Late last year, the U.S. Fish and Wildlife Service proposed removing 23 species from the Endangered Species List, but not for the reason you might hope.

All 23 species of birds, fish, and mussels have gone extinct, according to the USFWS, and are no longer eligible for listing under the Endangered Species Act.

Many of these species have been on the decline for decades. Some, like the Hawaiian Kauai nukupuu bird, havent been spotted since the 19th century. As the USFWS explained in its press release, ESA protections came too late to conserve habitat and protect these animals from invasive species and disease.

Some believe biobanking can save other animal populations from the same fate. Wooly mammoths probably arent on that list, but biobanking advocates say animal cells frozen in cold storage could be used to beef up the genetic diversity of captive populations and restore some species from the brink of extinction.

What is Biobanking?

Biobanking refers to the collection and storage of biological materials. There are many kinds of biobanks designed for different purposes, but conservationists are particularly interested in biobanks like San Diego Zoos Frozen Zoo.

As its name suggests, the Frozen Zoo stores living animal cells by super-freezing (the technical term) those cells at -196 degrees Celsius. Virtually all cell activity stops at this temperature, which allows scientists to store samples until they want to use them. These cells can come from anywhere on an animals body and often include reproductive cells like sperm and eggs.

The Frozen Zoo launched in 1975 and has since been able to store 1,100 species of vertebrate animals and cells from over 10,000 individual animals, according to Dr. Oliver Ryder. Dr. Ryder is the Frozen Zoos Director of Conservation Genetics, and he spoke to MeatEater about the importance of banking the cells of endangered animals.

Were seeing species decline in numbers, populations disappear from within their range due to habitat loss and fragmentation. For some species, more of their gene pool is in these freezers than is in the wild, Dr. Ryder told MeatEater.

Most of the Frozen Zoos samples come from animals at the San Diego Zoo, where biologists can collect cells during an animals regular checkups or postmortem examinations. The Frozen Zoo tries to bank a diverse collection of animals, but time and space constraints force them to select vulnerable species over less vulnerable ones.

The Frozen Zoo isnt alone. Among other biobanks related to animal conservation, the Rare Breed Survival Trust in the United Kingdom houses a gene bank of native livestock breeds, the National Oceanic and Atmospheric Administration houses the National Marine Mammal Tissue Bank (NMMTB), and Japans National BioResource Project houses animal and plant materials to advance scientific research.

Current Successes

Freezing biological specimens might sound like something out of Mel Gibsons 1992 movie, Forever Young, but the reality is less science fiction and more science class.

Frozen zoos can help researchers investigate parentage, genetic lineage, evolutionary history, and disease susceptibility of individuals or species. However, a biobanks greatest conservation potential is its ability to beef up the genetic diversity of captive breeding programs.

Captive breeding programs are expensive, but the biggest hurdle is maintaining healthy genetic diversity. This issue is especially concerning for species that do not exist in the wild. A small captive population will eventually die out without new individuals to introduce genetic diversity.

This almost happened to the black-footed ferret. The black-footed ferret is the only ferret native to North America, but the population was so small by the late 20th century that the species was thought to be extinct.

Conservationists found the last remaining wild population in 1981, but only seven of those 18 ferrets produced kits. The captive breeding program for the black-footed ferret has successfully produced thousands of ferrets, but the entire population descended from those seven individuals.

Fortunately, biologists in the 1980s preserved a tissue sample from one of the non-breeding female ferrets and sent that sample to the San Diego Frozen Zoo. Those cells were preserved until 2020, when a group of scientists created a ferret embryo from that tissue, which was born later that year.

This cloned ferret, dubbed Elizabeth Ann, is not related to any black-footed ferret currently in existence and could provide some much-needed genetic variation to the population. She is the first clone of a native endangered species in North America.

It was like discovering a new ferret, Dr. Ryder said.

Its unclear whether Elizabeth Ann is necessary to the black-footed ferrets continued success. The Smithsonians National Zoo & Conservation Biology Institute has released thousands of black-footed ferrets in partnership with the USFWS, and they dont report a lack of genetic diversity as one of the populations primary threats.

But in a press release announcing Elizabeth Anns birth, the USFWS pointed out that the ferrets must overcome unique genetic challenges and could eventually become more susceptible to disease, infertility, and genetic abnormalities.

In any case, if Elizabeth Ann proves to be fertile (researchers will know later this year), the project will provide powerful proof of concept for how biobanking can save threatened species.

Researchers at the Australian Frozen Zoo are also offering a less dramatic way biobanking could theoretically introduce genetic diversity into captive breeding populations. Biobanked sperm, researchers argue, can allow captive programs to operate with fewer animals while maintaining the diversity needed for a healthy population.

Using frozen zoos could provide a 25-fold increase in the number of species that could be conserved. This would be a staggering conservation achievement, and we think it can be done, said Dr. Simon Clulow of Macquarie University in Sydney.

Clulow and his colleagues published a paper in 2020 arguing that introducing biobanked frozen sperm to an Oregon spotted frog breeding program could significantly reduce the cost of the program. They suggest that backcrossingcrossing a hybrid with one of its parents or a creature genetically similar to its parentwith frozen sperm every generation would lead to much lower costs than with traditional captive breeding.

Reducing the cost of captive breeding programs will free up resources to conserve species other than the so-called charismatic megafauna that generate the most funding and attention.

Moral Hazard

Not all conservationists are quite as excited about using biobanked material in these ways. Dr. Stuart Pimm is the Doris Duke Professor of Conservation Ecology at Duke University, and he worries that de-extinction techniques (which are still largely theoretical) can give moral cover to people and organizations that want to destroy habitat.

If you think its OK to drive species to extinction because you think we can keep their DNA going, it creates an awful moral hazard, Dr. Pimm told MeatEater.

Resurrecting ancient species like the wooly mammoth gets a lot of play in the news (not to mention Hollywood), but when asked about mammoths, Dr. Ryder sounded skeptical. Both he and Dr. Pimm argued that mammoth resurrection isnt practical. Dr. Ryder noted that no viable mammoth DNA exists with which to make a clone, and Dr. Pimm wondered how scientists would reconstruct mammoth habitat and ecosystems.

But while Dr. Ryder is still interested in using genetic technology to save declining species, Dr. Pimm has personal experience that keeps him wary of anything that rhymes with de-extinction. When he testified before Congress in the mid-1990s about the reauthorization of the Endangered Species Act, members of Congress expressed unconcern with habitat destruction because endangered species could be resurrected a la Jurassic Park.

There are people who would like to push environmental destruction to the limit, so the moral hazard of de-extinction is a real danger, Pimm said.

Instead of using time and resources to pursue the kind of genetic strategies made possible by biobanks, Dr. Pimm would like to see conservationists focus on what works: habitat restoration, legislative protections, and public education.

The amount of time people are wasting on these de-extinctions, they could get off their arses and do something useful for conservation, he said. I think theyre doing a considerable amount of harm in giving people false solutions. Thats not how were going to save biodiversity.

When asked about Dr. Pimms moral hazard, Dr. Ryder agreed that its a legitimate concern and acknowledged that solutions like Elizabeth Ann are still highly experimental. We cant bank all our conservation efforts on their success, he said.

He took issue, however, with the contention that the two approaches represent a zero-sum game.

That argument would presume that focusing effort on banking cells would detract from efforts to save species. All the evidence is to the contrary. The effort to save species is as strong as ever and is supported by international treaties and national legislation and regulation, he pointed out.

For his part, Dr. Pimm was careful to distinguish between de-extinction technologies and biobanking more generally. He does not support the former, but the latter he described as essential to conservation efforts. Storing genetic material is not a problem; what matters is how we use it.

Moving Forward

Both scientists agreed that conserving threatened and endangered species requires a collaborative, multi-pronged approach. Dr. Ryder stressed that habitat conservation should always be a top priority, and Dr. Pimm said he could support promoting genetic diversity via biobanked material if those techniques proved to be effective.

Ultimately, Dr. Ryder believes conservationists should pursue the kinds of solutions hes spearheading at the Frozen Zoo in the hopes that they wont have to use them.

My hope is that we wont need to do these kinds of things because we wont have species that are so depleted in their genetic variation or on the brink of extinction that we have to evoke these heroics, he said.

But given that were seeing a number of species in decline, it would be prudent, thoughtful, and helpful to bank cells now so that we have that option in the future, he continued. I would like to see a greatly expanded effort to do banking so that we wouldnt need to be looking at a future where were inevitably seeing the genetic diversity of wild species erode.

Continue reading here:
Can Biobanking Save the World's Rarest Wildlife? - MeatEater

Recommendation and review posted by Bethany Smith

Narcolepsy is a neurological condition that affects your bodys sleeping and waking cycles.

Its estimated that between 135,000 and 200,000 people in the United States have narcolepsy. If you have it, youll often feel very tired during the day and may also unexpectedly fall asleep in the middle of activities. Its also possible to experience cataplexy, which is when muscle weakness comes on suddenly.

Adrenal insufficiency is a health condition where your adrenal glands dont make enough of certain hormones. This can lead to symptoms that are similar to those of narcolepsy, such as chronic fatigue and muscle weakness.

Another related term you may have heard of is adrenal fatigue, which is used to describe a mild type of adrenal insufficiency thats supposedly brought on by chronic stress. However, adrenal fatigue isnt a proven medical condition.

Below, well explore the ins and outs of narcolepsy, adrenal insufficiency, and adrenal fatigue. Keep reading to learn more.

Adrenal fatigue is a theory that chronic stress can impact the function of the adrenal glands. The adrenal glands are found above your kidneys and make hormones like cortisol, which is important for how you respond to stress.

Supporters of the theory of adrenal fatigue believe that the buildup of stress becomes too much for your adrenal glands. Due to this, they cannot produce enough cortisol to meet the bodys demands, causing symptoms like:

While some symptoms of adrenal fatigue are similar to those of narcolepsy, it really isnt possible to compare the two. This is because adrenal fatigue isnt recognized as a legitimate medical condition.

In a 2016 article, a group of endocrinologists reviewed 58 studies mentioning adrenal fatigue. Based on their review of the studies and how they were conducted, they could find no credible evidence that adrenal fatigue is an actual medical condition.

The reported symptoms of adrenal fatigue are general and could be caused by any actual health condition that needs to be treated. According to the Endocrine Society, these may include conditions like:

Adrenal insufficiency is a medical condition in which your adrenal glands dont make enough of the hormone cortisol and, in some cases, aldosterone. There are several types of adrenal insufficiency.

Some types have to do with decreased production of hormones in the brain. These hormones eventually promote cortisol production in the adrenal glands, so when theyre in short supply, cortisol levels are lower.

Some types of narcolepsy also have to do with decreased hormone production in the brain. In this case, its the hormone hypocretin, also called orexin, which regulates sleeping and waking.

Its also possible for people with narcolepsy to have other health conditions involving hormones, such as adrenal insufficiency and hypothyroidism.

Older research has also found that low levels of hypocretin in people with narcolepsy may impact other hormone pathways, such as those involved in adrenal insufficiency.

Lastly, theres overlap in the symptoms of adrenal insufficiency and narcolepsy, such as excessive tiredness or fatigue and muscle weakness.

However, there are many important differences between adrenal insufficiency and narcolepsy as well. Lets go over the different aspects these two conditions now.

The symptoms of adrenal insufficiency typically come on slowly and can include things like:

The symptoms of narcolepsy can include:

There are different types of adrenal insufficiency and each type as its own cause:

Similar to adrenal sufficiency, there are different types of narcolepsy. What causes each type is a little different.

People with type 1 narcolepsy, or narcolepsy with cataplexy, almost always have low levels of a hormone called hypocretin in the brain. This hormone is involved in regulating aspects of sleeping and waking.

Those with type 2 narcolepsy, or narcolepsy without cataplexy, have normal levels of hypocretin. The cause of this type of narcolepsy remains unclear.

Factors that may contribute to the development of narcolepsy in general include:

The risk factors for adrenal insufficiency can include:

You may be at an increased risk for narcolepsy if someone in your family has it. About 10% of people with type 1 narcolepsy have a close relative who reports similar symptoms.

An adrenal crisis is the most serious complication of adrenal insufficiency and is life threatening. It can happen when your body needs more cortisol than it can make, typically in response to intense physical stress caused by things like:

Its also possible for adrenal insufficiency to lead to electrolyte imbalances like too little sodium or too much potassium.

The nature of its symptoms can mean that narcolepsy can have a large impact on a persons quality of life. People with narcolepsy can experience significant disruptions in their daily life, including:

Additionally, sleep attacks and cataplexy can happen suddenly. This can be dangerous if youre driving or working in a job that involves operating heavy machinery.

In addition to taking your medical history and doing a physical exam, a doctor can use the following tests to diagnose adrenal insufficiency:

After taking your medical history, performing a physical exam, and evaluating your sleep log, your doctor can use the following tests to help diagnose narcolepsy:

The treatment for adrenal insufficiency involves replacement of the hormone cortisol. This can be done through drugs like hydrocortisone, dexamethasone, or prednisone.

Taking a drug called fludrocortisone can help maintain electrolyte balance in people who also dont make enough aldosterone.

There isnt a cure for narcolepsy. Instead, symptoms are managed using a combination of medications and lifestyle changes.

Medications for narcolepsy can include:

Lifestyle changes are also important, including setting up a regular sleep schedule, taking shorter naps during the day, and relaxing before bedtime.

If you have any of the following symptoms, its a good idea to see a doctor:

A doctor can evaluate your symptoms and test to see what may be causing them. After a diagnosis is made, they can develop a treatment plan that can help you to manage your condition.

Narcolepsy is a neurological condition affecting sleeping and waking. It causes symptoms like excessive daytime sleepiness, sleep attacks, and sudden instances of muscle weakness.

While some narcolepsy symptoms like excessive tiredness and muscle weakness overlap with adrenal insufficiency, the two conditions have many other differences in symptoms, causes, diagnosis, and treatment.

You may have also heard narcolepsy symptoms be compared to those associated with something called adrenal fatigue. However, adrenal fatigue is not recognized as an actual medical condition at this time.

Regardless, see a doctor if you have excessive tiredness, muscle weakness, or disrupted sleep that significantly interferes with your daily life. Its possible that your symptoms are due to a medical condition that needs to be treated.

Read more:
Adrenal Fatigue and Narcolepsy: Comparing the Conditions and Theories - Healthline

Recommendation and review posted by Bethany Smith

Los Angeles Times

Heres what the James Webb Space Telescope has seen in just a week of looking

A quintet of galaxies. A nursery of infant stars. A weather report for an exoplanet. And a preview of our own suns demise.

After years of delays, a 930,000-mile trip into space and months of speculation over whatthe James Webb Space Telelescopes first pictures might reveal, NASA on Tuesday released the first complete set of images captured by its $10-billion observatory.

They show stars in their infancy and in their final gasps, along with sweeping views of the cosmos and the majestic objects in it.

Every dot of light we see here is an individual star, not unlike our sun. And many of these likely also have planets, NASA astrophysicistAmber Straughnsaid while introducing an image of theCarina Nebula, a multihued landscape of gas and nascent stars.

It just reminds me that our sun and our planets and, ultimately, us were formed out of the same kind of stuff that we see here, she said. We humans really are connected to the universe. Were made of the same stuff in this beautiful landscape.

Webb Images of Jupiter and More Now Available In Commissioning Data

On the heels of Tuesdays release of thefirst imagesfrom NASAs James Webb Space Telescope, data from the telescopes commissioning period isnow being released on the Space Telescope Science Institutes Mikulski Archive for Space Telescopes. The data includes images of Jupiter and images and spectra of several asteroids, captured to test the telescopes instruments before science operations officially began July 12. The data demonstrates Webbs to track solar system targets and produce images and spectra with unprecedented detail.

Fans of Jupiter will recognize some familiar features of our solar systems enormous planet in these images seen through Webbs infrared gaze. A view from the NIRCam instruments short-wavelength filter shows distinct bands that encircle the planet as well as the Great Red Spot, a storm big enough to swallow the Earth. The iconic spot appears white in this image because of the way Webbs infrared image was processed.

In ominous sign for global warming, feedback loop may be accelerating methane emissions

If carbon dioxide is an oven steadily roasting our planet, methane is a blast from the broiler: a more potent but shorter lived greenhouse gas thats responsible forroughly one-thirdof the 1.2C of warming since preindustrial times. Atmospheric methane levels have risen nearly 7% since 2006, and the past 2 years saw thebiggest jumps yet, even though the pandemic slowed oil and gas production, presumably reducing methane leaks. Now, researchers are homing in on the source of the mysterious surge. Two new preprints trace it to microbes in tropical wetlands. Ominously, climate change itself might be fueling the trend by driving increased rain over the regions.

If so, the wetlands emissions could end up being a runaway process beyond human control, although the magnitude of the feedback loop is uncertain. We will have handed over a bit more control of Earths climate to microorganisms, says Paul Palmer, an atmospheric chemist at the University of Edinburgh and co-author of one of the studies,posted late last monthfor review atAtmospheric Chemistry and Physics.

Study: Climate impacts to disproportionately hurt tropical fishers, farmers

Coastal communities in the tropics that rely heavily on both agriculture and fisheries are most vulnerable to the losses caused by high global carbon emissions, a new study says.

It looked at coastal communities in five countries within the Indo-Pacific region and found that most may face significant losses of agricultural and fisheries products two key food sources simultaneously in the event of the worst-case impacts of climate change. These potential losses may be coupled with other drivers of change, such as overfishing or soil erosion, which have already caused a decline in productivity, according to thestudypublished July 5 in the journalNature Communications. When looked at separately, the potential losses for the fisheries sector would be greater than for agriculture, the research showed.

But if carbon emissions can be effectively managed to a minimum, the studys authors said, fewer communities would experience losses in both the agriculture and fisheries sectors.

Pioneering climate change research reveals long-term global carbon cycle impacts

A new study in Nature Geoscience, co-authored byDr Heather Ford , uses a unique research model to illustrate how past geologic periods can help us understand future climate changes. []

In this new paper, Dr Ford used geologic data and a climate model of a time about three million years ago known as the mid-Pliocene warm period, which is often used as an analogue for future climate change, because global temperatures then were around 2.3C warmer than today but CO2 levels were similar.

Whats unique about this study is the climate model was run for 2000 years, allowing conditions in the deep ocean to balance naturally over time, and enabling much deeper insight. Dr Ford explained: Running global climate models for thousands of years is computationally expensive, but critical in thinking about long-term impacts of carbon cycling and climate change.

How climate change could drive an increase in gender-based violence

As extreme weather events occur more frequently something that climate scientists say is inevitable so, too, will violence towards women and people from gender minorities. Thats the conclusion of a review examining events in the aftermath of floods, droughts, cyclones and heatwaves, among other weather disasters, over the past two decades.

The review found that extreme weather events often catalyse episodes of gender-based violence particularly physical, sexual and domestic abuse. It is the most comprehensive and timely analysis of gender-based violence related to extreme weather and climate events that are expected to increase under anthropogenic climate change, according to lead author Kim van Daalen, who studies global public health at the University of Cambridge, UK.

Its Getting Harder for Forests to Recover from Disasters

Forests around the world are losing their resilience and becoming more vulnerable to disturbances as the planet warms. Thats especially true for ecosystems in tropical, temperate and dry parts of the world, according to a new study.

When a forest loses resilience, it means its gradually losing its ability to bounce back after fires, droughts, logging and other disruptive events, said thestudy, published on July 13 inNature. Past a certain point, some forests may approach a kind of tipping point a threshold that launches them into a rapid decline.

And beyond that, some studies suggest, a forest may not be able to fully recover at all. It may instead transform into some other ecosystem entirely, like a grassland or savanna.

Study provides new clues to killer frog disease

A new study aiming to unlock the secrets of a disease devastating frog populations has turned up some unexpected results, which may change how scientists combat the outbreak.James Cook University biologist Dr Donald McKnight said the disease chytridiomycosis has caused declines or extinctions in over 500 species of amphibians worldwide.

But not all amphibian species are susceptible to chytridiomycosis, and some species and populations that underwent initial declines are surviving or increasing, despite the continued presence of the pathogen, said Dr McKnight. []

The reasons for these differences among species and populations are not entirely clear, but variations in microbiomes - the bacteria, fungi, and other microorganisms on the frogs - may play a key role, said Dr McKnight.

Machine learning identifies crater that ejected famous Martian rock

New Curtin-led research has pinpointed the exact home of the oldest and most famous Martian meteorite for the first time ever, offering critical geological clues about the earliest origins of Mars.

Using a multidisciplinary approach involving a machine learning algorithm, the new research published today inNature Communications identified the particular crater on Mars that ejected the so-called Black Beauty meteorite, weighing 320 grams, and paired stones, which were first reported as being found in northern Africa in 2011.

The researchers have named the specific Mars crater after the Pilbara city of Karratha, located more than 1500km north of Perth in Western Australia, which is home to one of the oldest terrestrial rocks.

Zombie fly fungus lures healthy male flies to mate with female corpses

Entomophthora muscaeis a widespread, pathogenic fungus that survives by infecting common houseflies with deadly spores. Now, research shows that the fungus has a unique tactic to ensure for its survival. The fungus 'bewitches' male houseflies and drives them to necrophilia with the fungal-infected corpses of dead females.

After having infected a female fly with its spores, the fungus spreads until its host has slowly been consumed alive from within. After roughly six days, the fungus takes over the behavior of the female fly and forces it to the highest point, whether upon vegetation or a wall, where the fly then dies. When the fungus has killed the zombie female, it begins to release chemical signals known as sesquiterpenes.

"The chemical signals act as pheromones that bewitch male flies and cause an incredible urge for them to mate with lifeless female carcasses," explains Henrik H. De Fine Licht, an associate professor at the University of Copenhagens Department of Environment and Plant Sciences and one of the studys authors.

Social support found to reduce stress levels in orphaned wild elephants

A team of researchers from Colorado State University, the Smithsonian Conservative Biology Institute and the Save the Elephants program in Kenya reports that social support by members of elephant herds in African savanna elephants reduces stress levels of orphaned youngsters. In their paper published in the journalCommunications Biology, the group describes their study of stress levels in orphaned wild elephants and their ability to rebound from a great loss.

