaviruses, including the SARS-CoV (~79%) orMiddle Eastern Respiratory Syndrome (MERS) CoV (~50%).

The study also found that the 2019-nCoV has a similar receptor-binding structure like that of SARS-CoV, though there are small differences in certain areas. This suggests that like the SARS-CoV, the 2019-nCoV may use the same receptor (called ACE2) to enter cells, though confirmation is still needed.

Finally, phylogenetic analysis found that the 2019-nCoV belongs to the Betacoronavirus family the same category that bat-derived coronaviruses fall into suggesting that bats may indeed be the 2019-nCoV reservoir. However, the researchers note that most bat species are hibernating in late December, and that no bats were being sold at the Huanan seafood market, suggesting that while bats may be the initial host, there may have been a secondary animal species which transmitted the 2019-nCoV between bats and humans.

Its clear that we can expect new findings from the research community in the coming days as scientists attempt to narrow down the source of the 2019-nCoV.

Read more from the original source:
My cat's coat is mostly white with dark tabby patches. What's going on? - Massive Science

Recommendation and review posted by Bethany Smith

UAB Magazine

Written by Charles Buchanan, Brett Bralley and Jay Taylor with editorial contributions from Matt Windsor and UAB Public Relations. Images from UAB Archives, Rachel Hendrix, Andrea Mabry, Sarah Parcak, Steve Wood and Getty Images. Web design by Tyler Bryant. Reprinted by permission of UAB Magazine.

UABs birth was like a ray of sunlight punching through the smog.

In 1969 the newly independent university, uniting a pioneering academic medical center and a growing extension center, brought the promise of a brighter future to a city eager for change.

Birmingham is better because of UAB. So are Alabama, America, and the world. In the following pages, discover some of the many ways that UAB has fulfilled its promiseby saving lives, solving problems, expanding knowledge, and opening doorsover 50 years.

1

Best of the best

UABs accolades shine a global spotlight on Birmingham and Alabama:

2

A way to retrain the brain

Most scientists once believed that neuroplasticitythe brains ability to grow or repair itselfended in childhood. But research by UAB neuroscientist Edward Taub, Ph.D., contributed to a shift in thinking, and in the 1990s he developed constraint-induced (CI) therapy for stroke patients with poorly functioning limbs. As the intensive training helps patients learn to accomplish tasks with their affected limbs, the brain adapts by strengthening communication with those parts of the body. And the results have been remarkable: Most patients see a clinically significant level of improvement in their ability to use their affected limbs, and brain scans have shown an increase in gray matter. Taub and UAB clinical psychologist Gitendra Uswatte, Ph.D., have used CI therapy to help thousands of stroke patientsand adapted it for patients impacted by cerebral palsy, traumatic brain injury, multiple sclerosis, and spinal cord injury. Today CI therapy is in use worldwide.

3

Discoveries on ice

UAB scientists conduct a lot of research in the fieldbut none may go as far afield as James McClintock, Ph.D.; Charles Amsler, Ph.D.; and Maggie Amsler. Their investigations take place at Palmer Station, Antarctica6,898 miles from their campus offices. For two decades, the biologists have led teams that dive into the frigid waters surrounding the icy continent to study the chemical ecology of the unique marine algae and invertebrates living there. What theyve discovered could aid the search for new drugs to help humans. The group also chronicles the dramatic impact of climate change, such as ocean acidification, on Antarctic marine life. You can see climate change happening there like no other place on earth, says McClintock.

4

A pinch of prevention

UAB endocrinologist Constance Pittman, M.D., turned her research passioniodines impact on thyroid functioninto a global mission. In the 1990s and 2000s, she teamed up with Kiwanis International and UNICEF to help eradicate iodine deficiency disorders (IDD), a prevalent cause of cognitive disabilities. Pittman traveled the world to convince companies to add iodine to table saltthe simplest solution for preventing IDD. And her work helped make a lasting impact.

5

Target: Diabetes

In 1973, UAB opened the nations first public diabetes hospitaland the first linked with an academic medical center. Today physicians on the front lines of the diabetes epidemic have an exciting new option to help their patients, thanks to breakthrough research from UABs Comprehensive Diabetes Center.