Over the past several decades, African savanna elephants, the largest land animals in the world, have seen population declines due to increases in both poaching and droughta situation that has led to many elephants being orphaned. Because of the long maturation process (it takes 20 years for the elephants to reach their full size), the number of orphans has increased overall. Also, elephantcalvesare highly dependent on their mothers for the first decade of their lives. In this new effort, the researchers studied the stress levels of orphans as they adapted to sudden changes in their care.

To learn more aboutorphanstress levels, the researchers followed several herds for over a year, watching carefully when they defecated. They collected the samples and tested them for glucocorticoid metabolite (GCM) levelsa relatively easy way to measurestress levelsin mammals.

A woodpecker's brain takes a big hit with every peck: study

The brain of a woodpecker experiences a seemingly catastrophic impact every time beak meets wood.

"When you see these birds in action, hitting their head against a tree quite violently, then as humans we start wondering how does this bird avoid getting headaches or brain damage," saysSam Van Wassenbergh, a researcher at the University of Antwerp in Belgium.

In the past, scientists havesuggestedthe bird's brain is protected from the impacts, perhaps bya skull that acts as a cushion, or a beak that absorbs some of the force, or a tongue that wraps around the brain.But Van Wassenberg wasn't convinced.

"Nobody has ever explained it very well, in my opinion," he says.

Difficult and costly. Snake dams should be breached, says Biden administration report

Breaching one or more of the lower Snake River dams in Eastern Washington is called for in a National Oceanic and Atmospheric Administration draft report released Tuesday.

The draft report looks at the state of the science on restoring salmon and steelhead populations in the Columbia River Basin and the large scale actions needed to make progress toward healthy and harvestable fish stocks.

It has become overwhelmingly clear that business as usual will not restore the health and abundance of Pacific Northwest salmon, said Brenda Mallory, chairwoman of the White House Council on Environmental Quality, at a news media briefing Monday afternoon. []

The NOAA draft report, Rebuilding Interior Columbia Basin Salmon and Steelhead, said the science calls for acting, and acting now.

Inaction will result in the catastrophic loss of the majority of Columbia River Basin salmon and steelhead stocks, the draft report said.

Knots in the resonator: elegant math in humble physics

At the heart of every resonator be it a cello, a gravitational wave detector, or the antenna in your cell phone there is a beautiful bit of mathematics that has been heretofore unacknowledged. Yale physicists Jack Harris and Nicholas Read know this because they started finding knots in their data.

In a new study in the journal Nature, Harris, Read, and their co-authors describe a previously unknown characteristic of resonators. A resonator is any object that vibrates only at a specific set of frequencies. They are ubiquitous in sensors, electronics, musical instruments, and other devices, where they are used to produce, amplify, or detect vibrations at specific frequencies.

The new characteristic the Yale team found results from equations that any high school algebra student would recognize, but which physicists had not appreciated as a basic principle of resonators.

Bat Virus Studies Raise Questions About Laboratory Tinkering

In mid-2020, a team of scientistscatching bats in Laotian cavesdiscovered coronaviruses that were strikingly similar to the one that had begun wreaking havoc around the world.

In the months since, some of those researchers have been studying one of these mysterious bat viruses in a high-security laboratory in Paris, hoping to discover clues about how its cousin, SARS-CoV-2, went on to become a global threat that has killed anestimated 15 million people.

Their work has been scientifically fruitful. Last year, the scientists discovered thatthe bat virus was capable of latching onto human cells, at least in Petri dishes. Last month, the teamreportedmore reassuring news: that the virus is not particularly harmful to lab animals. The finding suggests that SARS-CoV-2 evolved its abilities to spread quickly and cause deadly disease only after the two lineages branched apart on the viral evolutionary tree.

Mysterious glow of a milky sea caught on camera for first time

Waking at 10pm, a sailor looked out from the deck of the superyacht Ganesha to see that the ocean had turned white. There is no moon, the sea is apparently full of plankton, but the bow wave is black. It gives the impression of sailing on snow, they wrote.

For centuries, mariners have described navigating unearthly night-time waters, lit up by a mysterious glow, but such milky seas have long eluded scientific inquiry owing to their remote, transient and infrequent nature.

Id say theres only a handful of people currently alive who have seen one. Theyre just not very common maybe up to one or two per year globally and theyre not typically close to shore, so you have to be in the right place at the right time, said Steven Miller, a professor of atmospheric science at Colorado State University in Fort Collins.

An Army of Turtles Is Doing Cyclone Reconnaissance

Even with good data, its hard to predict tropical cyclones, which often appear with little warning and wander drunkenly around the worlds oceans. But five years ago, Olivier Bousquet, now the research director for Frances Ministry of Ecology, Sustainable Development and Energy, was tasked with forecasting storms strengths and paths in the cyclone-infested southwest Indian Ocean. The need for better predictions was great. On average, the area gets nine or 10 cyclones a year, and the storms are getting stronger. Tropical Cyclone Idai, in 2019, killed more than 1,000 people in Mozambique, Zimbabwe, and Malawi and 2014s Gafilo killed 363 in Madagascar.

Unlike in some other parts of the oceansuch as the North Atlantic, where the U.S. National Oceanic and Atmospheric Administration flies weather dronesBousquet had almost no data to work with. Sure, there are satellites that spy on the oceans surface, but those are biased around coastlines and blind in clouds, which storms have in spades. Just a handful of floating oceanographic buoys collected temperature, depth, and salinity information where Bousquet needed it. So he set out to find a new source of data.

For the past few decades, scientists have been using satellite-tagged animals to collect ocean data. For instance, in the Southern Ocean off Antarcticaa famously hostile area for humans and shipssouthern elephant seals have gathered much of the basic data we have on the waters temperature and salinity.

Researchers harness algae to grow construction cement

The massive worldwide pouring of concrete as developers densify cities could be transformed, eliminating heat-trapping pollution into the atmosphere, by switching to a new kind of cement created in Colorado cement that is grown by harnessing tiny sea organisms.Urban concrete jungles also would look less gray because the new cement is lighter in color and more reflective.

The U.S. Department of Energy this month embraced University of Colorado research that developed this cement, investing $3.2 million for scaling up cultivation of an algae species called coccolithophores. CUs innovation appealed to the DOEs Advanced Research Projects Agency because cement production causes 7% of the global heat-trapping pollution that accelerates climate warming. Thats a significant share, exceeding emissions from airplane travel.

This is a carbon dioxide removal project, said CU Boulder materials scientist Wil Srubar, leader of the work and director of CUs Living Materials Laboratory, who got got the idea while snorkeling in Thailand on his honeymoon in 2017. He saw magnificent natural limestone structures in coral reefs and wondered whether humans could replicate natural processes to make enough limestone for cement instead of excavating limestone from quarries.

Y chromosome loss through aging can lead to an increased risk of heart failure and death from cardiovascular disease, new research finds

The Y chromosome can be lost through the process of aging, and this can lead to an increased risk of heart failure and cardiovascular disease, according to a recent study my colleaguesand Ipublished in the journalScience.

While most women have two X chromosomes, most men have one X and one Y. And many people with Y chromosomes start to lose them in a fraction of the cells in their body as they age.

While loss of the Y chromosome wasfirst observed in 1963, it was notuntil 2014that researchers found an association between loss of the Y chromosome and shorter life span. Y chromosome loss has since been linked to a number ofage-related diseases, such as cancer and Alzheimers disease. However, it has been unknown whether this loss is just another benign indicator of aging, like gray hair or skin wrinkles, or whether it has a direct role in promoting disease. []

We found that while loss of the Y chromosome did not have immediate effects on the young mice, they ended up aging poorly, dying at an earlier age than mice that still had Y chromosomes. They also had more buildup of scar tissue in the heart, a condition calledfibrosis, as well as a stronger decline in heart function after induced heart failure. Treating the mice with a drug that blocks heart scarring, however, was able to restore lost heart function.

Genetic testing could help match people with the right antidepressant, new VA study finds

Understanding patient genetics could help to minimize the trial-and-error approach to prescribing antidepressants, a national study led by researchers at the Crescenz VA Medical Center in Philadelphia has found.

Finding the right antidepressant can take time. Its not uncommon for patients to try a few before finding an effective medication without too many side effects. Each round can mean losing weeks while waiting for the medication to start working, a frustrating reality for patients who seek relief and prescribers who often have little to guide them toward the optimal prescription.

Often with medications you might start with one, a patient might have side effects for that or it might not work, said David Oslin, a psychiatrist at the Philadelphia-based VA Medical Center. You end up with a second or third trial before finding something thats effective.

The oldest, brightest black holes in the universe were born from violent gas attacks, new study suggests

Twinkling like cosmic lighthouses on a shore 13 billion light-years from Earth, quasars are some of the oldest, brightest relics of the early universe that astronomers can detect today.

Short for "quasi-stellar radio sources," quasars are gargantuanblack holesthat glow as brightly as galaxies and are millions to billions of times as massive asEarth's sun. Today, quasars exist at the centers of many large galaxies. But thanks to their exceptional luminosity, quasars have been tracked far acrossspace-time, with roughly 200 of them identified as forming within the first billion years of our universe's history.

How could such massive objects form so early, when galaxies were sparse and large stars were exceptionally rare? The question has bedeviled researchers for more than two decades, since the first quasars were identified and now, a new study published July 6 in the journalNature

Researchers Have Found The First Example of Another Mammal 'Farming' Its Food

It was thought that humans were unique amongst mammals when it came to farming but depending on how strict we are with definitions, it turns out we might not be alone when comes to tending the land to grow food.

Scientists have discovered thatpocket gophers(Geomys pinetis) also practice a form of agriculture.

Measurements on a field containing burrows built by the little critters suggest they don't just harvest the longleaf pine roots that grow into their homes they cultivate them. []

"Southeastern pocket gophers are the first non-human mammalian farmers,"says biologist Francis Putz, from the University of Florida. "Farming is known among species of ants, beetles, and termites, but not other mammals."

Geologists reveal trends in mineral diversity

By classifying minerals by how they were made, scientists could better study the complex chemistry on other worlds.

Geology reference texts define mineral species based on chemical composition and crystal structure. But mineral samples collected in the field often contain trace elements and structural defects that distinguish most specimens from a textbook example. If youre interested in comparing Earth with other planets, both within our solar system and beyond, then you really need to think beyond those very simple, idealized structures, saysRobert Hazen, a mineralogist and astrobiologist at the Carnegie Institution for Science. So Hazen and his colleagues devised a new way to categorize minerals using the imperfections that tell stories about each minerals geologic past.

Because minerals acquire defects as they form, the isotopic ratios and foreign inclusions trapped within their crystal lattices can help researchers understand the context in which they were made. After combing the literature, Hazen and his team identified approximately 60 processes, such as lightning and oxidation events, that contribute to the formation of the more than 5,000 minerals known on Earth.

If Youre Owned by a Cat, Scientists Want to Hear From You

Scientists in California are asking for U.S. volunteers who live with cats to participate in a new research project. The study will survey owners about their pets behaviours and their knowledge of training methods. The teams larger goal is to help cats especially kittens and humans better form healthy relationships with one another.

The work is being conducted by scientists from the Animal Welfare Epidemiology Lab at the University of California Davis. Last fall, the teamrecruitedvolunteers who owned exactly two cats to look at cat videos on the internet, as part of a project to study how well owners could read feline body language. They were especially interested in knowing whether owners could tell when cats were about to lash out at their furry roommates.

View original post here:
Overnight News Digest: We humans really are connected to the universe. - Daily Kos

Recommendation and review posted by Bethany Smith

Researchers still haven't nailed down how to better predict who's at risk for attempting suicide, and whether or when vulnerable people will do it, said Justin Baker, clinical director of The Suicide and Trauma Reduction Initiative for Veterans at The Ohio State University Wexner Medical Center.

"That is extremely, extremely difficult," he said. "You can look back in time, when someone's made an attempt or has died, and go, 'Oh, look at all these things that were going on in their life.' The difficulty is that a lot of people handle or experience those types of stressors as well but never go on to (attempt suicide)."

Additionally, there isn't always a long timeframe wherein someone is considering suicide and showing signs -- and there can be as little as 5 to 15 minutes between someone deciding to attempt suicide and doing it, Baker added.

"What we collectively understand is it's an emotional dysregulation and cognitive error that occurs," Baker said. "They can't fix the situation, or they can't think their way through the situation, so suicide becomes a viable option as a way to manage the pain that they're in. So they may take action on it in that really short, brief window."

But there are some situations wherein a person who is suicidal and planning for a longer period of time will show behavioral changes, Baker added.

"If you're noticing that kind of stuff, obviously that's someone who is really close to being imminent risk -- someone who's really close to making that decision to end their life," he said. "But I would argue most people don't get that kind of warning."

Here are some of the most common behavioral, verbal and emotional signs and risk factors you should pay attention to, according to experts.

Behaviors to watch for

Some people might seem like their usual selves in the weeks or days leading up to a suicide attempt, while others might show behavioral changes that don't track with what you know about them, said Michael Roeske, a clinical psychologist and senior director of the Newport Healthcare Center for Research & Innovation.

Other potential behavioral red flags include giving away cherished belongings, sleeping too much or too little, withdrawing or isolating oneself, showing rage or desire to enact revenge, and acting anxious or agitated, according to Roeske, Baker and SAMHSA. Getting really intoxicated one night or driving recklessly could also be signs to watch out for, Roeske said.

Such behavior might be them "testing themselves to see if they can actually do it," Baker said. "A lot of times people need to kind of work up to that actual making an attempt because it's a biologic thing you have to go against, your own survival."

Concerning comments

Talking about wanting to die -- by suicide or otherwise -- is another warning sign that should always be taken seriously, Roeske said. Such comments are sometimes just expressions of discomfort, pain, boredom or desire for closeness rather than a reflection of actually wanting to die, but that doesn't mean you don't monitor the person who's making them, he added.

Some people might say they feel like they have no reason to live. "If someone is struggling to come up with a reason for living, that's a much higher-risk person than someone who's even able to identify one (reason)," Baker said.

Others talk about feeling like a burden on those close to them, Roeske said, or like they don't belong anywhere or with anyone. Such comments might include "You don't need me for this anymore" or "I feel like it'd be better if I just wasn't here." Teenagers considering suicide might not want their guardians to use their money for college, he added.

Mood and other risk factors

What to do

If any of these signs resonate with you, seek professional help and talk with someone you can trust and feel supported by, Baker said. Psychotherapy and certain psychiatric medications, such as antidepressants, can help, Roeske said.

If a loved one is showing signs they might be at risk of suicide, "it's not really your job to be able to predict the future," Baker said. But you can be supportive and intentional about asking them what's going on, Roeske and Baker said.

"You're not going to cause someone to be suicidal by asking directly about suicide," Baker said. "The worst they're going to say is 'no' and not get offended. If they are, still ask them. I'd rather have someone offended at me than dead."

When checking on someone, use what experts call a narrative, person-centered approach, Baker recommended. That might look like an open-ended question: "Hey, I've noticed life's gotten overwhelming these past couple days. Do you want to tell me about it?"

As the person responds, you can, to some extent, listen, express appreciation for them sharing their story and offer to help figure it out together, without offering advice on how to handle it, Baker said. But if your loved one seems more at risk or in the process of attempting suicide, "you no longer have time or the luxury to get their opinion," he added. Get medical care or call 911.

When Roeske first started working as a clinician, he had a young female patient who was a very accomplished equestrian, went to a prestigious school and had a lot of family resources, he said -- but she had been chronically suicidal for 10 to 15 years, since she was a teenager.

"Every time she would go to her mom and tell her that, her mom would (say things like) 'Oh, you're so beautiful. Look at how you are with the horses,'" Roeske said. "And (the patient) said, 'What it felt like was Mom was afraid of what I was saying and needed to distance herself from it.'

She said that therapists would do the same thing -- you know, 'create a positive gratitude list or correct your cognitive distortions.' Finally, there was a psychiatrist that looked at her as she said, 'I think I'm going to kill myself.' And the psychiatrist said, 'I think you might, too.' And she said it was the first time someone was willing to be in there with her."

When talking with someone who's suicidal, you might want to tell them all the wonderful reasons why they should stay alive, Roeske said -- but that can actually make them feel more lonely.

Unfortunately, "we are no better able to predict who will die by suicide than who will be in a car accident," Baker said. "This does not help to alleviate the grief or pain for those who have lost loved ones to suicide, but hopefully it helps remove some of the guilt and responsibility."

CNN's Jacqueline Howard contributed to this story.

Go here to read the rest:
People considering suicide might show signs early on. Here's what to watch for - CNN

Recommendation and review posted by Bethany Smith

Introduction

Stem cells are highly specialized cell types with an impressive ability to self-renew, able to transform into one or even more specific cell types that play a significant role in the regulation and tissue healing process.17 To self-renew, a stem divides into two identical daughter stem cells and a progenitor cell and the embryonic and adult cells contain stem cells.1,2,8

Curing patients with serious medical conditions has been the focus of all disciplines of medical research for many years. Stem cell treatment has evolved into a highly exciting and progressed field of scientific research. Major advances have recently been introduced in fundamental and translational stem-cell-based treatment studies. As stem cell research progressed, many therapeutic options were investigated. The development of therapeutic procedures has sparked a great deal of interest.1,9 Humanity has known for many years that it is possible to regenerate lost tissue. Recently, the regenerative medicine research has taken hold, defying the tremendous scientific advances in the molecular biology sciences only. Technological advances provide limitless opportunities for transformational and potentially restorative therapies for many of humanitys most illnesses. A variety of human organs have successfully yielded stem cells. Besides this, the cell therapy is rapidly bringing good advancements in the healthcare system, intending to restore and possibly replace injured tissue, as well as organs, and ultimately restore the functional capacity of the body.2,10,11

The stem cells can be obtained from various sources of Adult (Adult body tissues), Embryonic (Embryos), Mesenchyma (Connective tissue or stroma), and Induced pluripotent stem [ips] cells (Skin cells or tissue-specific cells).3,68,1215

Due to various stem cells cellular characteristics, the therapeutic clinical possibilities of stem-cell-based treatment are considered promising. These cells can regrow and restore various types of body tissues, for this reason, they are recognized as precursor cells to all kinds of cells.15 The following are the distinguishing features: 1. Self-renewal- Divide without distinction to generate an infinite supply, 2. Multi-potency- One mature cell may distinguish more than one, 3. Pluripotency- Create all sorts of cells except for embryonic membrane cells, 4. Toti- potency- Produce various sorts of cells, including embryonic stem cells.1,2,6,7,16

Stem cells are essential human cells that really can self-renew and make a distinction into particular mature cell types.3,6 The different types of stem cells are embryonic, induced pluripotent, and adult kind of cell types. They all share the important feature of self-renewal, and the ability to discern themselves. It should be mentioned that, the stem cells are not homogeneous, but instead appear in a progressive order. Totipotent stem cells are the most basic and immature stem cells. The above cells can form a complete embryo and also extra-embryonic tissue. This one-of-a-kind efficiency is only present for a short period, starting with ovum development and completing whenever the embryo achieves the 4 to 8 cell phases. Having followed that, cells that divide until they approach the blastocyst, about which point they end up losing their totipotency and acquire a pluripotent character trait, at which cells can only distinguish through each embryonic germ stack. After a few divisions, the pluripotency character trait starts to fade and the distinguishing ability has become more lineage constrained, where its cells are becoming multipotent, indicating they could only transform into the cells connected to a cell or tissue of origin.10 Many researchers believe that adult stem cells should be used in stem cell therapies.6,17

The stem cells can be transformed into a wide range of specialized functional cell types.3,18 In response to injury or maturation, those same stem cells can propagate in massive quantities.19 Adult, embryonic, and induced pluripotent stem cells are examples of stem cell-based therapies.14,15,1921 The stem cells, due to their capability to distinguish the specific cell types requisite for a diseased tissue regeneration, can provide an effective solution, while tissue and organ transplantation are considered necessary.10 The sophistication of stem cell-based treatment interventions, on the other hand, probably leads researchers to seek stable, credible, and readily available stem cell sources capable of converting into numerous lineages. As an outcome, it is critical to exercise caution when selecting the type of stem cells to be used in therapeutic trials.12,14,22

Only with the explosive growth of basic stem cell research in recent years, the comparatively recent study sector of Translational Research had also grown exponentially, starting to build on major research knowledge and insight to advance new therapies. Once the necessary regulatory clearances have been obtained, the clinical translation process can start. Translational research is important because it acts as a filtration system, ensuring that only safe and effective therapeutic approaches start making it to the clinic.23 Recent research illustrating, the successful application of stem cell transplantation to patient populations suggests that, such restorative approaches have been used to address a wide variety of complicated ailments of future concerns.19,24

Currently, clinical trials are available for a variety of stem cell-based treatments based on adult stem cells. To date, the WHO International Clinical Experiments Registration process has recorded more than 3000 experiments involved based on adult stem cells. Furthermore, preliminary trials involving novel and intriguing pluripotent stem cell therapies have been registered. These studies findings will assist the ability to comprehend and the timeframes required to obtain effective treatments and it will contribute to a better knowledge of the different disorders or abnormalities.10

The role of stem cells in modern medicine is vital, both for their widespread application in basic research and for the opportunities they provide for developing new therapeutic strategies in clinical practice.6,16 In recent times, the number of studies involving stem cells has expanded tremendously. Globally, thousands of studies claiming to use stem cells in experimental therapies have now been in the investigation field. This may give the impression that such treatments have already been shown to be extremely effective in the context of healthcare. Despite some promising results, the vast majority of stem cell-based therapeutic applications are still in the experimental stage itself.6,25

The stem cells are a valuable resource for understanding organogenesis as well as the bodys continual regenerative capacity. These cells have brought up enormous anticipations among doctors, investigators, patients, and the public at large because of their ability to distinguish into a variety of cell types.25 These cells are necessary for living beings for a variety of reasons and can play a distinguishable role. Several stem cells can play all cell types roles, and when stimulated effectively, they can also repair damaged tissue. This capability has the potential to save lives as well as treat human injuries and tissue destruction. Moreover, different kinds of stem cells could be used for several purposes, including tissue formation, cell deficiency therapeutic interventions, and stem cell donation or retrieval.3,6,26

New research demonstrating that the successful application of stem cell treatments to patients has expressed hope that such regenerative strategies might very well one day is being used to address a wide variety of problematic ailments. Furthermore, clinical trials incorporating stem cell-based therapeutics have advanced at an alarming rate in recent years. Some of these studies had a significant impact on a wide range of medical conditions.10 As a regenerative medicine strategy, cell-based treatment is widely regarded as the most fascinating field of study in advanced science and medicine. Such technological innovation paves the way for an infinite number of transformational and potentially curable solutions to some of humanitys most pressing survival issues. Moreover, it is gradually becoming the next major concern in medical services.11

Modern data, which shows that the successful stem cell transplantation in beneficiaries has raised hopes on the certain rejuvenating approaches, will one day be used to treat many different types of challenging chronic conditions.24 Preliminary data from highly innovative investigations have documented that the prospective advancement of stem cells provides a wide range of life-threatening ailments that have so far eluded current medical therapy.2,10,11 Furthermore, clinical trials involving stem cell-based therapies have advanced at an unprecedented rate. Many of these studies had a significant impact on various disorders.19 Despite the increasing significance of articles concerning viable stem cell-based treatments, the vast majority of clinical experiments have still yet to receive full authorization for stem cell treatments confirmation.11,12,27

Even though the first case of AIDS were noted nearly 27 years ago, and the etiologic agent was noticed 25 years ago, still for the effective control of the AIDS pandemic continues to remain elusive.28 The HIV epidemic started in 1981 when a new virus syndrome defined by a weakened immune system was revealed in human populations across the globe. AIDS showed up to have a substantial reduction in CD4+ cell counts and also elevated B-cell multiplication.15,2831

The agent that causes AIDS, later named HIV, is a retroviral disease with a genomic structural system made up of 2 identical single-stranded RNA particles.3234 According to the Centres for Disease Control and Prevention, with over 1.1 million Americans are presently infected with the virus.31 Compromised immune processes in HIV and AIDS, as well as partial immune restoration, barriers are confirmed for HIV disease eradication. Innovative developmental strategies are essential to maximizing virus protection and enabling the host immune response to eliminate the virus.35

The progression of HIV infection in humans is divided into the following stages of acute infection, chronic infection, and AIDS.15,36 During the acute infection phase, the circulation has a high viral replication, is extremely infectious, that may or may not demonstrate flu-like clinical signs. In the chronic stage, the viral load is lesser than in the acute stage, and individuals are still infectious but may be symptomless. The patient has come to the end stage of AIDS whenever the CD4+ cell count begins to fall below 200 cells/mm or even when opportunistic infections are advanced.15,36

There are currently two types of HIV isolated HIV-1 and HIV-2.15,37,38 However, HIV-1 is the most common cause of AIDS throughout the world, while HIV-2 is only found in a few areas of an African country. Although both virions can cause AIDS, HIV-2 infection is much more likely to occur in central nervous system disorder.15 Besides this, HIV-2 seems to be less infectious than HIV-1, and HIV-2 infection induces AIDS to develop more slowly. Even though both HIV-1 and HIV-2 have a comparable genetic structure comprised of group-specific antigen, polymerase, and envelope genes, their genome organizational structures are differed.15,3739

HIV infiltrates immune cell types, CD4+ T cell types, and monocytes, resulting in a drop in T-cell counts below a critical level and the failure of cell-mediated immune function.15,40 The glycoprotein (gp120) observed in the virion envelope comes into contact with the CD4 particle with high affinity, allowing HIV to infect T cells. By interacting with their co-receptors, CXCR4 and CCR5, the virus infiltrates T cells and monocytes. The retrovirus uses reverse transcriptase to convert its RNA into DNA after attaching it to and entering the host cell. These newly replicated DNA copies then exit the host cell and infect other cells.15,40,41

HIV-1 is a retrovirus and belongs to a subset of retroviruses known as lentiviruses.38,42 Infection is the most common global health concern around the world.15 It has destroyed the millions of peoples health and continues to wreak havoc on the individual health of millions more. The pandemic of HIV-1 is the most devastating plague in the history of humans, as well as a significant challenge in the areas of medicine, public health, and biological science of research activities.34,43 Antiretroviral therapy is the only treatment that is commonly used. This is not a curative treatment; it must be used for the rest of ones life.15 Although antiretroviral therapy has reduced significantly HIV intensity and transmission, the virus has not been eradicated, and its continued presence can lead to additional health issues.44

Infection with the human immunodeficiency virus necessitates entry into target cells, such as through adhesion of the viral envelope to CD4 receptor sites.43 Cellular antiviral responses fail to eliminate the virus, resulting in a gradual depletion of CD4+ T cells and, finally, a severely compromised immune functioning system. Unfortunately, there is no cure for the virus that destroys immunity.4447 In advanced HIV infection, memory T-cell depletion primarily affects cellular and adaptive immune responses, with a minor impact on innate immune responses.48 Globally, 37.7 million people were living with HIV in 2020, and with 1.5 million individuals are infected with the virus.49 The advancement of stem cell therapy and the conduct of implemented clinical trials have revealed that stem cell treatment has high hopes for a range of medical conditions and implementations.15

Stem cell treatment has shown impressive outcomes in HIV management and has the potential to have significant implications for HIV treatment and prevention in the future. In HIV patients, stem cell therapy helps to suppress the viral load even while enabling antiretroviral regimens to be tapered. Interestingly, this practice led to a significant improvement in procedure outcomes soon after starting antiretroviral treatment.15 Stem cell transplantation can alleviate a wide variety of diseases that are currently incurable. They could also be used to create a novel anti-infection therapy strategic plan and to enhance the treatment of immunologic conditions such as HIV infection. HIV wreaks havoc on immune system cells.30,50

The virus infects and replicates within T-helper cells (T-cells), which are white immune system cells. T-cells are also referred to as CD4 cells. HIV weakens a persons immune system over time by pulverizing more CD4 cells and multiplying itself. More pertinently, if the individual has been unable to obtain anti-retroviral medicine, he will progressively fail to control the infectious disease and illnesses.3,15,42

Despite 36 years of scientific research, investigators are still trying to cure human HIV and its potential problem, AIDS.3,5153 HIV continues to face unconquerable dangers to human survival. This virus has developed the potential to avoid anti-retroviral therapy and tends to result in victim death.52 Investigators are still looking for effective and all-encompassing treatment for HIV and its complexity, AIDS.54 This massive amount of data revealed potential AIDS treatment targets.55 Thousands of research projects have yielded a great deal of information on the elusive AIDS life cycle to date.5456 These massive amounts of data supplied possible targets for AIDS treatment.33,55,56 In HIV-infected patients, using stem cell therapy can augment the process of keeping the viral load stagnant by permitting antiretroviral regimens to be tapered.15

Overall, stem cell-based strategies for HIV and AIDS treatment have recently emerged and have become a key area of research. Ideally, effective stem cell-based therapeutic approaches might have several benefits.30 Clinical studies encompassing stem cell therapy have shown substantial therapeutic effects in the treatment of various autoimmune, degenerative, and genetic problems.15,25 Substantial progress has been developed in the treatment of HIV infection using stem cell-based techniques.30

Successfully treated, clinical studies have shown that total tissue recovery is feasible.15,57 In the early 1980s, the first stem cell transplants were accomplished on HIV-positive patients who were unsure of their viral disease. Following the above preliminary aspects, many HIV-positive patients with concurrent malignant tumours or other hematologic disorders underwent allogeneic stem cell transplantation around the world.42 After ART became a common treatment option for patients,58,59 the procedures prognosis improved dramatically. In addition, a retrospective study of 111 HIV+ transplant patients demonstrated a mildly lower overall survivorship performance in comparison to an HIV-uninfected comparison group.60

Earlier, the primary problem for people living with HIV and AIDS was immunodeficiency caused by a loss of productive T-cells. Some clinicians intended to replenish lost lymphocytes through adoptive cell transplants in the initial days before efficacious antiretroviral therapy options were available. Immunologically, it is relatively simple in an isogeneic condition, as illustrated on HIV-positive individuals with just a correlating identical twin who received T-lymphocytes and stem cell transfusions to rebuild the weak immune status of the patient.60 Cell therapy transfusion may be used to remove resting virion genomes from CD4+ immune cells and macrophages mostly through genome-editing or cytotoxic anti-viral cells.15,60 Cell technology and stem cell biological reprogramming developments have made a significant contribution to novel strategies that may give confidence to HIV healing process.3 However, human embryonic stem cells can be distinguished into significant HIV target cells, according to several research findings.30,61,62

Initially, stem cell transplantation was believed to influence the clinical significance of HIV infection, but viral regulation was not accomplished in the discipline. Moreover, improvements in stem cell transplants utilizing synthetic or natural resistant cell resources, in combination with novel genetic manipulative tactics or the advancement of cytotoxic anti-HIV effector cells, have significantly accelerated this sector of HIV cell management.60 Multiple techniques are being introduced to overcome HIV, either through protecting cells from infectious disease or by continuing to increase immune responses to the viral infection.30 The various methods are as follows: Bone marrow stem cells Therapies, Autologous stem cell transplantations, Hematopoietic stem cell transplantation, Genetical modifications of Hematopoietic stem cells (HSCT), HSCT and HAART therapeutic approach, Human umbilical cord mesenchymal stem cell transplantation, Mesenchymal stem/stromal cells (MSCs) applications, CCR5 Delta32/Delta32 Stem-Cell Transplantation, CRISPR and stem cell applications, Induced Pluripotent Stem Cells applications.

According to the findings, circulating replicative HIV remains the most significant threat to effective AIDS therapy. As a result, a method for conferring resistance to circulating HIV particles is required. The effective viral burden in the human body would be significantly reduced if it were possible to defeat reproducing HIV particles.43,44 For the treatment of AIDS, a restorative approach that relies on bone marrow stem cells has been suggested.52 The proposed treatment method captures and eventually destroys circulating HIVs using receptor-integrated red blood cells. Red blood cell membranes can be equipped with the CD4 receptor and the C-C chemokine receptor type 5 and C-X-C chemokine receptor type 4 co-receptors, which will selectively bind circulating HIV particles.15,30,32,33,43,44,46,6365

The term autologous pertains to blood-forming stem cells obtained from the patient for use as a source of fresh blood cells followed by high-dose chemotherapeutic agents.66 Lymphoma is still the biggest cause of mortality in HIV patients. Autologous stem cell recovery or transplantation with high-dose treatments has long been supported as a treatment for certain types of cancer in HIV-negative patients, including leukaemia and lymphoma. Individuals over the age of 65, as well as those with health problems such as HIV, were excluded from initial transfusion experiments. Moreover, the treatment regimen mortality of transplantation has also been reduced significantly due to its use of peripheral blood stem cells rather than bone marrow and the use of newer marginal conditioning therapeutic strategies. HIV-infected clients may be able to utilize enough stem cells for an autologous transplant advancement in HIV management. High-dose Autologous stem cell transplant (ASCT) treatments are better than conventional treatment in people with relapsed non-Hodgkin lymphoma, according to randomized trial evidence. Similarly, studies on HIV-negative people with Hodgkin Lymphoma have shown that ASCT would provide patients with repetitive illness with long-term progression-free survival.66,67 Even so, the clinical trial on Allogeneic Hematopoietic Cell Transplant for HIV Patients with Hematologic Malignancies report was explained as, the cell-associated HIV DNA and inducible infectious virus were not detectable in the blood of patients who attained complete chimerism.68

The study on long-term multilineage engraftment of autologous genome-edited hematopoietic stem cells in nonhuman primates report findings was Genome editing in hematopoietic stem and progenitor cells (HSPCs) is a potential innovative approach for the treatment of numerous human disorders. This report shows that genome-edited HSPCs engraft and contribute to multilineage repopulation following autologous transplantation in a clinically relevant large animal model, which is an important step toward developing stem cell-based genome-editing therapeutics for HIV and possibly other illnesses.69

Research on comprehensive virologic and immune interpretation in an HIV-infected participant again just after allogeneic transfusion and analytical interruption of antiretroviral treatment findings are the instance of HIV-1 cure having followed allogeneic stem cell transplantation (allo-SCT), resulting allo-SCTs in HIV-1 positive participants have failed to cure the disease. It describes adjustments in the HIV reservoir in a single chronically HIV-infected client who had undergone allo-SCT for acute lymphoblastic leukaemia treatment and was obtaining suppressive antiretroviral treatment.

To estimate the size of the HIV-1 reservoir and describe viral phylogenetic and phenotypic modifications in immune cells, the investigators just used leukapheresis to obtain peripheral blood mononuclear cells (PBMCs) from a 55-year-old man with chronic HIV infection prior and after allo-SCT. Once HIV-1 was found to be unrecognizable by numerous tests, including the PCR measurement techniques both of overall and fully integrated HIV-1 DNA, recompilation virus precise measurement by significant cell input quantifiable viral outgrowth assay, and in situ hybridization of intestine tissue, the client accepted to an analytic treatment interruption (ATI) with recurrent clinical observing on day 784 post-transplantation. He continued to remain aviremic off ART until ATI day 288, once a reduced virus rebound of 60 HIV-1 copies/mL resulted, which expanded to 1640 HIV-1 copies/mL five days later, urging ART reinitiation. Rebounding serum HIV-1 action sequences were phylogenetically distinguishable from pro-viral HIV-1 DNA discovered in circulating PBMCs before transplantation. It was indicated that allo-SCT tends to result in significant reductions in the magnitude of the HIV-1 reservoir and a >9-month ART-free cessation from HIV-1 multiplication.34

The Impact of HIV Infection on Transplant Outcomes after Autologous Peripheral Blood Stem Cell Transplantation: A Retrospective Study of Japanese Registry Data reported as ASCT is a successful treatment option for HIV-positive patients with non-Hodgkin lymphoma and multiple myeloma (MM). HIV infection was associated with an increased risk of overall mortality and relapse after ASCT for NHL in a study population.70

The procedure of delivering hematopoietic stem cells mostly through intravenous infusion to restore normal haematopoiesis or treat cancer is known as hematopoietic stem cell transplantation.71 There has recently been a rise in the desire to develop strategies for treating HIV/AIDS diseases employing human hematopoietic stem cells,30 along with this Hutter and Zaia were evaluated the background of Haematopoietic stem cell transplantation (HSCT) in HIV-infected individuals.42

Attempts to use HSCT as a technique for immunologic restoration in AIDS patients or as a therapeutic intervention for malignant tumours were initially insufficient. Regretfully, in the absence of sufficient ART, HSCT seemed to have no impact on the evolution of HIV infection, and the majority of the patients ended up dead of rapidly deteriorating immunosuppression or reoccurring lymphoma or leukaemia. A specific instance report described how an un-associated, matched donor supplied allogeneic HSCT to a patient with refractory lymphoma. The virus was unrecognizable by isolating or PCR of peripheral blood mononuclear cells commencing on day 32 after transplantation. Although HIV-1 was unrecognizable by cultural environment or PCR of several tissues examined at mortem, the patient died of recurring lymphoma on day 47. Another client who obtained both allogeneic HSCT and zidovudine had similar results, with HIV-1 becoming unnoticeable in the blood by PCR analysis. In some other particular instances, a 25-year-old woman with AIDS who obtained an allogeneic HSCT from a corresponding, unfamiliar donor after controlling with busulfan and cyclophosphamide and ART with zidovudine and IFN-2 regimen continued to live for 10 months before falling victim to adult respiratory distress. However, PCR testing of autopsy tissues revealed that they were HIV-1 negative.72

Recent research discovered significant progress towards the clinical application of stem cell-based HIV therapeutic interventions, principally illustrating the opportunity to effectively undertake a large-scale phase two HSC-based gene therapy experiment. In this investigation, the research team used autologous adult HSCs that had been transduced to a retroviral vector that usually contains a tat-vpr-specific anti-HIV ribozyme to develop cells that were less vulnerable to productive infection,73 whereas vector-containing cells have been discovered for extended periods (more than 100 weeks in most people) and CD4+ T cell gets counted were significantly high within anti-HIV ribozyme treating people group compared with the placebo group, the impacts on viral loads were minimal. The studys success, even so, is based on the realization that a stem cell-based strategy like this is being used as a more conventional and efficacious therapeutic approach.30 Some other latest clinical studies used a multi-pronged RNA-based strategic plan which included a CCR5-targeted ribozyme, an shRNA targeting tat/rev transcripts, and a TAR segment decoy.74

These crucial research findings are explained on lentiviral-based gene therapy vectors that can genetically manipulate both dividing and non-dividing HSCs and are less likely to cause cellular changes than murine retro-viral-based vectors. Long-term engraftment and multipotential haematopoiesis have been demonstrated in vector-containing and expressing cells, according to the researchers. Whereas the antiviral effectiveness was not reviewed, the results demonstrate the strategys protection, which helps to expand well for the possibility of a lentiviral-based approach in the upcoming years.30

A further approach, with a different emphasis, has been started up in the hopes of trying to direct immune function to target specific HIV to overcome barriers to attempting to clear the virus from the patient's body. These strategies use gene treatment innovations on peripheral blood cells to biologically modify cells so that they assert a receptor or chimeric particle that enables them to especially target a specific viral antigen,75 deception of HIV-infected peoples peripheral blood T cells raises issues to be addressed, such as the effects of ongoing HIV infection and ex vivo modification on the capabilities and lifetime of peripheral blood cells. Further to that, the above genetically manipulated cells would demonstrate their endogenous T cell receptors, and the representation of the newly introduced receptor could outcome in cross-receptor pairing, resulting in self-reactive T cells. Most of these deficiencies could be countered by enabling specific developmental strategies to take place that can start generating huge numbers of HIV-specific cells in a renewable, consistent way that can restore defective natural immune activity against HIV.30

One strategy being recognized is the application of B cells obtained from HSCs to demonstrate anti-HIV neutralizing specific antibodies. While animal studies have shown that neutralizing antibodies could protect against infection, and extensively neutralizing antibodies have been noticed in some HIV-infected persons, safety from a single engineered antibody might be exceptional.76,77 Realizing antibody binding and virus neutralization may assist in the development of chimeric receptors or single-chain therapeutic antibodies with recognition domains for other techniques that identify cellular immunity against HIV-infected cells.78,79 Thereby, genetically modifying HSCs to generate B cells that produce neutralizing anti-HIV specific antibodies, or engineering HSCs to enable multipotential haematopoiesis of cells that express a chimeric cellular receptor usually contains an antibody recognition domain, indicate one arm of an HSC-based engineered immunity process.30

A further technique of using HSCs that were genetically altered with molecularly cloned T-cell receptors or chimeric molecules particular to HIV to yield antigen-specific T cells. The basic difference in this strategy is that the cells produced from HSCs after standard advancement in the bone marrow and thymus are made subject to normal central tolerance modalities and are antigen-specific naive cells, and therefore do not have the ex-vivo manipulation and impaired functioning or exhaustion problems that other external cell modification methods would have. In this context, the latest actual evidence research using a molecularly cloned T cell receptor particular to an HIV-1 Gag epitope in the aspect of HLA-A*0201 revealed that HSC altered in this ability can progress into fully functioning, mature HIV specialized CD8+ T cells in human thymic tissue that conveys the acceptable constrained HLA-A*0201 particles.80 This explores the possibility of genetically engineering HSCs with a molecularly cloned receptor and signifies a step toward a better understanding and application of initiated T cell responses, which would probably result in the eradication of HIV infection from the body, similar to the natural immune function of other virus infections and pathogenic organisms.30

In an allogeneic transplantation, donor stem cells replace the patients cells.66 Allogeneic hematopoietic stem cell transplantation (HSCT) has appeared as one of the most potent treatment possibilities for many people who suffer from hemopoietic system carcinomas and non-malignant ailments.81 Both HIV-cured people have received HSCT utilizing CCR5 132 donor cells.82,83 This implies that HIV eradication necessitates a decrease in the viral reservoir through the myeloablative procedures,8486 Having followed that, immune rebuilding with HIV-resistant cells was carried out to prevent re-infection.45 The possibility of adoptive transfer of ex vivo-grown, virus-specific T-cells to prevent and control infectious diseases (eg, Cytomegalovirus and EBV) in immunocompromised patients helps to make adoptive T-cell treatment a feasible strategy to inhibit HIV rebound having followed HSCT.81,87,88

The Engineered Zinc Finger Protein Targeting 2LTR Inhibits HIV Integration in Hematopoietic Stem and Progenitor Cell-Derived Macrophages: In Vitro Study, the researchers investigated the efficacy and safety of 2LTRZFP in human CD34+ HSPCs. Researchers used a lentiviral vector to transduce 2LTRZFP with the mCherry tag (2LTRZFPmCherry) into human CD34+ HSPCs. The study findings suggest that the anti-HIV-1 integrase scaffold is an enticing antiviral molecule that could be utilised in human CD34+ HSPC-based gene therapy for AIDS patients.89

The fundamental element of HIV management is stem cell genetic modification, which involves genetically enhanced patient-derived stem cells to overcome HIV infection. In this sector, numerous experimental studies, in vitro as well as in vivo examinations, and positive outcomes for AIDS patients have been conducted.65,74 Genetic engineering for HIV-infected individuals can provide a once-only intervention that minimizes viral load, restores the immune system, and minimizes the accumulated toxicities concerned with highly active antiretroviral therapy (HAART).73 HSCs can be genetically altered, permitting for the addition of exogenous components to the progeny that protects them from direct infectious disease and/or enables them to target a specific antigen. Besides that, HSC-based strategies can enhance multilineage hemopoietic advancement by re-establishing several arms of the immune function. Eventually, as HSCs can be produced autologously, immunologic tolerance is typically high, enabling effective engraftment and subsequent distinction into the fully functioning mature hematopoietic cells.30

The utilization of human HSCs to rebuild the immune function in HIV disease is one application that tries to preserve newly formed cells from HIV infection, while another attempts to develop immune cells that attack HIV infected cells. While each initiative has many different aspects at the moment, they represent huge attention to HIV/AIDS therapies that, most likely when integrated with the other therapeutic approaches, would result in the body trying to overcome the obstacles needed for the virus to be effectively cleaned up.30

While HSC transplantation technique and processes are not accurately novel, as they are commonly and effectively used to address a wide variety of haematological diseases and malignant neoplasms,90 trying to combine them with a gene therapeutic strategy represents a unique and possibly potent therapeutic approach for HIV and AIDS-related ailments. As the results of HIV-infected patients who obtained autologous HSCT continued to improve, there was growing interest in genetically altered stem cells that were tolerant to HIV disease. Multiple logistical challenges have impeded the advancement of genetically modified hematopoietic stem cells as a conceivable therapeutic option for HIV/AIDS.72,73