6

Sharing stories that matter

WBHM 90.3 FM radio went on the air in 1976 as the 200th National Public Radio (NPR)-affiliated station. A member-supported service of UAB, WBHM provides global news and award-winning local coverage to Birmingham and the surrounding region. The station also recently welcomed StoryCorps, an NPR-affiliated initiative, to collect stories from the Birmingham community that will be housed at the Library of Congress in Washington, D.C.

7

Book of Life

Its tough to find a physician anywhere in the world who hasnt learned a few things from Tinsley Harrison, M.D. The legendary School of Medicine cardiologist and dean created and edited Harrisons Principles of Internal Medicine, which has been reprinted 20 times, translated into 14 languages, and become arguably the most recognized book in all of medicine, according to the Journal of the American Medical Association.

8

Foresight

The School of Optometry has been a pioneer since it opened in 1969 as the nations first optometry school associated with an academic medical center. Three years later, it became the first optometry teaching program affiliated with a Veterans Administration (VA) hospital, establishing a national model. Today more than 2,500 optometry staff and students from various schools work in the VA system nationwide.

9

Helping our hometown

Living and working in the heart of the city, UAB students, faculty, and staff cant help but feel a connection to Birmingham. Here are just a few ways Blazers have volunteered to support their neighbors:

10

A whole new ball game

Gene Bartow Mens basketball coach1977-1996

UAB started a winning tradition in 1977 when it hired coach Gene Bartow away from powerhouse UCLA to start a mens basketball program. He created a legendary team able to topple top rivals and reach the NCAA Tournament in just its third seasonthe first of 15 NCAA Tournament and 12 National Invitational Tournament appearances on its record. As UABs first athletic director, Bartow also helped UAB compete in other arenas. Today student-athletes in 18 sports give Birmingham reasons to cheer. Take a spin through some of the Blazers most memorable moments:

11

New views of history

Its as if Indiana Jones and Google Earth had a love child. Thats how UAB anthropology faculty member and National Geographic fellow Sarah Parcak, Ph.D., described space archaeology to Stephen Colbert on The Late Show in 2016. She has pioneered the use of high-resolution satellite imagery to search for the buried remains of lost civilizations. And her discoveries have thrilled people worldwide, including Colbert. She was even mentioned in a Jeopardy! answer earlier this year.

12

Defense team

UAB immunologists have been among the first to shed light on the mechanisms powering our bodys defenses:

13

Game changers

Future football helmets may better protect athletes thanks to mechanical engineering professor Dean Sicking, Ph.D. (Before coming to UAB, he developed the lifesaving SAFER barriers used on NASCAR and IndyCar courses.) Analyzing data from thousands of helmet-to-helmet impacts in football, Sicking has developed designs for a new helmet that could address concussionsabsorbing as much energy of the impact as possible so that the athlete has less risk of brain injury.

14

The dividends of discovery

In 2018-2019, UAB received $602 million in research grants and awardsjust one year after surpassing the $500-million milestone for the first time. We are aiming high and exceeding our goals, and it is a testament to the UAB research communitys great ideas, hard work, and will to succeed, says Christopher Brown, Ph.D., vice president for research. A rise in research funding means more opportunities to explore the frontiers of knowledgebut it also enables UAB to attract top minds from around the country in health care, engineering, the sciences, and more, plus create new jobs that boost the local economy. Want to ensure that UAB continues its upward trajectory? Philanthropic support helps position the university to attain competitive research grants.

15

Giant leaps

Space is the place for UAB people and technology:

Researcher Larry DeLucas, O.D., Ph.D., became the first optometrist in orbit with a 1992 mission aboard the shuttle Columbia. There he conducted experiments to grow protein crystals, which give scientists a 3D view of protein structuresand a greater understanding of the roles they play in disease. DeLucas also served as chief scientist for the International Space Station in 1994-1995.

Astrophysicist Thomas Wdowiak, Ph.D., passed away in 2013, but his name lives onon Mars. The Red Planets Wdowiak Ridge honors the physics faculty members role in NASAs Mars Exploration Project. Wdowiak was in charge of operating the Mossbauer spectrometers onboard the Spirit and Opportunity rovers that helped uncover firm evidence that water once existed on Mars.