UCLAs Eli and Edythe Broad Center for Restorative Medicine and Stem Cell Studies is one bit closer to constructing an instrument to arm the bodys immune system to attack and defeat HIV. Dr. Kitchen et al are the first ones to disclose the use of a chimeric antigen receptor (CAR), a genetically manipulated molecule, in blood-forming stem cells. In the experiment, the research team introduced a CAR gene into blood-forming stem cells, which were then moved into HIV-infected mice that had been genetically programmed. The scientists found that CAR-carrying blood stem cells efficiently transformed into fully functioning T cells that have the ability to kill HIV-infected cells in mice. The outcome was an 80-to-95 percentage reduction in HIV levels, suggesting that stem-cell-based genetic engineering with a CAR might be a viable and effective approach for treating HIV infection among humans. The CAR initiative, according to Dr. Kitchen, is much more able to adapt and ultimately more efficient, which can conceivably be used by others. If any further experiment showcases keep promising, the scientists expect that a practice based on their strategy will be accessible for clinical development within the next 510 years.91

HSCT and HAART therapeutic approaches in treating HIV/AIDS as the emergence of highly active antiretroviral therapy (HAART) in the 1990s improved survival rates of HIV infection, leading to a major dramatic drop in the occurrence of AIDS and AIDS-related mortalities. As an outcome, there is much less involvement with using HSCT as a therapy for HIV infection.28,33,43,67,86

A randomized clinical trial of human umbilical cord mesenchymal stem cell transplant among HIV/AIDS immunological non responders investigation, the researchers examined the clinical efficacy of transfusion of human umbilical cord mesenchymal stem cells (hUC-MSC) for immunological non-responder clients with long-term HIV disease who have an unmet medical need in the aspect of effective antiretroviral therapy. From May 2013 to March 2016, 72 HIV-infected participants were admitted in this stage of the randomized, double-blind, multi-center, placebo-controlled dose-determination investigation. They were either given a high dose of hUC-MSC of 1.5106/kg body weight as well as small doses of hUC-MSC of 0.5106/kg body weight, or a placebo application. During the 96-week follow-up experiment, interventional and immunological character traits were analysed. They found that hUC-MSC therapy was both safe and efficacious among humans. There was a significant rise in CD4+ T counts after 48 weeks of treatment in both the high-dose (P 0.001) and low-dose (P 0.001) groups, but no changes in the comparison group.92

One interesting invention made by a team of UC Davis investigators is the recognition of a particular form of stem cell that can minimize the quantity of the virus that tends to cause AIDS, thus dramatically increasing the bodys antiviral immune activity. Mesenchymal stem/stromal cells (MSCs) furnish an incredible opportunity for a creative and innovative, multi-pronged HIV cure strategic plan by augmenting prevailing HIV potential treatments. Even while no antivirals have been used, MSCs have been able to increase the hosts antiviral responses. MSC therapeutic approaches require specialized delivery systems and good cell quality regulation. The studys findings lay the proper scientific foundation for future research into MSC in the ongoing treatment of HIV and other contagious diseases in the clinical organization.35

Infection with HIV-1 necessitates the existence of both specific receptors and a chemokine receptor, particularly chemokine receptor 5 (CCR5).46 Resistance to HIV-1 infection is attained by homozygozygozity for a 32-bp removal in the CCR5 allele.93 In this investigation, stem cells were transplanted in a patient with severe myeloid leukaemia and HIV-1 infection from a donor who was homozygous to Chemokine receptor 5 delta 32. The client seemed to have no viral relapses after 20 months of transplantation and attempting to stop antiretroviral medicine. This finding highlights the essential role that CCR5 tries to play in HIV-1 infection maintenance.86

In comparison, additional HIV-1-infected people who have received allogeneic stem cell transplants with cells from CCR5 truly wild donors did not have long-term relapses from HIV-1 rebound, with 2 of these patients trying to report viral reoccurrence 12 as well as 32 weeks after analytic treatment interruption, respectively. Among these 2 patients, allogeneic stem cell transplantation probably reduced but did not eliminate latently HIV-infected cells, enabling persistent viral reservoirs to activate viral rebound. This viewpoint may not rule out the potential that allogeneic hematopoietic stem cell transplantation might result in a much more comprehensive or near-complete elimination of viral reservoirs, enabling long-term drug-free relapse of HIV-1 infection in some contexts.84 As just one report demonstrated a decade earlier, a curative treatment for HIV-1 remained elusive. The Berlin Patient has undergone 2 allogeneic hematopoietic stem cell transplantations to cure his acute myeloid leukaemia utilizing a potential donor with a homozygous genetic mutation in HIV coreceptor CCR5 (CCR532/32).15,34,46,64,65,72,82,84,86,9496 Other similar studies with CCR5 receptor targets are as follows: Automated production of CCR5-negative CD4+-T cells in a GMP compatible, clinical scale for treatment of HIV-positive patients,97 Mechanistic Models Predict Efficacy of CCR5-Deficient Stem Cell Transplants in HIV Patient Populations,98 Conditional suicidal gene with CCR5 knockout.99

Clustered regularly interspaced short palindromic repeats CRISPR/Cas9 is a promising gene editing approach that can edit genes for gain-of-function or loss-of-function mutations in order to address genetic abnormalities. Despite the fact that other gene editing techniques exist, CRISPR/Cas9 is the most reliable and efficient proven method for gene rectification.100103

Genome engineering employing CRISPR/Cas has proven to be a strong method for quickly and accurately changing specific genomic sequences. The rise of innovative haematopoiesis research tools to examine the complexity of hematopoietic stem cell (HSC) biology has been fuelled by considerable advancements in CRISPR technology over the last five years. High-throughput CRISPR screenings using many new flavours of Cas and sequential and/or functional outcomes, in specific, have become more effective and practical.104,105

The power of the CRISPR/Cas system is that it can specifically and efficiently target sequences in the genome with just a single synthetic guide RNA (sgRNA) and a single protein. Cas9 is directed to the specific DNA sequence by the sgRNA, which causes double stranded breaks and activates the cells DNA repair processes. Non-homologous end joining can cause insertiondeletion (indel) substitutions at the target location, whereas homology-directed repair can use a template DNA to insert new genetic material.104,106

The possibility for CRISPR/Cas9 to be used in the hematopoietic system was emphasised as pretty shortly after it was initiated as a new genome editing method.106,107 The efficiency with which CRISPR-mediated alteration can be used to evaluate hematopoietic stem/progenitor and mature cell function via transplantation. As a result, hematopoietic research has significantly advanced with the implementation of these technologies. Whilst single-gene CRISPR/Cas9 programming is a significant tool for testing gene function in primary hematopoietic cells, high-throughput screenings potentially offer CRISPR/Cas9 an even greater advantage in hematopoietic research.104

While understanding human haematological disorders requires the ability to mimic diseases, the ultimate goal is to transfer this innovation into therapies. Despite significant advancements in CRISPR technology, there are still barriers to overcome before CRISPR/Cas9 can be used effectively and safely in humans. CRISPR has also been used to target CCR5 in CD34+ HSPCs in an effort to make immune cells resistant to HIV infection, as CCR5 is an important coreceptor for HIV infection.104

CRISPR is a modern genome editing technique that could be used to treat immunological illnesses including HIV. The utilization of CRISPR in stem cells for HIV-related investigation, on the other end, was ineffective, and much of the experiment was done in vivo. The new research idea is about increasing CRISPR-editing efficiencies in stem cell transplantation for HIV treatment, as well as its future perspective. The possible genes that enhance HIV resistance and stem cell engraftment should be explored more in the future studies. To strengthen HIV therapy or resistance, double knockout and knock-in approaches must be used to build a positive engraftment. In the future, CRISPR/SaCas9 and Ribonucleoprotein (RNP) administration should be explored in the further investigations.108 As well as some different title studies were explained the effectiveness of the CRISPR gene editing technology on the management of HIV/AIDS including: CRISPR view of hematopoietic stem cells: Moving innovative bioengineering into the clinic,104 CRISPR-Edited Stem Cells in a Patient with HIV and Acute Lymphocytic Leukaemia,109 Sequential LASER ART and CRISPR Treatments Eliminate HIV-1 in a Subset of Infected Humanized Mice,110 Extinction of all infectious HIV in cell culture by the CRISPR-Cas12a system with only a single crRNA,111 HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells,112 CRISPR-Cas9 Mediated Exonic Disruption for HIV-1 Elimination,113 RNA-directed gene editing specifically eradicates latent and prevents new HIV-1 infection,114 CRISPR/Cas9 Ablation of Integrated HIV-1 Accumulates Pro viral DNA Circles with Reformed Long Terminal Repeats,115 CRISPR-Cas9-mediated gene disruption of HIV-1 co-receptors confers broad resistance to infection in human T cells and humanized mice,116 Inhibition of HIV-1 infection of primary CD4+ T-cells by gene editing of CCR5 using adenovirus-delivered CRISPR/Cas9,117 Transient CRISPR-Cas Treatment Can Prevent Reactivation of HIV-1 Replication in a Latently Infected T-Cell Line,118 CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection,119 CRISPR/Cas9-Mediated CCR5 Ablation in Human Hematopoietic Stem/Progenitor Cells Confers HIV-1 Resistance In Vivo.109

Induced pluripotent stem cells (iPSCs) have significantly advanced the field of regenerative medicine by allowing the generation of patient-specific pluripotent stem cells from adult individuals. The progress of iPSCs for HIV treatment has the potential to generate a continuous supply of therapeutic cells for transplantation into HIV-infected patients. The title of the study is reported on Generation of HIV-1 Resistant and Functional Macrophages from Hematopoietic Stem Cellderived Induced Pluripotent Stem Cells. In this investigation, researchers used human hematopoietic stem cells (HSCs) to produce anti-HIV gene expressing iPSCs for HIV gene therapy. HSCs were dedifferentiated into constantly growing iPSC lines using 4 reprogramming factors and a combination anti-HIV lentiviral vector comprising a CCR5 shRNA and a human/rhesus chimeric TRIM5 gene. After directing the anti-HIV iPSCs toward the hematopoietic lineage, a large number of colony-forming CD133+ HSCs were acquired. These cells were distinguished further into functional end-stage macrophages with a normal phenotypic profile. Upon viral challenge, the anti-HIV iPSC-derived macrophages displayed good protection against HIV-1 infection. Researchers have clearly shown how iPSCs can establish into HIV-1 resistant immune cells and explain their prospective use in HIV gene and cellular therapies.120

Some other similar titles of the studies reported on the effectiveness of IPSCs on HIV/AIDS managements are as follows: Generation of HIV-Resistant Macrophages from IPSCs by Using Transcriptional Gene Silencing and Promoter-Targeted RNA,121 Generation of HIV-1-infected patients gene-edited induced pluripotent stem cells using feeder-free culture conditions,122 A High-Throughput Method as a Diagnostic Tool for HIV Detection in Patient-Specific Induced Pluripotent Stem Cells Generated by Different Reprogramming Methods,123 Genetically edited CD34+ cells derived from human iPS cells in vivo but not in vitro engraft and differentiate into HIV-resistant cells,124 Engineered induced-pluripotent stem cell-derived monocyte extracellular vesicles alter inflammation in HIV humanized mice,125 Sustainable Antiviral Efficacy of Rejuvenated HIV-Specific Cytotoxic T Lymphocytes Generated from Induced Pluripotent Stem Cells.126

Recently, one HIV patient appeared to be virus-free after having undergone a stem-cell transfusion in which their WBCs were changed with HIV-resistant variations.84 Timothy Ray Brown also noted as the Berlin patient, who is still virus-free, was the first individual to undertake stem-cell transplantation a decade earlier. The most recent patient, like Brown, had a type of leukaemia that was vulnerable to chemo treatments. They required a bone marrow transplantation, which involved removing their blood cells and replacing them with stem cells from a donor cell.5,31,34,41,127130 Rather than simply choosing a suitable donor, Ravindra Gupta et al chose one who already had 2 copies of a mutant within the CCR5 gene,128,131 which provides resistance to HIV infection.3

Additionally, this gene encodes for a specific receptor of white blood cells that are assisted in the bodys immunological responses. The transplant, according to Guptas team, completely replaced the clients White cells with HIV-resistant forms.41,83 Cells in the patients blood disrupted expressing the CCR5 receptor, making it unfeasible for the clients form of HIV to infect the above cells again. The scientists determined that the virus had been cleared from the patients blood after the transplantation. Besides that, after 16 months, the client has withdrawn antiretroviral treatment. The infection was not detected in the most recent follow-up, which occurred 18 months after the treatment was discontinued. Adam, also known as the London patient, was the second person to be cured of HIV as a result of a stem cell transfusion. This discovery is an important step forward in HIV research because it may aid in the detection of potential future therapeutic interventions. It must be noted, but even so, that this is not an extensively used HIV treatment. For HIV-infected patients, antiretroviral drugs have been the foremost therapeutic option.3,31,41,94,129,130 It also encourages many investigators and clinicians to look at the use of stem cells in the treatment of a wide range of serious medical conditions. The reprogramming abilities of stem cells, as well as their accessibility, have created a window of opportunity in medical research. The clinical utility of stem cells is forecast to expand rapidly in the coming years.

On Feb 15, 2022, scientific researchers confirmed that a woman had become the 3rd person in history to be successfully treated for HIV, the virus that causes AIDS, after just receiving a stem-cell transfusion that has used cells from cord blood. Within those transplant recipients, adult hematopoietic stem cells have been used; these are stem cells that eventually develop into all blood cell types, which include white blood cells, these are a vital component of the immune framework. Even so, the woman who had fairly recently been completely cured of HIV infection had a more unique experience than that of the 2 men who were actually cured before her.132

The clients physician, Dr. JingMei Hsu of Weill Cornell Medicine in New York, informed them that, she had been discharged from the hospital just 17 days after her procedure was performed, even with no indications of graft vs host ailment. The woman was HIV-positive but also had acute myeloid leukaemia, a blood cancer of the bone marrow that affects blood-forming cells. She had likely received cord blood as a successful treatment for both her cancer and HIV once her doctors decided on a potential donor well with HIV-blocking gene mutation. Cord blood comprises a high accumulation of hematopoietic stem cells; the blood is obtained during a childs birth and donated by the parents.132

The patients donor was partly nearly matched, and she received stem cells from a close family member to enhance her immune function after the transfusion. The procedure was performed on the woman in August of 2017. She chose to discontinue taking antiretroviral drugs, the standardized HIV intervention, 37 months upon her transfusion. After more than 14 months, there is no evidence of the viral infection or antibodies against it in her blood. Umbilical cord blood, in reality, is much more commonly accessible and simpler to try to match to beneficiaries than bone marrow. Perhaps, some research suggests that the method could be more available to HIV patients than bone marrow transplantation. Nearly 38 million people worldwide are infected with HIV. The potential for using partly matched umbilical cord blood transplantation increases the chances of choosing appropriate suitable donors for these clients considerably.132

It is really exciting to see the earlier terminally ill diseases of being effectively treated. In recent times, there has been a surge of focus on stem cell research.3 Stem cell therapy advancements in inpatient care are receiving a growing amount of attention.20 HIV/AIDS has been and remains a significant health concern around the world. Effective control of the HIV pandemic will necessitate a thorough understanding of the viruss transmission.32

Despite concerns about full compliance and adverse reactions, HAART has demonstrated to be able to succeed and is a sign specifically targeted form of treatment against HIV advancement. As illustrated by the first case of HIV infection relapse attained by bone marrow transplant, anti-HIV HPSC-based stem cell treatment and genotype technology have established a possible future upcoming technique to try to combat HIV/AIDS.

Investigators have conducted experiments with engineering distinct anti-HIV genetic traits trying to target different phases of HIV infection utilizing advanced scientific modalities. In numerous in vivo and in vitro animal studies, HSPCs and successive mature cells were secured from HIV infection by trying to target genetic factors in the infection. Anti-HIV gene engineering of HSPCs is safe and efficacious.15

The number of stem-cell-based research trials has risen in recent years. Thousands of studies claiming to use stem cells in experimental therapies have been registered worldwide. Despite some promising results, the majority of clinical stem cell technologies are still in their early life. These achievements have drawn attention to the possibility of the potential and advancement of various promising stem cell treatments currently in development.11

HIV remains a major danger to humanity. This virus has developed the ability to evade antiretroviral medication, resulting in the death of individuals. Scientists are constantly looking for a treatment for HIV/AIDS that is both effective and efficient.52 The 1st treatments in HIV+ clients were conducted in the early 1980s, even though they were cognizant of their viral disease. Following these early cases, allogeneic SCT was used to treat HIV+ patients with associated cancer or other haematological disorders all over the world. Stem cell transplantation developments have also stimulated the improvement of innovative HIV therapeutic approaches, especially for large goals like eradication and relapse.60

Numerous stem cell therapy progressions have been recognized with autologous and allogeneic hematopoietic stem cell transplantation, as well as umbilical cord blood mesenchymal stem cell transplant in AIDS immunologic non-responders. Whereas this sector continues to advance and distinguishing directives for these cells become much more effective, totipotent stem cells such as hESC and the recently reported induced pluripotent stem cells (iPSC) could be very useful for genetic engineering methods to counter hematopoietic abnormalities such as HIV disease.133135

Immunocompromised people are at a higher risk of catching life-threatening diseases. The perseverance of latently infected cells, which is formed by viral genome inclusion into host cell chromosomes, is a significant challenge in HIV-1 elimination. Stem cell therapy is producing impressive patient outcomes, illustrating not only the broad relevance of these strategies but also the huge potential of cell and gene treatment using adult stem cells and somatic derivative products of pluripotent stem cells (PSCs).

Stem cells have enormous regeneration capacity, and a plethora of interesting therapeutic uses are on the frontier. This is a highly interdisciplinary scientific field. Evolutionary biologists, biological technicians, mechanical engineers, and others that have evolved novel concepts and decided to bring them to medical applications are required to make important contributions. Further to that, recent advancements in several different research areas may contribute to stem cell application forms that are novel. Several hurdles must be conquered, however, in the advancement of stem cells. On the other hand, this discipline appears to be a promising and rapidly expanding research area.

Stem cell-based approaches to HIV treatment resemble an innovative approach to trying to rebuild the ravaged bodys immune system with the utmost goal of eliminating the virus from the body. We will probably see effective experiments from the next new generation of stem cell-based strategies shortly, which will start serving as a base for the further development and use of these techniques in a range of treatment application areas for other chronic diseases.

My immense pleasure was mentioned to family members and friends, who supported and encouraged me in every activity.

There was no funding for this work.

The authors declare that they have no conflicts of interest in relation to this work.

1. Zakrzewski W, Dobrzyski M, Szymonowicz M, Rybak Z. Stem cells: past, present, and future. Stem Cell Res Ther. 2019;10:68. doi:10.1186/s13287-019-1165-5

2. Nadig RR. Stem cell therapy hype or hope? A review. J Conserv Dent JCD. 2009;12:131138. doi:10.4103/0972-0707.58329

3. Tasnim KN, Adrita SH, Hossain S, Akash SZ, Sharker S. The prospect of stem cells for HIV and cancer treatment: a review. Pharm Biomed Res. 2020;6:1726.

4. Weissman IL. Translating stem and progenitor cell biology to the clinic: barriers and opportunities. Science. 2000;287:14421446. doi:10.1126/science.287.5457.1442

5. Pernet O, Yadav SS, An DS. Stem cellbased therapies for HIV/AIDS. Adv Drug Deliv Rev. 2016;103:187201. doi:10.1016/j.addr.2016.04.027

6. Kolios G, Moodley Y. Introduction to stem cells and regenerative medicine. Respir Int Rev Thorac Dis. 2013;85:310.

7. Ebrahimi A, Ahmadi H, Ghasrodashti ZP, et al. Therapeutic effects of stem cells in different body systems, a novel method that is yet to gain trust: a comprehensive review. Bosn J Basic Med Sci. 2021;21:672701. doi:10.17305/bjbms.2021.5508

8. Introduction stem cells. Available from: https://www.dpz.eu/en/platforms/degenerative-diseases/research/introduction-stem-cells.html. Accessed December 19, 2021.

9. Hu J, Chen X, Fu S. Stem cell therapy for thalassemia: present and future. Chin J Tissue Eng Res. 2018;22:3431.

10. Aly RM. Current state of stem cell-based therapies: an overview. Stem Cell Investig. 2020;7:8. doi:10.21037/sci-2020-001

11. Chari S, Nguyen A, Saxe J. Stem cells in the clinic. Cell Stem Cell. 2018;22:781782. doi:10.1016/j.stem.2018.05.017

12. De Luca M, Aiuti A, Cossu G, Parmar M, Pellegrini G, Robey PG. Advances in stem cell research and therapeutic development. Nat Cell Biol. 2019;21:801811. doi:10.1038/s41556-019-0344-z

13. Hipp J, Atala A. Sources of stem cells for regenerative medicine. Stem Cell Rev. 2008;4:311. doi:10.1007/s12015-008-9010-8

14. Bobba S, Di Girolamo N, Munsie M, et al. The current state of stem cell therapy for ocular disease. Exp Eye Res. 2018;177:6575. doi:10.1016/j.exer.2018.07.019

15. Khalid K, Padda J, Fernando RW, et al. Stem cell therapy and its significance in HIV infection. Cureus. 2021;13. doi: 10.1038/d41586-019-00798-3

16. Gq D, Morrell CN, Tarango C. Stem cells: roadmap to the clinic. J Clin Invest. 2010;121:120. doi:10.1172/JCI39828

17. Prentice DA. Adult Stem Cells. Circ Res. 2019;124:837839. doi:10.1161/CIRCRESAHA.118.313664

18. McKee C, Chaudhry GR. Advances and challenges in stem cell culture. Colloids Surf B Biointerfaces. 2017;159:6277. doi:10.1016/j.colsurfb.2017.07.051

19. Prez Lpez S, Otero Hernndez J. Advances in stem cell therapy. In: Lpez-Larrea C, Lpez-Vzquez A, Surez-lvarez B, editors. Stem Cell Transplantation. New York, NY: Springer US; 2012:290313.

20. Zhang F-Q, Jiang J-L, Zhang J-T, Niu H, X-Q F, Zeng -L-L. Current status and future prospects of stem cell therapy in Alzheimers disease. Neural Regen Res. 2020;15:242250. doi:10.4103/1673-5374.265544

21. Hu L, Zhao B, Wang S. Stem-cell therapy advances in China. Hum Gene Ther. 2018;29:188196. doi:10.1089/hum.2017.224

22. Tadlock D Stem cell basics introduction; 19.

23. Poulos J. The limited application of stem cells in medicine: a review. Stem Cell Res Ther. 2018;9:1. doi:10.1186/s13287-017-0735-7

24. Madl CM, Heilshorn SC, Blau HM. Bioengineering strategies to accelerate stem cell therapeutics. Nature. 2018;557:335342. doi:10.1038/s41586-018-0089-z

See the rest here:
PROMISING STEM CELL THERAPY IN THE MANAGEMENT OF HIV & AIDS | BTT - Dove Medical Press

Recommendation and review posted by Bethany Smith

Global Mesenchymal Stem Cells Market Size is expected to be worth USD 2,600.5 million by 2027, with a CAGR of 7.1% over the forecasting years, according to Acumen Research & Consulting

The development of stem cell therapies to address serious medical conditions has significantly increased in recent years. In this regard, consistent advancement in the environment of stem cell treatments is expected to drive tremendous attention in the mesenchymal stem cells market. The market for mesenchymal stem cells is expected to increase dramatically in the future years. Extensive Research and development activities based on mesenchymal stem cells are propelling the markets rapid potential expansion. These cells are also being employed increasingly frequently in tissue engineering. As a result of many factors, the global mesenchymal stem cells market is expected to see new demand possibilities in the coming years.

Mesenchymal stem cells (MSCs) are multipotent stem cells, which can capable of converting into a variety of cellular structures such as adipocytes, chondrocytes, osteoblasts, and myocytes. MSCs have the ability to drastically alter their environment, demonstrating anti-fibrotic and anti-inflammatory properties while secreting chemicals that enhance the tissue healing. MSCs are advantageous to other stem cell technologies for a number of purposes, especially its immune-privileged status, which makes them a suitable cell type for allogenic transplantation. Moreover, mesenchymal stem cells (MSCs) comprise intimal cells that have the ability to self-renew and develop into a variety of lineages. It can be isolated from a variety of tissues, including endometrial polyps, bone marrow, menstrual blood, adipose tissue, and the umbilical cord. It is the most commonly used cell type in regenerative medicine to address neurological issues, diabetes, heart ischemia, and musculoskeletal and cartilage disorders.

Get Free Sample Report Copy : https://www.acumenresearchandconsulting.com/request-sample/2629

Global Mesenchymal Stem Cells Market Dynamics

The increasing utilization of mesenchymal stem cells (MSCs) in the aged population for the treatment of different diseases and disabilities is favorably impacting the global mesenchymal stem cell market size. The increasing medicinal evaluation of mesenchymal stem cells for the dealing of various illness, including musculoskeletal and cartilage disorders, and autoimmune problems, is expected to drive the global mesenchymal stem cells market growth. As per the investigation, these stem cells promote angiogenesis in the heart and help to reduce chronic inflammation. Pre-clinical investigations for employing mesenchymal stem cells to address cardiovascular disorders, liver ailments, and tumors are expected to open up overseas customers for the mesenchymal stem cells market trend. Furthermore, due to the regenerative potential, ease of separation, and immunoregulatory features of these stem cells, mesenchymal stem cell therapy has emerged as a feasible technique for the treatment of inflammatory, chronic, degenerative, and autoimmune diseases.

Rising Drug Discovery and Development activities around the globe are Fueling the Market Growth

Stem cell biology is a rapidly expanding field of study that has made substantial contributions to a wide range of scientific disciplines, including tissue regeneration and cell therapy treatment. In recent years, one of the most promising applications of mesenchymal stem cell biology has been drug discovery and development. Stem cells are quickly being exploited in creative ways to improve medication research, with applications ranging from academic circles to biotechnological start-ups to major pharmaceutical companies. Mesenchymal stem cells (MSCs) have the potential to be a valuable tool in drug discovery and development, as indicated by their ability to impact immune system response.

Report Customization: https://www.acumenresearchandconsulting.com/request-customization/2629

Market Segmentation

According to Acumen Research and Consulting, the global mesenchymal stem cells industry is fragmented into application, and product type. By application, the segment has been classified into myocardial and cardiovascular infarction, drug discovery and development, injuries, and others. By product type, the segment is further segmented into rat, mouse, human, and others.

Mesenchymal Stem Cells Market Regional Overview

The mesenchymal stem cells industry is divided into five regions including Asia-Pacific, Europe, North America, Latin America, as well as the Middle East and Africa. According to the mesenchymal stent cells market forecast, the North American region is expected to gain a significant market share in the coming periods. Increased utilization for clinical trials, medication research, and development, as well as the safety and efficacy of mesenchymal stem cells for chronic conditions, are driving market expansion in North America. Furthermore, organizations are concentrating on monetizing mesenchymal stem cells and delivering them to successful disease recovery treatment. This crucial element will continue to drive market expansion in North America over the anticipated timeframe.

Furthermore, the Asia-Pacific region is expected to experience considerable growth in the global market. Factors contributing to the regions growth include increased use of stem cell treatments as a result of consumers low expendable income and limited financial assistance for high-end procedures, which is expected to raise the use of mesenchymal stem cells technologies throughout the projected timeframe.

Get Premium Report Copy For This : https://www.acumenresearchandconsulting.com/buy-now/0/2629

Mesenchymal Stem Cells Market Players

Some of the significant mesenchymal stem cells market companies are R&D Systems, Inc., Axol Bioscience, Cytori Therapeutics, Inc., BrainStorm Cell Therapeutics Inc., Stemedica Cell Technologies, Inc., Cell Applications, Inc., Cyagen Biosciences, STEMCELL Technologies Inc., and Celprogen, Inc.

About Acumen:

Acumen Research and Consulting is a global provider of market intelligence and consulting services to information technology, investment, telecommunication, manufacturing, and consumer technology markets. ARC helps investment communities, IT professionals, and business executives to make fact based decisions on technology purchases and develop firm growth strategies to sustain market competition. With the team size of 100+ Analysts and collective industry experience of more than 200 years, Acumen Research and Consulting assures to deliver a combination of industry knowledge along with global and country level expertise.

Contact Us:

Mr. Frank WilsonAcumen Research and ConsultingUSA: +13474743864India: +918983225533E-mail:[emailprotected]

See more here:
Mesenchymal Stem Cells Market Size is Projected to Reach at USD 2600.5 Million by 2027 at a CAGR of 7.1%, Driven by Rising Prevalence of Hepatitis...

Recommendation and review posted by Bethany Smith

This bone marrow market report provides details of new recent developments, trade regulations, import export analysis, production analysis, value chain optimization, market share, impact of domestic and localised market players, analyses opportunities in terms of emerging revenue pockets, changes in market regulations, strategic market growth analysis, market size, category market growths, application niches and dominance, product approvals, product launches, geographic expansions, technological innovations in the market. To gain more info on the bone marrow market contact Data Bridge Market Research for anAnalyst Brief,our team will help you take an informed market decision to achieve market growth.

The bone marrow market is expected to gain market growth in the forecast period of 2021 to 2028. Data Bridge Market Research analyses that the market is growing with the CAGR of 5.22% in the forecast period of 2021 to 2028 and is estimated to reach 13,899.60 USD Million by 2028. The growing amount of bone marrow diseases will help in escalating the growth of the bone marrow market. Bone marrow transplant also referred to as hematopoietic stem cell. It is a soft vascular tissue present in the interior of long bones. It comprises of two types of stem cells, that are hematopoietic and mesenchymal stem cells. Bone marrow is mainly responsible for the haematopoiesis, (formation of blood cells), production of lymphocytes, and the storage of fats. The bone marrow transplant is the last alternative generally recommended by the physicians in the cases of fatal bone marrow diseases and bone or skin cancer.

Get a Sample PDF of the report https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-bone-marrow-market

Major factors that are boosting the growth of the bone marrow market in the forecast period are the growing of the incidences of non-Hodgkin and Hodgkin lymphoma, thalassemia, and leukemia, along with the common bone marrow diseases around the world, the developments in the technology and the enhancing of the healthcare infrastructure. Furthermore, the advancing signs of bone marrow transplant for heart and neuronal disorders, increasing funding in the logistic services and the growing per capita of the healthcare expenses are some of the other factors anticipated to further propel the growth of the bone marrow market in the coming years. However, the high expenditure for the treatment, shortage of the bone marrow donors and instability of the repayment are few of the factors further responsible for the impeding the growth of the bone marrow market in the near future.

Bone MarrowMarket Scope and Market Size

The bone marrow market is segmented on the basis of transplantation type, disease indication and end user. The growth amongst these segments will help you analyse meagre growth segments in the industries, and provide the users with valuable market overview and market insights to help them in making strategic decisions for identification of core market applications.

To Gain More Insights into the Market Analysis, Browse Summary of the Research Report@ https://www.databridgemarketresearch.com/reports/global-bone-marrow-market

Bone MarrowMarket Country Level Analysis

The bone marrow market is analysed and market size insights and trends are provided by country, transplantation type, disease indication and end user as referenced above. The countries covered in the bone marrow market report are the U.S., Canada and Mexico in North America, Germany, France, U.K., Netherlands, Switzerland, Belgium, Russia, Italy, Spain, Turkey, Rest of Europe in Europe, China, Japan, India, South Korea, Singapore, Malaysia, Australia, Thailand, Indonesia, Philippines, Rest of Asia-Pacific (APAC) in the Asia-Pacific (APAC), Saudi Arabia, U.A.E, South Africa, Egypt, Israel, Rest of Middle East and Africa (MEA) as a part of Middle East and Africa (MEA), Brazil, Argentina and Rest of South America as part of South America.

Europe dominates the bone marrow market because of the occurrence of the increasing number of innovative healthcare centers. Furthermore, the healthcare systems have introduced the bone marrow transplant in their contributions and the state-of-the-art public facilities which will further boost the growth of the bone marrow market in the region during the forecast period. North America is projected to observe significant amount of growth in the bone marrow market because of the growing cases of chronic diseases such as blood cancer. Moreover, the increasing of the geriatric population is one of the factors anticipated to propel the growth of the bone marrow market in the region in the coming years.

The country section of the bone marrow market report also provides individual market impacting factors and changes in regulation in the market domestically that impacts the current and future trends of the market. Data points such as consumption volumes, production sites and volumes, import export analysis, price trend analysis, cost of raw materials, down-stream and upstream value chain analysis are some of the major pointers used to forecast the market scenario for individual countries. Also, presence and availability of global brands and their challenges faced due to large or scarce competition from local and domestic brands, impact of domestic tariffs and trade routes are considered while providing forecast analysis of the country data.

Competitive Landscape and Bone MarrowMarket Share Analysis

The bone marrow market competitive landscape provides details by competitor. Details included are company overview, company financials, revenue generated, market potential, investment in research and development, new market initiatives, global presence, production sites and facilities, production capacities, company strengths and weaknesses, product launch, product width and breadth, application dominance. The above data points provided are only related to the companies focus related to bone marrow market.

The major players covered in the bone marrow market report are AGendia, Agilent Technologies, Inc., Ambrilia Biopharma Inc., Astellas Pharma Inc., diaDexus, Illumina, Inc., QIAGEN, F Hoffmann-La Roche Ltd, Sanofi, Stryker Corporation, PromoCell GmbH, STEMCELL Technologies Inc., Lonza, ReachBio LLC, AllCells, ATCC, Lifeline Cell Technology., Conversant bio, HemaCare, Mesoblast Ltd., Merck KGaA, Discovery Life Sciences., ReeLabs Pvt. Ltd., Gamida Cell, among other domestic and global players. Market share data is available for global, North America, Europe, Asia-Pacific (APAC), Middle East and Africa (MEA) and South America separately. DBMR analysts understand competitive strengths and provide competitive analysis for each competitor separately.

Browse the complete table of contents at https://www.databridgemarketresearch.com/toc/?dbmr=global-bone-marrow-market

Related Reports:

Allogenic Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/global-allogenic-stem-cell-therapy-market

Cancer Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/global-cancer-stem-cell-therapy-market

North America Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/north-america-stem-cell-therapy-market

Europe Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/europe-stem-cell-therapy-market

Asia-Pacific Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/asia-pacific-stem-cell-therapy-market

Middle East and Africa Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/middle-east-and-africa-stem-cell-therapy-market

Asia-Pacific Drug-Device Combination Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/global-drug-device-combination-market

About Data Bridge Market Research:

An absolute way to forecast what future holds is to comprehend the trend today! Data Bridge Market Research set forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge endeavours to provide appropriate solutions to the complex business challenges and initiates an effortless decision-making process. Data Bridge is an aftermath of sheer wisdom and experience which was formulated and framed in the year 2015 in Pune.

Data Bridge Market Research has over 500 analysts working in different industries. We have catered more than 40% of the fortune 500 companies globally and have a network of more than 5000+ clientele around the globe. Data Bridge adepts in creating satisfied clients who reckon upon our services and rely on our hard work with certitude. We are content with our glorious 99.9 % client satisfying rate.

Contact Us:-

Data Bridge Market Research

US: +1 888 387 2818

UK: +44 208 089 1725

Hong Kong: +852 8192 7475

Email:- corporatesales@databridgemarketresearch.com

View post:
Bone Marrow Market Global Projection By Key Players AGendia, Agilent Technologies, Inc., Ambrilia Biopharma Inc Analysis and Forecast to 2028 ...

Recommendation and review posted by Bethany Smith

Animals

All animal experiments were performed in accordance with the institutional guidelines of the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University (Kyoto, Japan), and all experimental protocols were approved by the same institute. The reporting in this manuscript followed the recommendations in the ARRIVE guidelines. For euthanasia, mice were intraperitoneally administrated with a mixture of Medetomidine (0.3mg/kg body weight), Midazolam (4mg/kg body weight), and Butorphanol (5mg/kg body weight). SM22-Cre mice(Tg (Tagln-cre)1Her/J, Stock# 004746) and dual fluorescent membrane-localized tdTomato/eGFP (mT/mG) mice (B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato, -EGFP)Luo/J, Stock# 007676) were purchased from the Jackson Laboratory. SM22 -Cre mice were bred with flox mT/mG mice to produce mT/mGflox/wt: SM22-Cre+(SM22mT/mG) mice. For embryos, SM22 -Cre mice were paired overnight with flox mT/mG mice. The morning after mating was considered 0.5days post-coitus (dpc).

Male and female SM22mT/mG mice, 610weeks of age, were used as the cell source. CFs were isolated as described previously26. Media and buffers were prepared according to a previous paper26. The descending aortas and inferior venae cavae were cut. The hearts were perfused with EDTA buffer from the right ventricle. The ascending aortas were clamped. The clamped hearts were removed, transferred to a dish containing EDTA buffer, and perfused with EDTA buffer from the left ventricle (LV). The hearts were transferred to a dish of perfusion buffer, and perfused with perfusion buffer from the LV. The hearts were transferred to a dish of collagenase buffer and perfused with collagenase buffer from the LV. The ventricles were transferred to the other dish of collagenase buffer, gently teased apart into pieces, and triturated. Stop solution was added to the cell-tissue cell suspension. The supernatants obtained via gravity settling three times for 10min in perfusion buffer were collected as nonCMs. The nonCMs were centrifuged at 300g for 5min, resuspended in DMEM containing 10% fetal bovine serum (FBS) and penicillinstreptomycin (Wako, #168-23191), plated on cell culture dishes and cultured for 67days. Almost all cells were fibroblasts after the culture.

Bone marrow was extracted from the femurs and tibias of euthanized mice and differentiated in bone marrow macrophage differentiation media (RPMI 1640 containing 10% fetal bovine serum (FBS), penicillinstreptomycin, 20g/mL recombinant mouse M-CSF (Biolegend, #576404), and 0.1mM/L 2-mercaptoethanol (Wako, #133-14571)). Seven days after being harvested, BMDMs were stimulated with recombinant mouse TGF-1 (Biolegend, # 763102) for 1 or 7days, for RNA or for Flow cytometric analysis, respectively. To investigate whether Cre-recombination occurs during the differentiation process from HSCs to BMDMs, bone marrow cells were harvested and cultured in bone marrow macrophage differentiation media containing with TGF-.

Hearts in 6-week-old mice were perfused with cold phosphate-buffered saline (PBS) and 4% paraformaldehyde, removed, and fixed with 4% paraformaldehyde (PFA) for 3h. The hearts of Embryos at 17.5 dpc were removed, washed with cold PBS and fixed with 4% PFA for 3h. The hearts were incubated in 10%, 20% and 30% sucrose diluted in PBS. The samples were then embedded in OCT compound (Sakura Finetek Japan), frozen and stored at 80. Cryosections (8m thick) were obtained using a Leica cryostat.

For immunofluorescence analysis, sections were first washed with PBS, permeabilized with PBS containing 0.1% Triton-X, and washed with PBS containing 0.1% Tween 20. The sections were then incubated in blocking buffer (PBS containing, 0.1% Tween 20, 1% BSA, and 10% normal donkey serum (Jackson ImmunoResearch, #017-000-121)) for 1h at room temperature. Primary antibodies diluted in blocking buffer were added and incubated overnight at 4. The following primary antibodies were used: anti-SMA (1:100) (Goat, Novus Biologicals, #NB300-978), anti-Vimentin (1:100) (rabbit, Cell Signaling Technology, #5741S), anti-CD68 (1:200) (rat, Bio Rad, #MCA1957GA), and anti-CD31 (1:100) (rabbit, Novus Biologicals, # NB100-2284). Then, the slides were washed three times in PBS containing 0.1% Tween 20 for 5min each, and incubated with Alexa Fluor 647 (ThermoFisher, #A-31573 or Abcam, #ab150155) or Alexa Fluor Plus 680 (ThermoFisher, #A32860) against the appropriate species (diluted at 1:500) for 1h at room temperature. The slides were washed three times in cold PBS for 5min each. Finally, the slides were mounted with VECTASHIELD Antifade Mounting Medium with DAPI (Vector Laboratories, #H-1200-10).

Immunofluorescence images were acquired on an Axio Observer (Carl Zeiss) (5objective) or SP8 Falcon (Leica) (63objective) and analyzed with Zen software (Carl Zeiss) or LAS X (Leica), respectively.

Single cardiac cell suspensions were generated as described previously27. Hearts were perfused with cold PBS and finely minced and digested in Hanks Balanced Salt Solution (HBSS) with Collagenase 2 (500 U/ml) (Worthington Biochemical, #LS004176) for 30min at 37C. Next, the hearts were digested in HBSS with Collagenase/Dispase (1mg/mL) (Merck, #11097113001) for 20min at 37C. To deactivate the enzymes, the samples were washed with cold HBSS. The solutions were passed through a 40m cell strainer (Corning, #352340). Red blood cell lysis was performed with ACK lysis buffer (0.16M ammonium chloride, 10mM Potassium bicarbonate and 0.1mM EDTA). The samples were washed with FACS buffer (HBSS with 25mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 2% FBS and 2mM ethylenediaminetetraacetic acid (EDTA)) and resuspended in 300 L of FACS buffer. Heart samples were blocked with TruStain FcX Plus (0.5 L/100 L) (Biolegend, #156604) for 5min at 4.

Peripheral blood samples were collected from the inferior vena cava of anesthetized mice using a heparin-contained syringe. Red blood cell lysis was performed with ACK lysis buffer. The samples were washed with FACS buffer and resuspended. Peripheral blood samples were blocked with TruStain FcX Plus for 5min at 4.

Bone marrow cells were obtained by flushing femurs and tibias with RPMI supplemented with 25mM HEPES and 10% FBS. The suspensions were passed through a 40m cell strainer. After the red blood cells were lysed, the samples were washed with FACS buffer and resuspended.

BMDMs were collected after harvesting as described before and were blocked with TruStain FcX Plus for 5min at 4.

Cells were stained with monoclonal antibodies at 4C for 20min in the dark. The samples were washed twice, and the final resuspension was made in 500 L of FACS buffer. 7-AAD was used to exclude dead cells. Flow cytometric analysis was performed on BD FACS ARIAII platforms. Complete lists of antibodies and flow cytometry gating strategies are provided in Supplementary Tables 1 and 2, respectively.

Total RNA was isolated and purified using TRIzol reagent (ThermoFisher), and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, #FSQ-301) in accordance with the manufacturer's instructions. For quantitative real-time PCR (qRTPCR), specific genes were amplified using 40 cycles with Thunderbird SYBR qPCR mix (Toyobo, #QPS-201) and StepOnePlus (ThermoFisher). Expression was normalized to the housekeeping gene18rS. Gene-specific primers are described as follows:

18rS forward, CTCAACACGGGAAACCTCAC; 18rS reverse, AGACAAATCGCTCCACCAAC; Tagln forward, CAACAAGGGTCCATCCTACGG; Tagln reverse, ATCTGGGCGGCCTACATCA; Acta2 forward, TGACGCTGAAGTATCCGATAGA; Acta2 reverse, CGAAGCTCGTTATAGAAAGAGTGG; Col1a1 forward, AATGGCACGGCTGTGTGCGA; and Col1a1 reverse, AACGGGTCCCCTTGGGCCTT.

For the Flow cytometric analysis, the lines represent the means and standard error of the samples. Differences between two groups were compared by Students t test as a parametric comparison test. For the RTPCR experiments, one-way ANOVA followed by Tukeys test was performed for multiple comparisons. The bars represent mean of the samples. The analysis and plots were generated using the ggplot2 package and R software. A P value<0.05 was considered statistically significant.

More:
Smooth muscle protein 22-Cre recombination in resting cardiac fibroblasts and hematopoietic precursors | Scientific Reports - Nature.com

Recommendation and review posted by Bethany Smith

The Global Rheumatoid Arthritis Stem Cell Therapy Market is replete with new growth opportunities and expansion avenues. There has been an increase in the use of products and services falling under the ambit of Rheumatoid Arthritis Stem Cell Therapy, giving a thrust to the growth of the global Rheumatoid Arthritis Stem Cell Therapy market. The unprecedented use of these products can be attributed to the increasing paying capacity of the masses.

Furthermore, in the absence of robust or utilitarian alternatives, the demand within the global Rheumatoid Arthritis Stem Cell Therapy market is projected to reach new heights of recognition. It is worthwhile to mention that the global Rheumatoid Arthritis Stem Cell Therapy market is treading along a lucrative pathway due to favorable government legislations.