16

Focus on finances

Would you like to get better at saving, budgeting, or investing? Or do you dream of launching a business? The Regions Institute for Financial Education in the Collat School of Business has been helping people throughout the community develop practical, lifelong financial management skills since 2015. Some of its programs include a Money Math Camp for middle schoolers, a College Bridge Camp to prepare high schoolers for life after graduation, and for adults, a Do-It-Yourself Credit Repair Workshop.

17

Going green

Campus expansions have reshaped Birminghams Southside, and UAB works hard to be a good steward of that spaceand set a sustainable example. In 2008, UAB brought open green space into the heart of Birmingham by converting a city street into the Campus Green. Now UAB is aiming to reduce its greenhouse gas emissions by 20 percent and establish a clean energy standard of 20-percent renewable energy by 2025.

18

Ingenuity vs. Infection

Virus vanguards

Antiviral therapies are essential for treating everything from influenza to HIV. In 1977, UAB pediatrics experts Richard Whitley, M.D., and Charles Alford, M.D., helped spark the antiviral revolution by developing vidarabine, the first drug to treat encephalitis caused by the herpes simplex virus. In the 1990s, Whitley and his team transformed the herpes virus into a genetically engineered weapon against tumors.

Vaccines for everyone

The laboratory of Moon Nahm, M.D., is a national treasure, notes the National Institutes of Health. But its discoveries could help protect millions of children worldwide threatened by S. pneumoniae infections, the leading cause of pneumonia. (Nahms lab also is designated a World Health Organization Pneumococcal Reference Laboratory.) His mission is to make pneumonia vaccines more affordable for use in developing countries.

Global guardian

GeoSentinel is a worldwide network of clinics watching for potential pandemics in an increasingly interconnected world, ready to relay information quickly about new disease outbreaks and effective treatments. And it has Alabama roots. UAB travel medicine expert David Freedman, M.D., cofounded GeoSentinel, a collaboration between the International Society for Travel Medicine and the Centers for Disease Control and Prevention, in the 1990s. He also directed the network for 20 years.

19

Staying safe on the road

In 2002, UAB public health researchers unveiled the Digital Childa pioneering computer model evaluating the physical consequences of car crashes on young passengers at various stages of developmentto generate data that could lead to improved child safety devices. Shift gears to today, and researchers in UABs TRIP (Translational Research for Injury Prevention) Lab use virtual realitya first-of-its-kind SUV simulator built with Honda Manufacturing of Alabamato study distracted driving in an effort to save lives. The TRIP Lab also has a portable simulator for schools and community events to help educate students and others on the dangers of distracted driving.

20

A home for Birmingham history

Odessa WoolfolkEducator and civic leader

When Birmingham first dreamed of developing a civil rights museum and research center, UABs Odessa Woolfolk, then special assistant to the president and director of community relations, and Horace Huntley, Ph.D., a historian and first director of the African American studies program, helped lead efforts to turn that idea into a reality. The Birmingham Civil Rights Institute opened in 1992, with Woolfolk as president of its board of directors. Huntley also directed the institutes Oral History Project, which preserves the accounts of foot soldiers and other witnesses to the Birmingham campaign. Today the BCRI attracts visitors from around the world and is a key component of the Birmingham Civil Rights National Monument.

21

Invention in action

Faculty, staff, and students are designing the future for the rest of us. Preview some of their ingenious solutions:

Each year, biomedical engineering and business students develop technologies to help people overcome physical limitations. Examples include a joystick-controlled wheelchair for toddlerswhich won an international awardbuilt for the Bell Center for Early Intervention Programs, and a special scale to help wheelchair users monitor their weight, used by the Lakeshore Foundation. Another design, a mechanical umbrella to protect power wheelchair users from rainy weather, scored second place at the 2018 World Congress on Biomechanics.

Graphic design students in UABs Bloom Studio unleash their talents to support local nonprofits and underserved communities. You can spot their work on license plates and signs that promote and protect the Cahaba Riverpart of a collaboration with the Cahaba River Society.

Solution Studios pairs Honors College, engineering, and nursing students with UAB health professionals to tackle everyday problems affecting patient care. One team has designed a device prototype that could improve quality of life for patients wearing ostomy bags to expel waste. Another has focused on new, more comfortable methods of applying wires to the skin in settings such as intensive care units.

22

Spreading the word

Low literacy levels translate into increased high school dropout rates, a lower-performing workforce, and higher rates of social problems, say UAB School of Education experts. For years UABs Maryann Manning, Ed.D., led the charge to improve literacy across Alabama, launching programs such as a conference that attracted thousands of local schoolchildren to share their writing with authors and illustrators. Today the Maryann Manning Family Literacy Center continues her legacy, providing enrichment activities in reading, writing, math, arts, and science for children and helping teachers across Alabama learn innovative strategies to foster literacy skills in their classrooms.

23

The heart of innovation

John Kirklin, M.D.Surgery superstar

John Kirklin, M.D., helped put Birmingham on the medical map when he was recruited in 1966 to chair the Department of Surgery. He already was a superstar at the Mayo Clinic, where he had revolutionized cardiovascular surgery by improving the heart-lung machine and performing the first operations for a variety of congenital heart malformations. At UAB he continued to pursue new methods and techniques, such as the development of a computerized intensive care unit with continuous monitoring of vital functions, which became a model for ICUs worldwide.

When Kirklin passed away in 2004, colleagues estimated his medical innovations had saved millions of lives. And his legacy thrives in other ways: UAB is a world-class medical center in part because of Kirklins work behind the scenes, where he championed the combination of public and private investments to foster growth. His textbook, Cardiac Surgery, remains a must-read for anyone in the field. His name lives on in The Kirklin Clinic of UAB Hospital, which opened in 1992. And his son, cardiothoracic surgeon James Kirklin, M.D., directs UABs James and John Kirklin Institute for Research in Surgical Outcomes.

24

Birthplace of new businesses

UABs ideas and energy are an engine for entrepreneurship. The university was a founder of Birminghams Innovation Depot, where start-up companiessome born from UAB research breakthroughsfind the resources they need to grow. Today Innovation Depot is the Southeasts largest high-tech business incubator, home to more than 100 companies.

25

University of opportunity

In the fall of 2019, underrepresented students made up nearly 42 percent of UABs enrollment, and 20.5 percent of undergraduates were first-generation students. UAB has a long history of widening access to higher educationand potential careers in science and health careamong diverse students. Back in 1978, the Minority High School Research Apprentice Program began matching local students with faculty members for summer research experiences. Today, initiatives such as the Department of Surgerys Pre-College Internship for Students from Minority Backgrounds and the Neuroscience Roadmap Scholars program offer similar opportunities for students along their educational journeys.

26

Successful careers begin here

More than 135,000 alumni call UAB their alma mater. Today youll find them across the United States and around the world, working as leaders in health care, science, business, art, engineering, government, education, and other fields. Many stay connected with UAB through the National Alumni Society, which was established in 1979 and has 63 chapters in locations ranging from Washington, D.C., to Taiwan.

27

Follow this link:
UAB: 50 years of Improving Birmingham, Alabama and the World - Birmingham Times

Recommendation and review posted by Bethany Smith

CRISPR technology is a simple yet powerful tool for editing genomes. It allows researchers to easily alter DNA sequences and modify gene function. Its many potential applications include correcting genetic defects, treating and preventing the spread of diseases and improving crops. However, its promise also raises ethical concerns.

In popular usage, "CRISPR" (pronounced "crisper") is shorthand for "CRISPR-Cas9." CRISPRs are specialized stretches of DNA. The protein Cas9 (or "CRISPR-associated") is an enzyme that acts like a pair of molecular scissors, capable of cutting strands of DNA.

CRISPR technology was adapted from the natural defense mechanisms of bacteria and archaea (the domain of single-celled microorganisms). These organisms use CRISPR-derived RNA and various Cas proteins, including Cas9, to foil attacks by viruses and other foreign bodies. They do so primarily by chopping up and destroying the DNA of a foreign invader. When these components are transferred into other, more complex, organisms, it allows for the manipulation of genes, or "editing."