To get in-depth insights Request for Brochure here https://www.factmr.com/connectus/sample?flag=B&rep_id=1001

The COVID-19 pandemic has changed narratives related to growth and expansion across several key industries. Therefore, the Rheumatoid Arthritis Stem Cell Therapy market is also battling the cons of supply chain disruptions and procurement issues. Over the course of the next quarter, market players could be investing in new technologies to recover from the shocks of the pandemic.

The global market for rheumatoid arthritis stem cell therapy is highly fragmented. Examples of some of the key players operating in the global rheumatoid arthritis stem cell therapy market include Mesoblast Ltd., Roslin Cells, Regeneus Ltd, ReNeuron Group plc, International Stem Cell Corporation, TiGenix and others.

Through the latest research report on Rheumatoid Arthritis Stem Cell Therapy market, the readers get insights on:

Share Your Requirements & Get Customized Reports: https://www.factmr.com/connectus/sample?flag=RC&rep_id=1001

Tentatively, the global rheumatoid arthritis stem cell therapy market can be segmented on the basis of treatment type, application, end-user, and geography.

Based on treatment type, the global rheumatoid arthritis stem cell therapy market can be segmented into:

Based on application, the global rheumatoid arthritis stem cell therapy market can be segmented into:

Based on the distribution channel, the global rheumatoid arthritis stem cell therapy market can be segmented into:

Based on geography, the global rheumatoid arthritis stem cell therapy market can be segmented into:

The study further identifies major manufacturing trends, technologies that will be commercialized

Reasons to choose a Fact.MR:

For In-depth Analysis & Business Strategy, Buy a Copy of this Report: https://www.factmr.com/checkout/1001

About Fact. MR

Market research and consulting agency with a difference! Thats why 80% of Fortune 1,000 companies trust us for making their most critical decisions. We have offices in US and Dublin, whereas our global headquarter is in Dubai. While our experienced consultants employ the latest technologies to extract hard-to-find insights, we believe our USP is the trust clients have in our expertise. Spanning a wide range from automotive & industry 4.0 to healthcare & retail, our coverage is expansive, but we ensure even the most niche categories are analyzed. Reach out to us with your goals, and well be an able research partner.

Contact:US Sales Office :11140 Rockville PikeSuite 400Rockville, MD 20852United StatesTel: +1 (628) 251-1583E-Mail:sales@factmr.com

Corporate Headquarter:Unit No: AU-01-H Gold Tower (AU),Plot No: JLT-PH1-I3A,Jumeirah Lakes Towers,Dubai, United Arab Emirates

Read more:
Growing Prevalence & Recurrence Of Rheumatoid Arthritis Is Expected To Growth Of The Rheumatoid Arthritis Stem Cell Therapy Market Designer Women...

Recommendation and review posted by Bethany Smith

Theglobal cell therapy marketsize was valued atUSD 8.1 billion in 2021and is estimated to reachUSD 23.9 billion by 2030, growing at a CAGR of 14.5% over the forecast period. The development of precision medicine and advancements in cellular therapies in context to their efficiency & manufacturing are expected to be major drivers for the market. Moreover, the development of stem cell banking facilities and resultant enhancement of stem cells production, storage, and characterization are also expected to improve the volumetric capabilities of the market at a global level, which is anticipated to directly translate into revenue for this market at a larger level. Ongoing technological advancements in the parent and ancillary markets for stem and non-stem cells usage are expected to reinforce the demand over the forecast period. There are fewer commercialized cellular therapy products in the current market than the number of research products. This is partly due to stringent regulations and the high cost of stem cells.

Get Full PDF Sample Copy of Report:https://www.marketstatsville.com/request-sample/cell-therapy-market

Cell lines, such as Induced Pluripotent Stem Cells (iPSC) and human Embryonic Stem Cells (hESC) are recognized as having high growth potential; as a result, many research entities and companies are making significant investments in R&D pertaining to iPSC- and hESC-derived products.

Pricing of stem cell transplantation varies from region to region. For instance, the cost of transplantation in the U.S. is higher than that in Germany or China. In March 2018, Alofisel by TiGenix received approval for marketing in Europe. This was the first allogeneic stem cell therapy to be approved in Europe. Furthermore, revenue for certain products varies for the country; for instance, products like INVOSSA received approval for marketing in Korea but have yet to receive marketing authorization in the U.S. Growth is also influenced by the commercialization of unauthorized stem cell treatments revenue generation.

Global Cell Therapy Market Definition

Therapy in which viable cells are injected, grafted, or implanted into a patient to effectuate a medicinal effect is known ascell therapy; for instance, In immunotherapy, T-cells capable of fighting cancer cells via cell-mediated immunity are transplanted, and stem cells are grafted to regenerate diseased tissues.

Cellular therapies hold a great therapeutic promise across various clinical applications. This has resulted in substantial global investments in research and their clinical translation. Rapid advances in stem cell research have the potential to fulfill the unmet demand of pharmaceutical entities, biotech entities, and doctors in disease management. Several unknown therapies are in clinical development.

Furthermore, government and private funding agencies are constantly offering grants to support projects at various stages of clinical trials, increasing the number of ongoing clinical trials.

Research on human embryonic stem cells is ethically controversial. Harvesting embryonic stem cells involves the destruction of human embryos, raising a moral concern. In addition, stringent regulations for obtaining Intellectual Property Rights (IPR) for products or materials used in research are major restraints for commercializing these services. Ethical approval should be obtained to store cell lines and tissues in biorepositories to avoid the usage of tissue for illegal purposes or to identify proxy diseases to claim insurance. Moreover, controversies surrounding the use of embryonic stem cells for research impede the market growth in several regions

The study categorizes the cell therapy market based on use type and therapy type at the regional and global levels.

The analysis of the cell therapy market is based on the use of stem cells for clinical and research purposes. The research-use segment dominated the market for the global cell therapy market and accounted for the largest revenue share of 58.3% in 2021. Currently, cell therapies (stem & non-stem cells) are majorly being used for research projects, which in turn, has led to a large revenue share of this segment in 2021. Cell-based therapies are all possibilities for the replacement, repair, restoration, and regeneration of damaged tissues, cells, and organs. As an alternative to traditional treatment strategies, researchers are investing heavily in developing effective and safe cell-based treatments.

As per the CGT Catapult database of clinical trials, 59 cell and gene therapy trials are ongoing in the UK. Out of all therapeutic areas, oncology has the highest number of ongoing clinical trials. T cells, CD34+ and CD133+ stem cells, mesenchymal stem/stromal cells are some predominantly employed cell types for clinical investigation. Neural cells, bone marrow mononuclear cells, fibroblasts, cornea cells, antigen-presenting cells, epithelial cells, and chondrocytes are some other cells that are being explored for the development of cell therapies.

Make an Enquire before Purchase @:https://www.marketstatsville.com/buy-now/cell-therapy-market?opt=2950

Asia Pacificaccounts for the highestCAGR during the forecast period

Based on the regions, the global cell therapy market has been segmented across North America, AsiaPacific, Europe, South America, and the Middle East & Africa.In the Asia Pacific, the market for cell therapy is anticipated to witness a lucrative growth rate of 15.5% over the forecast period. Advancements in stem cell therapy in Asian countries are observed to be better than those in the U.S. This has resulted in Asia leading stem cell research. Several stem cell consortiums in Asian countries aim to ensure coordinated and focused R&D programs. Moreover, patients from western countries migrate to Asian countries for treatment, owing to the flexible legal framework.

Companies from Japan, South Korea, India, China, Taiwan, Singapore, and the rest of Asia were active participants in the conference. In addition, the large regional population and untapped potential present in the region have resulted in global firms entering the market. Moreover, this region offers relatively inexpensive manufacturing & operating units for conducting research. These factors are expected to play a major role in expanding the stem cell market in this region.

The cell therapy market is mildly concentrated in nature with few numbers of global players operating in the market such as Kolon TissueGene, Inc., Anterogen Co., Ltd., JCR Pharmaceuticals Co., Ltd., Castle Creek Biosciences, Inc., MEDIPOST, Osiris Therapeutics, Inc., PHARMICELL Co., Ltd, Tameika Cell Technologies, Inc., Cells for Cells, NuVasive, Inc., Vericel Corporation, and Celgene Corporation.

Request for Complete TOC and Figures & Graphs @https://www.marketstatsville.com/table-of-content/cell-therapy-market

Originally posted here:
Cell Therapy Market With Manufacturing Process and CAGR Forecast by 2030 Designer Women - Designer Women

Recommendation and review posted by Bethany Smith

Returning home after a Fathers Day trip to New York City with his daughter in 2016, Scott Kesel thought he had come down with the flu. Bloodwork showed his blood platelets were lower than normal. He followed up with his regular physician and was given the news: he had chronic myelomonocytic leukemia (CMML).

CMML is a rare type of blood cancer that starts in the bone marrow, where blood cells are made. It can involve other areas of the body. There are only about 1,100 cases in the U.S. each year and its more common in people over age 60.

As a Canandaigua resident, Scott started his cancer journey at Wilmot Cancer Institutes Sands Cancer Center at F.F. Thompson. His oncologist laid out all the options: chemo and a stem cell transplant.

Knowing he would need a transplant, his team at Sands had him transfer to Wilmots Hematology team, where he began seeing Jason Mendler, M.D., and his transplant doctor, Omar Aljitawi, M.B.B.S.

He had chemotherapy at Wilmot, where he got to know the infusion nursing staff.

They have put a mindset in place thats so beneficial to the patient, he says.

For a stem cell transplant, his brother was the closest match they could find, although he was only a half-match. That left the option for a haplo-identical transplant available. Historically, it was required to have a closer match in order to do a transplant. With a haploidentical transplant, the donor is only half-matched. Its a newer procedure that is not available at all transplant centers, but the doctors at Wilmot have been performing the surgery since 2015.

He underwent the transplant but, unfortunately, in Scotts case, it didnt work.

For a short period, Scott went to another institution for a clinical trial. Unfortunately, that didnt work either. He developed pancreatitis and had to drop out of the trial. He also experienced cold agglutinin disease, which caused his immune system to attack his red blood cells. Cold temperatures can trigger it and he had to stay at Wilmot for about a month in a temperature-controlled room, set at 80 degrees at all times, to overcome it.

Once that resolved, the team at Wilmot suggested another treatment option to try on Scotts leukemia: a transplant with stem cells from an umbilical cord donation. Umbilical cord blood stem cells came from Australia and Spain to try to save Scotts life. He had only two cord blood units available and he needed both to have a successful transplant, which was his only viable chance to potentially cure his leukemia. Along with the cord blood, he also had radiation therapy with Louis Constine, M.D.

He had nothing but good things to say about the team that took care of him while he was hospitalized on Wilmot Cancer Centers sixth floor, the Blood and Marrow Transplant Unit.

It was exceptional. They were so friendly and accommodating right from the very beginning, he says. It wasnt limited to nurses. Theres medical technicians on the floor that were so friendly and became very good friends.

Scott Kesel (right) with Jason Mendler, M.D., at the 2019 Wilmot Warrior Walk

Thankfully, this time the transplant took. As of June 2022, Scott has been in remission for three-and-a-half years. He credits his team for getting him there.

Its an incredible group of people, he says.

But its not just his team hes grateful for. He appreciates that his life has returned basically back to normal, despite the tumultuous COVID pandemic that happened shortly after his transplant.

Hes gotten back to work and to hobbies he enjoys outside work.

I happen to be the worlds greatest tuba playing car salesman, he jokes.

This summer and fall, he has 28 gigs lined up, with different music groups around the region to keep him busy, and he looks forward to hunting and fishing during his free time.

For it all, he feels fortunate.

You have to be grateful for the outcome, he says. I got a lot of support remotely from people in my community who used the opportunity to promote bone marrow registration and blood drives, which was awful nice.

He adds, Im grateful that I ended up at Wilmot. I really couldnt have been in a better place.

Original post:
'World's Greatest Tuba-Playing Car Salesman' Bounces Back after Leukemia, Thanks to Wilmot Team - URMC

Recommendation and review posted by Bethany Smith

Preclinical evaluation of FasT CAR-T cellsFasT CAR-T (F-CAR-T) proliferation in vitro

To characterize the in vitro proliferative capacity of F-CAR-T cells, F-CAR-T and C-CAR-T cells were manufactured in parallel (Supplementary Methods, and Fig. S1) using T-cells from 6 B-ALL patients. To investigate the ex vivo proliferation of F-CAR-T, frozen CD19 F-CAR-T and C-CAR-T cells from each patient were thawed and stimulated with irradiated CD19-expressing K562 cells. The number of CD19-targeting CAR-T cells was then determined during the course of cell expansion in vitro. As shown in Fig. 1A, upon CD19 antigen stimulation, F-CAR-T proliferation was much more robust compared to C-CAR-T proliferation. On day 17 post co-culture, F-CAR-T expanded 1205.61226.3 fold (MeanSD), while C-CAR-T expanded only 116.437.2 fold (MeanSD), (p=0.001). To characterize the mechanism underlying the superior proliferative ability of F-CAR-T, we purified CD19+ CAR-T cells from both F-CAR-T and C-CAR-T. The expression of genes involved in cell proliferation, cell cycle, and apoptosis was analyzed using Nanostring (detailed gene sets are in Table S2). Gene expression profiles showed higher F-CAR-T expression scores for genes associated with cell cycle regulation (F-CAR-T vs. C-CAR-T, p<0.01) and lower expression scores for apoptosis-related genes (F-CAR-T vs. C-CAR-T, p<0.05) in F-CAR-T cells (Fig. S2A).

A Ex vivo cell proliferation of F-CAR-T and C-CAR-T derived from B-ALL patients (n=6) (***P=0.001, F-CAR-T vs. C-CAR-T, d17, unpaired student two-tailed t-test). B Tscm, Tcm, and Tem were characterized by surface staining of CD45RO and CD62L and analyzed with flow cytometry (***P<0.001 comparing F-CAR-T and C-CAR-T). C T-cell exhaustion was characterized by PD-1, LAG3, and TIM-3 staining; Statistical analyses of the percentage of PD1+ LAG3+ Tim3+ (***P<0.001, comparing F-CAR-T and C-CAR-T), unpaired student two-tailed t-test). D RTCA assay was used to examine the specific killing of HeLa-CD19 cells. Growth of target HeLa-CD19 or HeLa cells were monitored dynamically. E CD19+ target Nalm6-Luc cells or F Raji-Luc cells were co-cultured with either F-CAR-T or C-CAR-T for 6h. Target cell killing efficacy was calculated by luciferase activity. NS, P>0.05 F-CAR-T vs. C-CAR-T (unpaired student t-test, two-tailed). F-CAR-T FasT CAR-T, C-CAR-T conventional CAR-T, Tcm (CD45RO+CD62L+) T central memory cells, Tem (CD45RO+CD62L) T effector memory cells, Tscm (CD45ROCD62L+) T stem cell memory, PD1 programmed cell death protein 1, TIM-3 T cell immunoglobulin and mucin domain containing-3, LAG3 lymphocyte-activation gene 3, RTCA real-time cell analyzer, E:T effector cells: target cells, NT normal T-cell.

Phenotypes of unstimulated F-CAR-T from three healthy donors were analyzed by flow cytometry. The CD45ROCD62L+ population was 45.7%2.2% which was comparable to the un-transduced T-cells (data not shown). Upon stimulation with CD19+ tumor cells for 9 days, C-CAR-T central memory cells (Tcm, CD45RO+CD62L+ and effector memory cells (Tem, CD45RO+CD62L) were 56.62%11.97% and 40.48%9.70%, respectively, among the C-CAR-T cells (Fig. 1B and Figs. S2B and S2). In contrast, Tcm cells (87.92%4.36%) was predominant in F-CAR-T, with only a small fraction of Tem (7.84%3.79%). In addition, F-CAR-T cells demonstrated more abundant T stem cell memory (Tscm) (3.841.22% vs 2.342.48%, p<0.05) than C-CAR-T cells. We also examined the exhaustion status of the stimulated CAR-T cells. A higher percentage of PD-1+LAG3+Tim3+T-cells were detected in the C-CAR-T (11.19%2.54%) compared to F-CAR-T (3.59%2.51%, p<0.001) (Fig. 1C). Together these data indicated that the F-CAR-T exhibited a younger phenotype and was less exhausted compared to C-CAR-T.

We used a real-time cell analyzer (RTCA) assay to measure the cytotoxicity of F-CAR-T and C-CAR-T against CD19+ cells in vitro. F-CAR-T and C-CAR-T killing of Hela-CD19 target cells were comparable using this assay (Fig. 1D). Similar levels of IFN- and IL-2 production were also observed (Fig. S2D). In a luciferase-based cytotoxicity assay, CD19+ B leukemia cell lines, Raji and Nalm6, were both effectively killed to similar or better levels at different E:T ratios (Fig. 1E, F).

To compare the in vivo cytotoxicity of F-CAR-T and C-CAR-T, severe immunodeficient NOG mice were engrafted with Raji-luciferase cells. One week after the tumor grafts were established, F-CAR-T and C-CAR-T were intravenously injected at various doses. The engrafted tumors progressed aggressively in control groups with either vehicle alone or control T-cells (Fig. 2A). In contrast, F-CAR-T or C-CAR-T treatment greatly suppressed tumor growth in a dose-dependent manner (Fig. 2A). In the high dose group (2106/mice), both F-CAR-T and C-CAR-T eliminated the tumor rapidly. However, in the low dose group (5105/mice), F-CAR-T showed more effective tumor-killing compared to C-CAR-T. On day 20, mice in the low dose F-CAR-T group became tumor-free, while C-CAR-T treated mice exhibited tumor relapse (Fig. 2A). We examined the CAR-T cell expansion in vivo after infusion. As shown in Fig. 2B, both F-CAR-T and C-CAR-T began to expand in the peripheral blood 7 days after infusion. C-CAR-T cell numbers reached their peak on day 14 and receded on day 21. In contrast, the F-CAR-T cell number peaked on day 21 and declined to a baseline level on day 28. F-CAR-T not only persisted longer but also underwent 26 folds greater expansion than C-CAR-T (Fig. 2B).

A Raji-Luc cell engraftment NOG mice were given high dose (2106/mice, n=3) and low dose (5105/mice, n=3) F-CAR-T/C-CAR-T along with control groups. Tumor growth was monitored with IVIS scan once every 3 days; B CAR-T expansion in peripheral blood of mice was analyzed by flow cytometry (n=6). ***P<0.001 for F-CAR-T HD vs. C-CAR-T HD; F-CAR-T LD vs. C-CAR-T LD; F-CAR-T HD vs. F-CAR-T LD; C-CAR-T HD vs. C-CAR-T LD (two-way ANOVA statistical analysis); C Schematic of the Nalm6 (1106) xenograft model, CAR-T (2106) infused 1 day after cyclophosphamide (20mg/kg) treatment. Bone marrow infiltration of F-CAR-T was analyzed 10 days after CAR-T infusion (n=3); D CD45+CD2 F-CAR-T vs. C-CAR-T in peripheral blood of mice were analyzed by flow cytometry; *P<0.05 (unpaired student two-tailed t-test). IVIS in vivo imaging system, PB peripheral blood, i.v. intravenous, HD high dose, LD low dose, Cy cyclophosphamide; *p<0.05; #: number.

We examined the BM infiltration of F-CAR-T cells after infusion into Nalm6-bearing mice (Fig. 2C). A larger population of CAR-T cells was observed 10 days after infusion in BM in F-CAR-T infused group than that in the C-CAR-T group (p<0.05) (Fig. 2D), suggesting F-CAR-T cells possessed a better BM homing capability than C-CAR-T.

The chemokine receptor CXCR4 is known to be critical for BM homing of T-cells [25, 26]. Indeed, a higher percentage of CXCR4+ T cells were detected in F-CAR-T than in the C-CAR-T. Interestingly, this phenotype was more pronounced for CD4+ T cells than CD8+ T cells (Fig. S3A). In a two-chamber system, more F-CAR-T cells could be detected in the lower chamber than their C-CAR-T counterparts (Fig. S3B).

Between Jan. 2019 and Oct. 2019, 25 pediatric and adult patients with CD19+R/R B-ALL were enrolled onto our phase 1 trial, including two patients who had relapsed following a prior allo-HSCT. Patient characteristics are detailed in Table 1. The median age of patients was 20 (range: 344) years old. Twenty patients were >14 years old, and five were 14 years old. The median percentage of pre-treatment BM blasts was 9.05% (range: 0.1982.9%). As our pre-clinical studies demonstrated that F-CAR-T cells had a superior expansion capability as compared to C-CAR-T, we infused a relatively low doses of F-CAR-T cells, ranging from 104105 cells/kg: 3.0104 cells/kg (n=2), 6.5 (5.867.43)104 cells/kg (n=9), 1.01 (1.01.16)105 cells/kg (n=12), 1.52(1.471.56)105 cells/kg (n=2), (Fig. S4). The median time from apheresis to the infusion of CD19+F-CAR-T cells was 14 days (range: 1220). Although the manufacturing time of F-CAR-T was next day, the quality control time and detailed final product releases including sterility testing require a minimum of 710 days to complete. In addition, transportation of cell products requires approximately two days. Of the 25 patients who received CD19 F-CAR-T infusion, 22 (88%) received bridging chemotherapy between apheresis and lymphodepleting chemotherapy to control rapid disease progression (Table S3).

F-CAR-T cells were manufactured successfully for all patients. The mean transduction efficiency of F-CAR-T was 35.4% (range: 13.170.3%) (Fig. S5A). Both CD4+/CAR+ (mean, 49.6%; range: 13.673.2%) and CD8+/CAR+ (mean, 41.5%; range: 20.677.7%) subsets were present in the CD3+CAR+ T cell subsets of all products. The mean proportion of Tscm, Tem, and Tcm cells in the CD3+CAR+ T cell subsets of all products was 23.3% (range: 3.5545.3%), 33.2% (range: 17.267.9%), and 36.1% (range: 20.758.1%), respectively (Fig. S5B). F-CAR-T products exerted significant IFN- release and cytotoxic effects against the CD19+ cell line HELA-CD19 (Fig. S5, C, D).

All 25 infused patients experienced adverse events (AEs) of any grade, with 25 (100%) experiencing grade 3 or higher adverse events. No grade 5 events related to F-CAR-T treatment were observed (Table 2).