Until 2017, no one really knew what this process looked like. In a paper published Nov. 10, 2017, in the journal Nature Communications, a team of researchers led by Mikihiro Shibata of Kanazawa University and Hiroshi Nishimasu of the University of Tokyo showed what it looks like when a CRISPR is in action for the very first time. [A Breathtaking New GIF Shows CRISPR Chewing Up DNA]

CRISPRs: "CRISPR" stands for "clusters of regularly interspaced short palindromic repeats." It is a specialized region of DNA with two distinct characteristics: the presence of nucleotide repeats and spacers. Repeated sequences of nucleotides the building blocks of DNA are distributed throughout a CRISPR region. Spacers are bits of DNA that are interspersed among these repeated sequences.

In the case of bacteria, the spacers are taken from viruses that previously attacked the organism. They serve as a bank of memories, which enables bacteria to recognize the viruses and fight off future attacks.

This was first demonstrated experimentally by Rodolphe Barrangou and a team of researchers at Danisco, a food ingredients company. In a 2007 paper published in the journal Science, the researchers used Streptococcus thermophilus bacteria, which are commonly found in yogurt and other dairy cultures, as their model. They observed that after a virus attack, new spacers were incorporated into the CRISPR region. Moreover, the DNA sequence of these spacers was identical to parts of the virus genome. They also manipulated the spacers by taking them out or putting in new viral DNA sequences. In this way, they were able to alter the bacteria's resistance to an attack by a specific virus. Thus, the researchers confirmed that CRISPRs play a role in regulating bacterial immunity.

CRISPR RNA (crRNA): Once a spacer is incorporated and the virus attacks again, a portion of the CRISPR is transcribed and processed into CRISPR RNA, or "crRNA." The nucleotide sequence of the CRISPR acts as a template to produce a complementary sequence of single-stranded RNA. Each crRNA consists of a nucleotide repeat and a spacer portion, according to a 2014 review by Jennifer Doudna and Emmanuelle Charpentier, published in the journal Science.

Cas9: The Cas9 protein is an enzyme that cuts foreign DNA.

The protein typically binds to two RNA molecules: crRNA and another called tracrRNA (or "trans-activating crRNA"). The two then guide Cas9 to the target site where it will make its cut. This expanse of DNA is complementary to a 20-nucleotide stretch of the crRNA.

Using two separate regions, or "domains" on its structure, Cas9 cuts both strands of the DNA double helix, making what is known as a "double-stranded break," according to the 2014 Science article.

There is a built-in safety mechanism, which ensures that Cas9 doesn't just cut anywhere in a genome. Short DNA sequences known as PAMs ("protospacer adjacent motifs") serve as tags and sit adjacent to the target DNA sequence. If the Cas9 complex doesn't see a PAM next to its target DNA sequence, it won't cut. This is one possible reason that Cas9 doesn't ever attack the CRISPR region in bacteria, according to a 2014 review published in Nature Biotechnology.

The genomes of various organisms encode a series of messages and instructions within their DNA sequences. Genome editing involves changing those sequences, thereby changing the messages. This can be done by inserting a cut or break in the DNA and tricking a cell's natural DNA repair mechanisms into introducing the changes one wants. CRISPR-Cas9 provides a means to do so.

In 2012, two pivotal research papers were published in the journals Science and PNAS, which helped transform bacterial CRISPR-Cas9 into a simple, programmable genome-editing tool.

The studies, conducted by separate groups, concluded that Cas9 could be directed to cut any region of DNA. This could be done by simply changing the nucleotide sequence of crRNA, which binds to a complementary DNA target. In the 2012 Science article, Martin Jinek and colleagues further simplified the system by fusing crRNA and tracrRNA to create a single "guide RNA." Thus, genome editing requires only two components: a guide RNA and the Cas9 protein.

"Operationally, you design a stretch of 20 [nucleotide] base pairs that match a gene that you want to edit," said George Church, a professor of genetics at Harvard Medical School. An RNA molecule complementary to those 20 base pairs is constructed. Church emphasized the importance of making sure that the nucleotide sequence is found only in the target gene and nowhere else in the genome. "Then the RNA plus the protein [Cas9] will cut like a pair of scissors the DNA at that site, and ideally nowhere else," he explained.

Once the DNA is cut, the cell's natural repair mechanisms kick in and work to introduce mutations or other changes to the genome. There are two ways this can happen. According to the Huntington's Outreach Project at Stanford (University), one repair method involves gluing the two cuts back together. This method, known as "non-homologous end joining," tends to introduce errors. Nucleotides are accidentally inserted or deleted, resulting in mutations, which could disrupt a gene. In the second method, the break is fixed by filling in the gap with a sequence of nucleotides. In order to do so, the cell uses a short strand of DNA as a template. Scientists can supply the DNA template of their choosing, thereby writing-in any gene they want, or correcting a mutation.

CRISPR-Cas9 has become popular in recent years. Church notes that the technology is easy to use and is about four times more efficient than the previous best genome-editing tool (called TALENS).

In 2013, the first reports of using CRISPR-Cas9 to edit human cells in an experimental setting were published by researchers from the laboratories of Church and Feng Zhang of the Broad Institute of the Massachusetts Institute of Technology and Harvard. Studies using in vitro (laboratory) and animal models of human disease have demonstrated that the technology can be effective in correcting genetic defects. Examples of such diseases include cystic fibrosis, cataracts and Fanconi anemia, according to a 2016 review article published in the journal Nature Biotechnology. These studies pave the way for therapeutic applications in humans.

"I think the public perception of CRISPR is very focused on the idea of using gene editing clinically to cure disease," said Neville Sanjana of the New York Genome Center and an assistant professor of biology, neuroscience and physiology at New York University. "This is no doubt an exciting possibility, but this is only one small piece."

CRISPR technology has also been applied in the food and agricultural industries to engineer probiotic cultures and to vaccinate industrial cultures (for yogurt, for example) against viruses. It is also being used in crops to improve yield, drought tolerance and nutritional properties.

One other potential application is to create gene drives. These are genetic systems, which increase the chances of a particular trait passing on from parent to offspring. Eventually, over the course of generations, the trait spreads through entire populations, according to the Wyss Institute. Gene drives can aid in controlling the spread of diseases such as malaria by enhancing sterility among the disease vector female Anopheles gambiae mosquitoes according to the 2016 Nature Biotechnology article. In addition, gene drives could also be used to eradicate invasive species and reverse pesticide and herbicide resistance, according to a 2014 article by Kenneth Oye and colleagues, published in the journal Science.

However, CRISPR-Cas9 is not without its drawbacks.

"I think the biggest limitation of CRISPR is it is not a hundred percent efficient," Church told Live Science. Moreover, the genome-editing efficiencies can vary. According to the 2014 Science article by Doudna and Charpentier, in a study conducted in rice, gene editing occurred in nearly 50 percent of the cells that received the Cas9-RNA complex. Whereas, other analyses have shown that depending on the target, editing efficiencies can reach as high as 80 percent or more.

There is also the phenomenon of "off-target effects," where DNA is cut at sites other than the intended target. This can lead to the introduction of unintended mutations. Furthermore, Church noted that even when the system cuts on target, there is a chance of not getting a precise edit. He called this "genome vandalism."

The many potential applications of CRISPR technology raise questions about the ethical merits and consequences of tampering with genomes.

In the 2014 Science article, Oye and colleagues point to the potential ecological impact of using gene drives. An introduced trait could spread beyond the target population to other organisms through crossbreeding. Gene drives could also reduce the genetic diversity of the target population.

Making genetic modifications to human embryos and reproductive cells such as sperm and eggs is known as germline editing. Since changes to these cells can be passed on to subsequent generations, using CRISPR technology to make germline edits has raised a number of ethical concerns.

Variable efficacy, off-target effects and imprecise edits all pose safety risks. In addition, there is much that is still unknown to the scientific community. In a 2015 article published in Science, David Baltimore and a group of scientists, ethicists and legal experts note that germline editing raises the possibility of unintended consequences for future generations "because there are limits to our knowledge of human genetics, gene-environment interactions, and the pathways of disease (including the interplay between one disease and other conditions or diseases in the same patient)."

Other ethical concerns are more nuanced. Should we make changes that could fundamentally affect future generations without having their consent? What if the use of germline editing veers from being a therapeutic tool to an enhancement tool for various human characteristics?

To address these concerns, the National Academies of Sciences, Engineering and Medicine put together a comprehensive report with guidelines and recommendations for genome editing.