CRS occurred in 24 (96%) patients with 18 (72%) grade 12 CRS,6 (24%) of grade 3, and no grade 4 or higher CRS (Fig. S6). In the >14 years old group, 16/20 (80%) patients developed mild CRS, and only 2/20 (10%) developed grade 3 CRS. For 14 years old patients, 2/5 (40%) had mild CRS, yet 3/5 (60%) experienced grade 3 CRS (Table S4). ICANS was observed in 7 (28%) patients, with 2 (8%) grade 3 ICANS occurring in patients >14 years old and 5 (20%) grade 4 ICANS all occurring in patients 14 years old. No grade 5 ICANS was developed (Fig. S7 and Table S4). The most frequent presentation of CRS was fever, particularly a high fever of >39C. The first onset of CRS symptoms occurred between day 3 and 8 post-CAR-T infusion with a median onset at day 4 (range: 110 days). The most common symptoms of ICANS were seizure (5/7) and depressed consciousness (5/7). The median time to ICANS onset from CAR-T cell infusion was 7 days (range: 58), and the median time to resolution was 2 days (Fig. S7). All CRS and ICANS events were managed including early intervention when fever of 39C persisted for 24h. Sixteen (64%) patients received tocilizumab with a median total dose of 160mg (range: 160320mg). Twenty-one (84%) patients received corticosteroids including dexamethasone (median total dose, 43mg; range: 4127mg) and or methylprednisolone (median total dose, 190mg; range: 401070mg). The vast majority of these patients discontinued corticosteroids within 2 weeks. The change in IL-6, IFN-, IL-10, and GM-CSF levels after infusion are selectively shown in Fig. S8. The peak levels of these four cytokines were observed between day 710. Among all 21 cytokines examined, only post-infusion IL-6 levels were associated with moderate to severe CRS and/or ICANS (Figs. S9 and S10).

Superior in vivo proliferation and persistence of F-CAR-T compared to C-CAR-T cells were observed regardless of dose levels. The median peak level was reached on day 10 (range: 714 days) with 1.9105 transgene copies/g of genomic DNA (range: 0.225.2105 transgene copies/g of genomic DNA) by qPCR and 83 F-CAR-T cells per l blood (range: 42102 F-CAR-T cells per l blood) by FCM (Fig. 3A, B). No significant differences were observed among the different dose groups in the mean F-CAR-T copies peak (Fig. 3C). Importantly, there was no significant difference in the mean F-CAR-T copies peak between patients who received corticosteroids compared to those who did not (Fig. 3D).

A F-CAR-T cells in peripheral blood by qPCR. Purple, dose level 1; black, dose level 2; blue, dose level 3; red, dose level 4; B F-CAR-T cells in peripheral blood by flow cytometry. Purple, dose level 1; black, dose level 2; blue, dose level 3; red, dose level 4; C Comparison of the mean peak copy number of F-CAR-T cells in peripheral blood at each dose level. Statistical significance was determined by the MannWhitney test. D Comparison of the mean peak copy number of F-CAR-T cells in peripheral blood with or without steroids. Statistical significance was determined by the MannWhitney test.

Fourteen days after F-CAR-T cell infusion, all patients achieved morphologic CR including 2/25 with CR and 23/25 CR with incomplete hematologic recovery (CRi), which further improved to 11/25 CR and 14/25 CRi 28 days post F-CAR-T (Table 1 and Fig. 4). More importantly, 23/25 (92%) had the minimal residual disease (MRD)-negative remission on day 14 and day 28 after F-CAR-T treatment. Patients achieving remission through CAR-T were given the option to proceed to allo-HSCT. With a median time of 54 days (range: 4581 days) post F-CAR-T infusion, 20 of 23 patients with MRD-negative status decided to pursue consolidative allo-HSCT including one patient who received a 2nd transplant. As of 18 October 2021, with a median follow-up duration of 693 days (range: 84973 days) among the 20 patients who had received allo-HSCT, one patient relapsed on day 172 and died 3 months after relapse, and four patients died from transplant-related mortality (TRM) including infection (n=3) and chronic GVHD (n=1) on day 84, day 215, day 220, and day 312, respectively. The other 15 patients remained in MRD-negative CR with a median remission duration of 734 days (range: 208973) except for one who became MRD-positive on day 294 with CD19+ disease. Among the other three patients (F05, F06, F16), one remained in MRD-negative CR on day 304, one remained in MRD-negative CR until day 303, received allo-HSCT but died from an infection on day 505, and one was lost to follow-up after day 114. Two patients who had MRD-positive CR after infusion withdrew from the study on day 42 and day 44, respectively, to seek other studies.

Clinical outcomes and consolidative allo-HSCT for the 25 patients who were treated with F-CAR-T therapy are shown. On day 28, 23/25 patients achieved MRD-negative CR/CRi. With a median time of 54 days (range: 4581) post F-CAR-T infusion, 20 of 23 patients with MRD-negative status received consolidative allo-HSCT. Among the 20 patients, 1 patient (F23) relapsed on day 172 and died 3 months after relapse. Four patients (F04, F09, F11, F12) died from transplant-related mortality (TRM) including infection (n=3) and chronic GVHD (n=1) on day 84, day 215, day 220, and day 312, respectively. The remaining 15 patients were in MRD-negative CR except for one (F18) who became MRD-positive on day 294. Among the other 3 patients (F05, F06, F16), 1 remained MRD-negative CR on day 304, 1 remained in MRD-negative CR until day 303, received allo-HSCT, and subsequently died from an infection on day 505. One patient was lost to follow-up after day 114. MRD minimal residual disease, CR complete remission, Allo-HSCT allogeneic hematopoietic stem cell transplantation.

F-CAR-T/T ratio in cerebrospinal fluid (CSF) was evaluated by FCM in 13/25 patients with available samples (Table S5). Between days 10 and 32, 9 patients were found to have considerable F-CAR-T penetration in their CSF, ranging from 40.65 to 79.2%, including 4 who developed severe ICANS. Among the other 4 patients, F-CAR-T cell abundance in the CSF ranged from 1.29% to 3.57%, and none experienced severe ICANS. Patients with higher levels of CAR-T in PB on day 10 consistently had higher levels of CAR-T in CSF with the exception of patient F15. Notably, CAR-T cells were still detectable in the CSF on day 101 with a 2.36% CAR-T/T ratio in patient F06, who also had undetectable circulating CAR-T cells at the same time.

In addition, concentrations of seven cytokines (IL-1b, IL-6, IL-10, IFN-, TNF-, MCP-1, and GM-CSF) in CSF samples from the above 10 of 13 patients were measured. Specifically, IL-1b was not detected in any of the 10 patients, and only one patient had detectable GM-CSF. For the other five cytokines, patients with severe ICANS had higher IL-6 levels in contrast to patients without severe ICANS, and the difference between the median level of IL-6 among these two groups of patients was statistically significant (Fig. S11). We did not observe significant differences among the other 4 cytokines between the two groups of patients. No clear relation between the CSF cytokine levels and the F-CAR-T/T % was observed.

View post:
Next-day manufacture of a novel anti-CD19 CAR-T therapy for B-cell acute lymphoblastic leukemia: first-in-human clinical study | Blood Cancer Journal...

Recommendation and review posted by Bethany Smith

Ulcerative colitis, or UC, is a form of inflammatory bowel disease characterized by chronic and relapsing large intestine inflammation. Genetics account for only a minority of UC cases; hence, to develop treatments, researchers need to understand better the environmental contributions to this condition.

Gut microbes are in perpetual contact with the gastrointestinal tract, so they comprise important but poorly defined environmental variables contributing to UC development. Many studies have reported changes in gut microbiome composition in patients with UC compared to healthy individuals. While that suggests a potential role for gut microbes in UC pathogenesis, researchers have yet to pinpoint the causative microbes and associated bacterial proteins.

Dennis Wolans lab at Scripps Research is interested in identifying small-molecule activators and inhibiting bacterial enzymes involved in proliferation of human disease. Wolan said he was curious about what bacterial enzymes of the microbiome contribute to UC development.

Many publications have focused on the role of the microbiome in both health and disease states, he said. Most of these were focused on the taxonomical and phylogenic differences in the microbiome. But what about the associated bacterial proteins? What proteins are these gut bacteria making in disease conditions, and how are these interacting with the human body?

One protein of interest was serine proteases, a type of proteolytic enzyme that cleaves peptides at the serine amino acid. Researchers long have recognized that they coordinate many physiological processes and play key roles in regulating the inflammatory response. Previous studies have suggested increased proteolytic activity in microbial samples harvested from people with inflammatory disorders such as UC and Crohns disease.

Peter ThuyBuon, a graduate student and later a postdoc in the Wolan lab, led a project to study differential protein expression in healthy and UC fecal samples. He and the team described the project in a recent paper in the journal Molecular & Cellular Proteomics. In addition to standard mass spectrometry, ThuyBuon used a small molecular approach called affinity-based proteomic profiling to target and enrich for different types of proteases in the fecal samples.

We showed that there were 176 discrete host and microbial protein groups differentially enriched between healthy and UC patients, Wolan said. Furthermore, further enrichment of these proteins showed significantly higher levels of serine proteases in UC patients.

This finding has inspired exciting future research questions. For example, are elevated serine proteases the driver of UC or merely the effect of UC disease progression?

There is a lot of exciting work to be done using these findings, Wolan said. Future molecular studies should focus on how serine proteases might be contributing to UC and whether their levels can be manipulated to modify disease progression.

Functional proteomics has shown the potential role of serine proteases in UC. Future steps will include drug discovery and design of small-molecule regulators of bacterial enzymes.

Wolan said, Ultimately, the moderation of microbiome distribution in UC via external small-molecule intervention can serve as a foundation for UC prevention and treatment.

Read more here:
Proteases implicated in ulcerative colitis - ASBMB Today

Recommendation and review posted by Bethany Smith

The very thought of getting someone elses poop transfused in your body may make you cringe but stool transplant has not only helped patients with gastrointestinal tract issues, it has also saved those who have had bone marrow transplants.

At Deenanath Mangeshkar Hospitals Centre of Excellence in Infectious Diseases and Department of Haematology, Pune, seven of the 11 patients of bone marrow transplants developed Clostridium difficile infection. They were treated with faecal microbial transplant (FMT), also referred to as stool transplant, over the past year.

Research worldwide has shown that a faecal transplant can restore healthy bacteria in the lower intestine which can help control Clostridium difficile or C. diff. According to the Johns Hopkins University School of Medicine, FMT can be more effective than antibiotics for keeping C. diff in check in some cases.

Since C. diff infection can recur and cause colitis (inflammation in the colon), FMT restores good and healthy bacteria, said Dr Parikshit Prayag, infectious disease consultant and in-charge of the Centre of Excellence in Infectious Diseases at Deenanath Mangeshkar hospital.

Dr Sameer Melinkeri, head of the department of haemotology at the hospital, said C. diff infection-related diarrhoea can occur in a normal setting in which antibiotics can be used for treatment. However, antibiotic treatment for recurrent infections can involve one or more courses of medication and their effectiveness comes down with each subsequent bout. FMT can arrest such infections post bone marrow transplant as it can be life-threatening, he added.

FMT is also done for certain disease conditions like Graft vs host disease (GvHD). Most people who undergo a bone marrow transplant suffer from blood cancer. Graft vs host disease can occur at any time after an allogeneic transplant where the donated bone marrow or peripheral stem cells can attack the recipients body. It can develop in the GI tract, skin or liver, Dr Prayag said.

Latest research published in the Journal of International Medical Research and others has shown how FMT is a promising treatment for patients with steroid-resistant GvHD. We have seen clinically relevant results in six of our patients, Dr Prayag said.

So, who can be donors? They are selected based on certain parameters. They should not be immune-compromised or have taken antibiotics over the past six months, says Dr Sampada Patwardhan, head of the department of microbiology at the hospital. Donor screening has to be done carefully. We need to rule out infections, she said.

Procedures on the transplant delivery methods may vary like colonoscopy and use of nasojejunal tube. The recovery may take a week or more and in most cases there are at least two weekly installations of the stool (in liquid form).

Very few centres conduct FMT and among them, the centre at Deenanath Hospital actively treats cases involving bone marrow transplants. At a recent virtual meeting of the International Society of Blood Transfusion, Dr Prayag made a strong case for encouraging stool transplants. The condition of C. diff is also underdiagnosed in the country as there isnt adequate infrastructure to correctly detect the problem, he pointed out.

In fact, FMT is being touted as a treatment option for many gut health issues. In an opinion article published on June 30 in the journal Trends in Molecular Medicine, a team from Harvard Medical School and Brigham and Womens Hospital (BWH) proposes that individuals bank samples of their own gut microbiota when they are young and healthy for potential use later in life in an autologous FMT.

A report in Science Daily quotes corresponding author Yang-Yu Liu, an associate professor of medicine at Harvard and an associate scientist in the Channing Division of Network Medicine at BWH, as saying, The idea of rewilding the human microbiome has taken off in recent years and has been hotly debated from medical, ethical and evolutionary perspectives. It is still unknown if people in industrialized societies can gain some health benefit by restoring their microbiome to an ancestral state. In this paper, we proposed a way to rejuvenate the human gut microbiome.

The report also listed OpenBiome, a non-profit stool bank based in Somerville, Massachusetts, as the first stool bank to offer an option for individuals to bank their own stool for future treatment of C. diff infection. Yang and his colleagues are now looking at if this treatment can be used for other diseases.

Conceptually, the idea of stool banking for autologous FMT is similar to when parents bank their babys cord blood for possible future use. However, there is greater potential for stool banking, and we anticipate that the chance of using stool samples is much higher than for cord blood. But there are many practical issues to implementing this idea, Yang is quoted as saying, hinting at optimal storage and cryopreservation issues.

Read the rest here:
Cutting Edge: Poop therapy can save your gut, and your life - The Indian Express

Recommendation and review posted by Bethany Smith

A non-nuclear mock B61-12 Joint Test Assembly (JTA) being prepared for test loading inside the B-2A Spirit stealth bombers bombs bay. (U.S. Air Force photo by Airman 1st Class Devan Halstead)

The U.S. Air Force recently released on the Defense Visual Information Distribution Service (DVIDS) website a series of interesting photos from Whiteman Air Force Base, Missouri. The photos, taken on June 13, 2022, show a high-fidelity, non-nuclear mock B61-12 Joint Test Assembly (JTA) being prepared for test loading inside the B-2A Spirit stealth bombers bombs bay. To our knowledge, these should be the first public photos of the weapon with the Spirit since testing aboard the aircraft has begun few years ago.

The Air Force did not provide many details and did not even mention the name of the bomb, simply stating the 72nd Test and Evaluation Squadron test loads a new nuclear-capable weapons delivery system for the B-2 Spirit bomber. The 72nd TES, a geographically separated unit of Eglin AFBs 53rd Wing based at Whiteman, is in charge of all testing and evaluation of new equipment, software and weapons systems for the B-2 Spirit stealth bomber.

It is not clear what the caption refers to with the term nuclear-capable weapons delivery system. The unofficial Nuclear Matters Handbook of the office of the Deputy Assistant Secretary of Defense for Nuclear Matters, gives us the following definition:

A nuclear weapon delivery system is the military platform and delivery vehicle by which a nuclear weapon is delivered to its intended target in the event of authorized use (by the President of the United States, who retains sole authority to employ nuclear weapons). Most nuclear weapons have been designed for a specific delivery system, making interoperability potentially challenging.

In addition to the mix of silo-based Minuteman III (MMIII) ICBMs, Trident II D5 Life Extension (LE) SLBMs carried on Ohio-class SSBNs, and B-2A and B-52H nuclear-capable heavy bombers, the U.S. nuclear force includes dual-capable aircraft (DCA), that can carry conventional or nuclear weapons.

Judging by this definition, the weapon delivery system in question should be the B-2A bomber, however the fact that the caption mentions the test loading aboard the aircraft might mean that this system is a new weapon rack inside the bombs bay designed to work with the new B61-12. Available public info states that the Spirit was designed to employ a Bomb Rack Assembly (BRA) for conventional munitions and a Rotary Launcher Assembly (RLA) for the delivery of conventional or nuclear weapons.

The BRA was later upgraded between 2003 and 2006 and became a Smart Bomb Rack Assembly capable of carrying as many as 80 independently targeted, JDAM GPS-guided weapons. So, since the new B61-12 in equipped with a guidance kit, it is possible that also the RLA is now being upgraded to use the new bomb. The new bomb variant will replace the B61-7 and B61-11 currently available for the B-2 fleet.

As we already reported, The B61 entered service 50 years ago and has undergone a Life-Extention Program (LEP) to consolidate and replace four legacy bomb variants, the B61 -3, -4, -7, and -11 mods, into the B61-12. The refurbished B61-12 will allow the retirement of the larger B83, becoming the only remaining gravity delivered nuke in the inventory. The bomb will carry a low-yield nuclear warhead with four yield options, reportedly 0.3 kilotons, 1.5 kilotons, 10 kilotons and 50 kilotons, instead of larger warheads like the models it is replacing (which can reach 400 kilotons depending on the variants).

The 12-foot, 825-pound bomb is designed to be delivered from the air in either ballistic or guided-gravity drop modes, thanks to a new Boeing-built tail assembly that includes an Inertial Navigation System (INS) precision-guidance package and two spin rocket motors that improve the bombs stability on its longitudinal axis during the descent. The LEP is said to be increasing the B61s accuracy so much (with a reported 30 m Circular Error Probability instead of the original 100 m) that it will have the same capability against hardened targets as the much more powerful weapons it is replacing.

See the article here:
U.S. Air Force Releases Photos Of Mock B61-12 Nuclear Bomb Test Loaded On B-2A Bomber - The Aviationist

Recommendation and review posted by Bethany Smith

Global Wellness Supplements Market Continuous Trend, Recent Events, Competitive Scenarios And Regional Forecast To 2029

DBMR added a comprehensive research document of 350+ pages on Global Wellness Supplements Market Share, Size, Industry Trends and Forecast 2029 with detailed insights on growth factors and strategies. Wellness Supplements report has been structured after a thorough study of various key market segments like market size, share, growth, demand, latest trends, market threats and key drivers which drives the market. Strategically analyzed facts and figures of the market and keen business insights covered in this industry analysis report would be a key aspect in achieving enduring business growth. The report offers steadfast knowledge and information of revolutionizing market landscape, what already exists in the market, future trends or what the market expects, the competitive environment, and strategies to plan to outshine the competitors.

Market Analysis and Insights: Wellness Supplements Market

The Wellness Supplements market is expected to witness market growth at a rate of 6.95% in the forecast period of 2022 to 2029. Data Bridge Market Research report on wellness supplements market provides analysis and insights regarding the various factors expected to be prevalent throughout the forecast period while providing their impacts on the markets growth. The rise in the awareness towards healthy lifestyles among the people worldwide is escalating the growth of wellness supplements market.

Wellness supplements are known to be substances that are projected to add further nutritional value to the diet for boosted health. Wellness supplements are vital for upholding a healthy life. Supplements contain all the minerals in sufficient amount to meet the daily need for the healthy life. Food supplement frequently contain calcium, folic acid, vitamin D and vitamin b12.

Download Sample Pages Of This Research Study @ https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-wellness-supplements-market&Shraddha

The research covers the current industry size and growth rates based on previous records with the business pattern of the major players/manufacturers:

Life Extension, OPTAVIA LLC, Beachbody LLC, Natures Sunshine Products, Inc., Organo Gold., Thrive Life, LLC, Phytoscience Trvo, Oriflame Cosmetics AG, Melaleuca Inc, Shaklee Corporation, Arbonne International, LLC., Forever Living.com, L.L.C, Juice Plus+, Herbalife International of America, Inc, and Isagenix Worldwide LLC, Nikken Inc., Wellness Resources, Inc., The Daily Wellness Company, Otsuka Holdings Co. Ltd, Glanbia plc, Nestle, Nuskin, and USANA Health Sciences, Inc.

By Type:

By Application

Academic Institutes, Clinical and Diagnostic Laboratories, Pharmaceutical and Biotechnology Companies and Others

3) Geographically, this report is located on several key regions with sales, revenue, and market share as well as growth rate of Wellness Supplements covered in these regions, 2021-2029.

Countries covered by Global Wellness Supplements Market are Argentina, Australia, Austria, Belgium, Brazil, Canada, Chile, China, Colombia, Czech Republic, Denmark, Egypt, Germany, Finland, France, Hong Kong, India ., Indonesia, Ireland, Israel, Italy, Japan, Malaysia, Mexico, Netherlands, New Zealand, Nigeria, Norway, Peru, Philippines, Poland, Portugal, Romania, Russia, Saudi Arabia, Singapore, South Africa, South Korea, Spain, Sweden, Switzerland, Thailand, Turkey, United Arab Emirates, United Kingdom, United States, Venezuela, Vietnam.

Dont miss out on trade opportunities on Wellness Supplements Market. Talk to our analyst and get crucial industry insights that will help your business grow while completing sample PDF reports

Profitable Result Of Requesting A Sample PDF Report Before Purchase

Frequently Asked Question [F.A.Q]

Q1. Why Choose databridgemarketresearch.com?

Quality Assured (we focus at the quality and accuracy of the report), Customer Satisfaction (our crew of experts will help you with all of your research needs and customize the report), Analyst Support (remedy your questions with our professional analysts earlier than and after buying the report), Instant Delivery (Instant transport as a PDF/PPT/Word report to your e mail address, within 12 hours of receipt of complete payment.) Expertise inimitable (analysts will provide in-intensity information on reports) and privacy policy (We admire your privateness and could never lease or sell your e mail address.)

Q2. How Can I Obtain Statistical Data On The Main Market Players Of The Wellness Supplements Industry?

Statistical data of important marketplace players of the Wellness Supplements enterprise may be obtained from the company profile segment specified in the report. This segment incorporates an evaluation of important players working in the Wellness Supplements industry along side their sales for the beyond 5 years, phase revenue, product offerings, key strategies adopted, and geographic sales generated.

Q3. What Market Dynamics Affect The Company The Most?

The report gives an in-depth assessment of the market by presenting data on various viewpoints that incorporate drivers, restraints, opportunities, and threats. This data can help stakeholders make the right decisions before investing.

Get Complete Details with TOC @ https://www.databridgemarketresearch.com/toc/?dbmr=global-wellness-supplements-market&Shraddha

About Data Bridge Market Research:

An absolute way to forecast what future holds is to comprehend the trend today!