Although the National Academies urge caution in pursuing germline editing, they emphasize "caution does not mean prohibition." They recommend that germline editing be done only on genes that lead to serious diseases and only when there are no other reasonable treatment alternatives. Among other criteria, they stress the need to have data on the health risks and benefits and the need for continuous oversight during clinical trials. They also recommend following up on families for multiple generations.

There have been many recent research projects based around CRISPR. "The pace of basic research discoveries has exploded, thanks to CRISPR," said biochemist and CRISPR expert Sam Sternberg, the group leader of technology development at Berkeley, California-based Caribou Biosciences Inc., which is developing CRISPR-based solutions for medicine, agriculture, and biological research.

Here are some of the most recent findings:

Additional reporting by Alina Bradford, Live Science contributor.

Additional resources

View post:
What Is CRISPR? | Live Science

Recommendation and review posted by Bethany Smith

Mammoth Biosciences cofounders Janice Chen, Lucas Harrington and Trevor Martin.

Mammoth Biosciences, a company that uses gene-editing technology Crispr for disease testing, said Thursday that it had raised $45 million in Series B funding to expand into treatments. The round, led by Decheng Capital and including new investor Verily, brings total funding to over $70 million.

The South San Francisco-based company, founded in 2017 by Forbes Under 30 honorees Trevor Martin, Janice Chen, Lucas Harrington and Crispr pioneer Jennifer Doudna, uses Crispr as a genetic search engine to find disease markers and alert researchers of their presence. Theyve already partnered with others, such as gene-editing company Horizon Discovery and a UC San Francisco researcher who is creating a rapid diagnostic test to identify people infected with the new coronavirus.

The company has been one of the most prolific innovators in the overall Crispr ecosystem, says Ursheet Parikh, an investor at the Mayfield Fund, which also participated in the round.

The new capital will allow Mammoth to expand into more traditional gene editing, which can be used to treat diseases. The company also plans to double in size, Martin says. Mammoth has already moved into new lab space on the South San Francisco campus of Verily, Alphabets life sciences company.

Crispr gene editing emerged in the 2010s as a tool that could quickly and precisely snip, repair or insert genes into DNA, giving rise to companies including eGenesis, Caribou Biosciences and Sherlock Biosciences. Most biotech companies in the gene-editing space use the Crispr system with Cas9, a large protein that can cut DNA. Mammoth focuses on a different one: Cas14. Martin refers to this protein as nano-Cas, because its smaller and more precise than the popular Cas9 protein. Its more of a scalpel than a sledgehammer, he says. In a diagnostic test, the Cas protein is programmed to find a specific target. Once it finds this target, it breaks apart a reporter molecule, which can then change the color of the solution, indicating a positive or negative test result. Cas14 is particularly useful in diagnostics, Martin says, because of its size and its ability to quickly generate a signal once it finds DNA evidence of disease.

The technology has big implications for diagnostics, Martin says. One of Mammoths current partnerships is with UCSF researcher Charles Chiu, who also sits on Mammoths scientific advisory board, to create a rapid diagnostic test for the new coronavirus that has sickened more than 6,100 people globally and killed 132.

Right now, suspected coronavirus samples are shipped to the Centers for Disease Control and Prevention, where it can take six or more hours for the test to complete. The new test will work by taking a sample from a nasal swab, putting it into a tube with the Crispr-Cas system and other chemicals, and then dipping in a color-changing strip of paper to determine whether the test result is positive or negative. The whole thing should take from one to two hours, Chiu says, and be done in a doctors clinic or an emergency room. His lab was already working on a similar diagnostic test for Lyme disease, and it was able to adapt the test quickly to the new coronavirus. Chiu says the test could be ready in a matter of weeks; the only thing holding it back is a lack of human samples with which to test the diagnostic accuracy. Chiu credits Mammoths platform for helping them create a better, faster test. There are very few if any technologies that you could use that would have the same speed, turnaround and accuracy, he says.

Originally posted here:
Mammoth Biosciences Raises $45 Million For Crispr DiagnosticsAnd Its Tech Is Already Being Used Against Coronavirus - Forbes

Recommendation and review posted by Bethany Smith

CRISPR Technology Market to 2027 - Global Analysis and Forecasts By Product and Services (Enzymes, Kits, Services and Others), Application (Genetic Engineering, Cell Line Engineering and Others) End User (Biotechnology & Pharmaceutical Companies, Contract Research Organizations (CROs), and Academic & Government Research Institutes); and Geography

CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology is a simple but powerful tool for genome editing. This tool enables life science researchers to easily edit DNA sequences and modify gene function.

It has many potential applications include correcting genetic defects, treating and preventing the spread of diseases and improving crops. By delivering the CRISPR enzyme Cas9 nuclease coupled with synthetic guide RNA (gRNA) into a cell, the cell's genome can be cut at a desired location, that allows existing genes to be removed or add new ones.

Increasing usage of CRISPR systems in microbiology, growing government and private investments on research and development of genome editing, rising prevalence of genetic disorders, and increases application of CRISPR/Cas9 technology to improve crop production drives the global CRISPR technology market. However, ethical issues associated with CRISPR and lack of skilled personnel restrain the global CRISPR technology market over the forecast period.

Download Samle PDF Of Report@www.theinsightpartners.com/sample/tech-10186

Some of the key players operating in the CRISPR Technology market include :-

Thermo Fisher Scientific Inc., Merck KGaA, Horizon Discovery Group plc, Cellecta, Inc, GeneCopoeia, Inc., New England Biolabs, OriGene Technologies, Inc., GenScript, Integrated DNA Technologies, Inc. and Agilent Technologies, Inc.

The report also includes the profiles of key CRISPR Technology companies along with their SWOT analysis and market strategies.

In addition, the report focuses on leading industry players with information such as company profiles, components and services offered, financial information of last 3 years, key development in past five years.

The "Global CRISPR Technology Market Analysis to 2027" is a specialized and in-depth study of the medical device industry with a focus on the global market trend. The report aims to provide an overview of global market with detailed market segmentation by product and services, application, end user and geography.

The global CRISPR Technology market is expected to witness high growth during the forecast period. The report provides key statistics on the market status of the leading CRISPR Technology market players and offers key trends and opportunities in the market.

The global CRISPR technology market is segmented on the basis of product and services, application, end user. Based product and services, the market is segmented as, enzymes, kits, services and others.

The CRISPR technology market is categorized based on application into, genetic engineering, cell line engineering and others. Based on end user, the CRISPR Technology market is classified into biotechnology & pharmaceutical companies, contract research organizations (CROS), and academic & government research institutes.

The report provides a detailed overview of the industry including both qualitative and quantitative information. It provides overview and forecast of the global CRISPR Technology market based product and services, application, end user.

It also provides market size and forecast till 2027 for overall market with respect to five major regions, namely; North America, Europe, Asia-Pacific (APAC), Middle East and Africa (MEA) and South & Central America. The CRISPR Technology Market by each region is later sub-segmented by respective countries and segments.

The report covers analysis and forecast of 13 countries globally along with current trend and opportunities prevailing in the region.

North America held over major share in the CRISPR Technology market in 2017 owing to significant research carried out in order to develop novel therapeutics for disease targeting and high adoption of genome editing technique for germline modifications. North America is expected to collectively contribute towards the growth of CRISPR Technology market owing to the presence of major market players and also the development of technologically advanced products of CRISPR technology is expected to influence the CRISPR technology market growth.

The Asia-Pacific region is expected to exhibit highest CAGR during the forecast period due to many applications in developing economies of the region for animal disease and human disease treatment. Also, the rapid economic growth in this region coupled with diversified population and large patient pool, drives CRISPR Technology market in this region.

The report analyzes factors affecting CRISPR Technology market from both demand and supply side and further evaluates market dynamics effecting the market during the forecast period i.e., drivers, restraints, opportunities, and future trend. The report also provides exhaustive PEST analysis for all five regions namely; North America, Europe, APAC, MEA and South & Central America after evaluating political, economic, social and technological factors effecting the CRISPR Technology market in these regions.

Access Full Report@www.theinsightpartners.com/buy/TIPtech-10186

This email address is being protected from spambots. You need JavaScript enabled to view it.

See more here:
CRISPR Technology Market analysis by growth, segmentation, performance, competitive strategies and forecast to 2027 - WhaTech Technology and Markets...

Recommendation and review posted by Bethany Smith