Data Bridge Market Research set forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge endeavours to provide appropriate solutions to the complex business challenges and initiates an effortless decision-making process. Data Bridge is an aftermath of sheer wisdom and experience which was formulated and framed in the year 2015 in Pune.

Data Bridge Market Research has over 500 analysts working in different industries. We have catered more than 40% of the fortune 500 companies globally and have a network of more than

5000+ clientele around the globe. Data Bridge adepts in creating satisfied clients who reckon upon our services and rely on our hard work with certitude. We are content with our glorious 99.9 % client satisfying rate.

Contact Us:

Data Bridge Market Research

US: +1 888 387 2818

UK: +44 208 089 1725

Hong Kong: +852 8192 7475

E-Mail:Corporatsesales@databridgemarketresearch.com

See original here:
Global Wellness Supplements Market Will Record Significant Revenue Growth During The Forecast Period 2022-2029 Designer Women - Designer Women

Recommendation and review posted by Bethany Smith

To remain effective in an era of near-peer warfare and to counter China's growing military, US Special Operations Command and the Navy SEALs are working on two new and improved mini-submarines that are expected to enter service soon.

The two new special-operations mini-subs the Mark 11 Shallow Water Combat Submersible and the Dry Combat Submersible will be the backbone of Naval Special Warfare's submersible fleet for decades to come.

The Mark 11 will replace the Mark 8 Mod 1 mini-sub. The new mini-sub comes with an increased operational range and payload, more advanced sensors, improved navigation systems, and a new command-and-control structure that will allow new technologies to be introduced more efficiently.

At 23 feet long, the Mark 11 will be able to carry six Navy SEALs: two crew and four combat divers. The mini-sub will be to dive to about 165 feet and will be flooded while in use, meaning the SEAL operators will be exposed to the elements and will have to use dry suits and oxygen tanks. (The British Special Boat Service has also ordered the Mark 11.)

SOCOM expects the Mark 11 to hit initial operating capability this summer. Should everything go according to plan, the new SEAL Delivery Vehicle will begin to phase out the Mark 8, which has been in service since the 1980s.

The Dry Combat Submersible is much larger and heavier. The 40-foot mini-submarine will have a vastly longer operational range and greater payload capacity than the Mark 11 and be more comfortable for the 10 commandos two crew and eight combat divers it will be able to carry.

At a recent industry conference, Cmdr. John Conway, SOCOM's program manager for special-operations forces undersea systems, likened the Dry Combat Submersible to "an electric truck" that can do a lot of things at the same time and can be adapted and improved with new sensors and systems in response to future threats and operational environments.

Naval Special Warfare is also looking at "other nontraditional ways to launch" the Mark 11, such as "a containerized solution" off of "some vessel of opportunity or things like that," Navy Cmdr. James Hanlon, SOCOM's program manager for special-operations maritime systems, said at the conference, according to Defense News.

In addition to the new Mark 11 and Dry Combat Submersible, Naval Special Warfare is working on a service-life extension program for the Dry Deck Shelter, which is attached to a submarine's hull and allows SEALs and other combat divers to exit and enter the submarine while underway.

The Navy's six Dry Deck Shelters were built between 1982 and 1991 and were expected to have service lives of 40 years. The planned extension would allow them to operate until the 2050s

The Navy SEAL teams are most well known for their direct-action capabilities. High-profile operations over the last 20 years, including the raid that killed Osama bin Laden, have fostered a belief that all that SEALs do is kick down doors and go after bad guys.

But SEAL teams have other capabilities and are proficient in many skill sets. The SEAL Delivery Vehicles are perhaps one of their most exotic capabilities, and the two SEAL Delivery Vehicle teams specialize in three mission sets: underwater insertion and extraction of special operations troops, underwater special reconnaissance, and underwater special operations.

In addition, SEAL Delivery Vehicle teams can support maritime counterterrorism operations by stealthily moving special operators close to a target that is in or near the water.

Generally, SEAL operators avoid an assignment to a SEAL Delivery Vehicle team because of the extremely difficult mission set. Although all Navy SEALs are combat divers, SEAL Delivery Vehicle team members take combat diving to the next level. Eight- to 10-hour dives are not uncommon.

Naval Special Warfare Command, which oversees the SEALs, has two delivery vehicle teams, which were first stood up in the early 1980s.

SEAL Delivery Vehicle Team One, now based in Hawaii, is dedicated to the West Coast and operations in the Pacific. SEAL Delivery Vehicle Team Two was deactivated in 2008 but reestablished in 2019 amid the shift toward great-power competition. SDVT-2 is based in Little Creek, Virginia, and is the dedicated delivery vehicle unit for the East Coast and operations in Europe.

The delivery vehicle teams are now part of Naval Special Warfare Group 8, which was created in 2020 through the consolidation of two other special warfare groups. The officer who led the group with the delivery vehicle teams was selected to lead Group 8 when it was formed, suggesting SDVs will have an important role going forward.

SEAL Delivery Vehicles are SOCOM's only special-operations submersible capability. In a conflict with China, mini-subs paired with the Navy's attack submarines would be ideal for getting SEALs into tough spots and denied areas, which will be essential for countering China's anti-access/area-denial umbrellaover the Western Pacific.

"Our relationship with our submarine force has never been closer," Rear Adm. Hugh Howard III, commander of Naval Special Warfare Command, told senators in May. "We see the undersea as absolutely critical to deterrence. I think that it is a place that we maintain advantage, and it is a place where we must maintain advantage to critically deter our peer adversaries."

Follow this link:
SOCOM is working on a new and improved Navy SEAL Delivery Vehicle - Business Insider

Recommendation and review posted by Bethany Smith

This is an audio transcript of the FT Weekend podcast episode: How to live forever

Lilah RaptopoulosHello FT Weekend listeners, its Lilah. Im away on vacation this week so weve reached into the vault to bring you one of our favourite episodes. My team and I talk about this episode a lot. Its about living forever and the ethics of radical life extension. Its also about defying death on this outrageous family summer vacation, which feels relevant for the season. One quick note: this episode first published in November. So in the beginning, when I say last year, I mean March of 2020. Okay, enjoy the show.

Did I ever tell you about the time Ira Glass almost gave me coronavirus? It was the last day of going about our normal lives in March of 2020, and everything was starting to shut down and my office was closing, so I packed up my laptop and my keyboard and some of my notebooks into these kind of unwieldy tote bags and I slung them over my shoulder and headed home. But my last stop was this one final interview with the iconic radio host in the studios of This American Life. So Ira and I sat together in the small audio booth for an hour, and we talked about the art of storytelling, and then I left. The next day his assistant emailed me to say that I might have coronavirus because Ira might have coronavirus because he had shaken hands with someone who had coronavirus. And I remember thinking, this cannot be how I go. And that was my first brush with mortality during the pandemic and the first of many. For the next few months, mortality and I became friends. We, like, encountered each other very regularly, going to the grocery store, passing a neighbour in the hallway, taking a walk. We all encountered it, all the time. There are some people who come face to face with death early because theyve had loved ones get sick and pass. And it happens more often to us as we get older. But these past 18 months, its been different. We have a new relationship with death. Weve had to face it either as a reality or as a real possibility.

[MUSIC PLAYING]

Lilah RaptopoulosThis is FT Weekend, the podcast. Im Lilah Raptopoulous. This weekend, were thinking about mortality. Do we look death in the face or do we avoid it altogether? Were going to the extreme ends. One of the worlds top climbers defies death by scaling treacherous mountains with his kids. And FT science writer Anjana Ahuja takes us through the science of living for hundreds of years.

[CLIP PLAYING]

Leo HouldingWhat did you do today, Jackson?

Jackson HouldingWe climbed up the Pingora Peak.

Leo HouldingWhich ones that? You point to it.

Jackson HouldingThat one.

Lilah RaptopoulosThats Leo Houlding, an outdoor adventurer and a guest writer for FT weekend, chatting with his four-year-old son, Jackson.

[CLIP PLAYING]

Leo HouldingWas it hard?

Jackson HouldingUmm, not very, but a bit.

Leo HouldingWas it were you scared at all?

Jackson HouldingNo.

Lilah RaptopoulosLeo recently took his family on a vacation that would leave most of us fearing for our lives. Thats them climbing up Pingora Peak, a mountain described by the first Europeans who saw it as impossible. It was a 14-day trek deep in Wind River Country in the wilderness of Wyoming. He and his wife, Jessica, took their two kids scrambling up isolated technical terrain. Theyre four and eight. Heres Leo with his daughter, Freya, climbing Wolfs Head, a 12,000-foot summit that would be hard for most adults.

[CLIP PLAYING]

Leo HouldingWhats happening, Freya?

Freya HouldingAh, well, Ive just gone up that ridge and Im, whoo! That ridge.

Leo HouldingAwesome. [Freya making sounds while climbing] There goes Freya, heading up that east ridge of the Wolfs Head. Pretty epic. One of the more epic features youre ever likely to see anywhere in the world.

Lilah RaptopoulosOn this trip, there was no cell service. They slept in tents and they brought all their food. Some of the climbing was almost vertical roped climbing and full harnesses. Leo talks about all of this in his piece, which Ive linked to in the show notes, but it sounded so outrageous that I wanted to talk to him about it.

Leo HouldingI think discomfort is underrated and our lives are so comfortable these days. Were all kind of obsessed with making everything as comfortable as possible, whereas actually a good dose of discomfort just makes you appreciate a little bit of comfort so much more.

Lilah RaptopoulosIt should be said that Leo is sort of a climbing celebrity. Hes considered one of the best in the world. You may have seen him. Hes been in documentaries like The Wildest Dream, an Imax film that documents a climb up Everest. And hes been on TV shows like Top Gear. Hes been to Antarctica twice to climb some of the most secluded mountains in the world. So it isnt just that he wants to torture his kids. He believes in this stuff for himself, too. So off they went into the wilderness, the whole family, and two unexpected hired hands.

Leo HouldingThe problem is to do that as a family of four, you need quite a lot of stuff. Aside from the climbing gear, you need all the camping gear, sleeping gear, cooking gear and, most of all, you need food for 14 days. Total was about 100 kilos of equipment. And thats where the llamas came in. (Laughter)

Lilah Raptopoulos(Laughter) Right. Okay. So in your story, youre talking about your van getting stuck and your kids being kind of like unsure about it and youre waiting for someone to help you out. And then this groan comes from the trailer behind you.

Leo HouldingNot many people know that llama trekking is a thing in the western states. There are a couple of outfitters who rent you llamas unguided. Theyre extremely easy animals to look after, unlike horses, which, you know, you kind of have to know stuff to handle horses.

Lilah RaptopoulosSo Leo, his wife, two kids, two llamas, 14 days worth of food and gear. They avoid a moose almost immediately as they get into the backwoods. And at this point, theyre going upwards, but not climbing just yet. On the walk to their camping spot, they meet a hiker who shows them an edible mushroom the size of a football. So they take that with them. And then when they set up camp, Leos wife, Jessica, casts her fishing rod out and immediately pulls back a perfect fish. Like in the movies.

At that stage, what were you thinking? Were you thinking, okay, were good. This is going to be an easy trip?

Leo HouldingI knew it wasnt going to be an easy trip because going into the backcountry is never easy. In fact, its very hard, but its simple. You know, you dont have all the complications of modern life. Its much more about shelter and food and looking after each other. I mean, we went into the Wind Rivers with a couple of objectives in mind, some big cliffs. But for most people that go there, they go there simply to experience the wilderness. Thats something that I would recommend to absolutely everyone.

Lilah RaptopoulosBut Leo and his family arent everyone. Jessica is also an experienced mountain climber, so on that third day, they take their kids out to climb some serious, bare-faced rocks.

Leo HouldingWe did this peak called Pingora, the east ledges of Pingora, which is Jacksons first big climb where he didnt get carried. And I mean, it is a big climb. Its 1,000 feet of climbing, but the face is 2,000 feet high. You kind of come in from the side. So its, its incredibly spectacular.

Lilah RaptopoulosThe following day, Leo takes Freya on a climb thats too hard for Jackson, so they go with one of his climbing buddies.

Leo HouldingIts definitely one of the best kind of easier climbs in North America, if not the world. Its this knife-edge ridge, you know, no more than a metre wide with pretty much 300m drops on both sides, outrageously exposed. Its quite complicated terrain. You have to squirm through chimneys and you have to rappel a bit and you have to go sideways. Going sideways in climbing is actually more difficult to protect than going straight up, and watching my little girl, she got scared, you know. Of course she got scared. But she faced her fear, she controlled her breathing and she absolutely loved it. She was just grinning from ear to ear the whole day.

Lilah RaptopoulosYeah, I have to say, as you tell the story, my heart is beating fast. I imagine that, like a lot of it. And tell me if Im wrong, that a lot of it is just deciding kind of not to be scared.

Leo HouldingThats a big part of it for sure. You know, kids, whatever you introduce them to is normal for them. So Jackson, whos only five, he was only four this summer when when we did some big climbs out in America. Hes just picking his nose, eating his sweets, looking at the birds, wittering away like any other four-year-old would in any other situation. Freya is extremely confident. Shes grown up in the mountains so shes way better than most adults in that terrain. In fact, we actually overtook a couple of adult teams and they were polite about it. But it must have been a little disheartening seeing a cute little eight-year-old skipping past you (laughter) on your big adventure.

Lilah RaptopoulosAll along, Leo had planned to go on an even more serious climb right at the end of their two weeks. Just him and his climbing partner. Theyre gone for just 24 hours. And when they get back nursing cramps and muscle spasms, they find out that the rest of his family had to fend off a bear. Did I not mention? The story also includes a bear.

Leo HouldingShe tried the old banging pans together to scare it off. She did have a kind of bear spray and a hiking pole, but it was snuffling around for, you know, a few hours through the night. And then she realised there was still some food in the pots, in one of these stuff sacks. So she gingerly pushed it out from underneath the tent and ironically, the noise of that scared it off.

Lilah RaptopoulosIf you have kids at this point, you might be asking yourself, is this a little too dangerous? Why is this guy putting his kids at risk? Going into the backcountry with two little kids is one thing, but treacherous climbs, foraged food, bears?

Leo HouldingI mean, theres no question that going into the mountains, going into the backcountry is dangerous. But sometimes people think of me as a professional climber, as an adventurer, as a risk-taker. But the truth is, its very much about risk management. Its about reducing the risks as much as possible. Any idiot can roll the dice a couple of times and get away with it. But when you do it professionally and you do high-risk stuff all the time, you have to do it with a very high degree of safety. But, you know, risk is an inherent part of all life, not just lives of adventure and life in the mountains. You kind of have to accept risk in life to be able to go out and make the most of it.

Lilah RaptopoulosBut Leo says thats the point.

Leo HouldingYou know, we had a couple of pretty serious storms and there was a lot of tears and screaming, as there is in many situations with kids. But actually, sometimes its the, its the low points, its the negative experiences which are the most memorable and most formative. Now, when you get to the top of the mountain, its all smiles and high fives and sunshine. Thats great. But when youre being pelted by hail, thats kind of leaving bruises. And, you know, my wife and I were literally stooped over the kids protecting them from this vicious hail storm. And thats when they learn, as we do, that, you know, you can survive, you can endure, you can push on through, dont give up. And you just have to kind of stay on top of the situation. And then when the sun does come out, you can dry off and live to fight another day.

[MUSIC PLAYING]

Lilah RaptopoulosAnd from looking death in the eye to trying to delay it forever. If you had the chance to undergo a therapy that would let you live for 200 years in your prime body, would you do it? Im talking 200 years in the body of a 35-year-old. Not just a longer life, but a longer life thats actually good. There are scientists working hard on making that possible right now, thanks in part to funding from billionaires like Jeff Bezos. But if Bezoss space launch was criticised for wasting money, how do we feel about his quest for eternal life? Should we consider it urgent medical research? Or is this just rich mans folly? Do we really want a hacker biology to live to 200? Think about it.

[MUSIC PLAYING]

Anjana AhujaYou know, if a woman could reset her biology and have the biology of a, you know, perpetually of a 30-year-old, then what happens to the concept of generations? Are we all going to be living you know, when we talk about multigenerational households, are we talking about instead of the three at the moment, maybe four, five, six?

Lilah RaptopoulosThats Anjana Ahuja, a contributing science writer for the FT. Anjana recently wrote the cover story for Life & Arts on this radical idea. It was called, Can we defeat death? And it asks just that. Can we actually live for hundreds of years or forever? And yeah, thats a real headline from a real newspaper, not a sci-fi novel, written by a real, distinguished journalist who actually has a PhD in space physics. So heres where we are. We arent close yet to making humans age in reverse. But scientists have been able to de-age cells in living organisms. There are mice that go blind from ageing. And we can manipulate their genes so that they can see again. Were close enough to a Benjamin Button situation that philosophers are now publishing books about the morality of extending the human lifespan.

So I cant stop thinking about your piece. (Laughter) Im just like, yeah, and Im wondering, like, where this started for you. Where did you start reporting it?

Anjana AhujaBack in September, I wrote a column about Altos Labs. I found out that it was being set up, it was being funded by Jeff Bezos. And to me, it seemed like a really serious outfit in terms of the money that was going into it, the people they were recruiting. And Ive always thought this, that actually somebody, sooner or later, is going to look at ageing as a technological problem because there is so much research into kind of interfering, trying to hack the ageing process.

Lilah RaptopoulosAltos is a Silicon Valley start-up and Anjana says it expands on the work of Shinya Yamanaka, a Nobel Prize-winning physiologist who heads Altoss scientific board. In 2006, Yamanaka made a discovery that some people consider even more important than the discovery of the DNAs double helix.

News clipThe Nobel Assembly at Karolinska Institute has today decided to award the Nobel Prize in physiology or medicine 2012 to Shinya Yamanaka.

Lilah RaptopoulosHis research showed that if you take an adult mouse cell and bathed in a mixture of four proteins, you can reset that cells age back to its embryonic state. In 2007, he proved that it could be done with human skin cells. Let me say that again. If you dunk individual cells in this particular cocktail of proteins, you can make those cells not just stop ageing. You can make them younger. And we, of course, are made entirely of cells.

Im curious what, like, the practical implications would be of these findings? Like, would it be just that individual parts of your body, those cells, could kind of Benjamin Button themselves backwards and yet you still would look old? Like, is there is there a way to sort of make the entire body young? Thats a very dumb question. But is there a way to make the whole body younger?

Anjana AhujaNo, its not a dumb question at all. I think thats really what these billionaires are hoping for, isnt it, to kind of freeze themselves in some kind of eternally youthful state? I think thats a very good question. The key is how you translate from individual cells up to whole organisms.

Lilah RaptopoulosThe name for what happens when you bathe cells in the Yamanaka Factor proteins is cellular reprogramming. Scientists try to reprogramme the cells of an entire body on mice, but when they did, the mice grew these horrible malignant tumours. Anjana put it like this. She said once you bring the cells back to their embryonic state, they lose their life plan. They dont know what to do next, so they grow into cancers. But there are companies right now working to see if you can apply these factors incrementally to de-age cells as far as you can without them developing cancer and then to do it again.

Anjana AhujaI suspect people will be quicker to apply it to individual organs first, individual tissues. You know, when you think about the number of people whose organs just wear out, they need transplants. So that might be an option.

Lilah RaptopoulosThis research, it isnt the only path to reverse ageing. A California scientist has been giving a small group of middle-aged men this cocktail of drugs that includes diabetes medication. Its made their thymus glands, which is a key part of the immune system, younger by two-and-a-half years. David Sinclair, a Harvard geneticist and one of the biggest names in anti-ageing. Hes doing a lot to experiment on his own body, including only eating one or two meals a day to put his body into survival mode. But Yamanakas discovery and where its going, thats whats really changing the game for longevity research. And to tell you the truth, thinking about it really pushed me on my assumptions about scientific progress, especially progress driven by Jeff Bezos.

These stories can look a little like the stories of men with too much money in Silicon Valley (laughter) just trying to like, kind of like, still be young and cool, right? Like, kind of suspend reality and like, isnt there something, even if its hard, comforting about the fact that we understand that, like, theres a limit to our lives and we understand the arc of it and, and we all die.

Anjana AhujaYeah, I mean, why dont these billionaires put their money to solving climate change and starvation and, you know, giving us clean drinking water and that kind of thing? You know, whats really interesting to me, I think, is when you think about what healthcare is.

Lilah RaptopoulosMmhmm.

Anjana AhujaIts about postponing death.

Lilah RaptopoulosYeah.

Anjana AhujaYou know, if you say to someone, you know, if you could not have cancer, not have heart disease, not have Alzheimers, not have dementia, if you could find a therapy that did that, would you take it? And I think there would be a lot of people that would say yes.

Lilah RaptopoulosMmhmm.

Anjana AhujaAnd what the scientists are saying, well, actually, you know, ageing is the common factor in lots of these diseases.

Lilah RaptopoulosMmhmm.

Anjana AhujaSo instead of, you know, kind of waiting till Alzheimers or heart disease or diabetes hits, why dont we make an upstream intervention and stop the root cause, or one root cause, which is ageing?

Lilah RaptopoulosAt the moment, though, most people seem to be sceptical of radical life extension. Anjana quotes the survey in her piece that only four per cent of Americans recently said theyd want to live past 120. Statistically, thats pretty close to no Americans wanting to live past 120. And Anjanas right! Part of that scepticism is that we cant imagine our world without Alzheimers, cancer and heart disease because the image we have is of old age as we know it now, one that is inextricably linked to disease and frailty and loneliness. But even if we could get rid of the negative consequences of ageing, if we can have lives that arent just longer but good till the end, should we? Have we really thought this through? What about the climate crisis and overpopulation and burning through our limited resources? What about marriage? Can you stay married to one person for 150 years? How many careers should we have over 200 years? What about dictators who dont ever die? Supreme Court justices? What about the House of Lords?

Anjana AhujaWhat do you do in the judicial system? You know, what does a life sentence mean, if youre living for 150, 200 years?

Lilah RaptopoulosYeah.

Anjana AhujaAnd just this idea that kind of a lot of institutions in society are set up with finite life spans in mind.

Lilah RaptopoulosAs we ended this conversation, I held two opposing feelings at once. One is, if this discovery happened today, it would be a nightmare on a macro scale, and we are not ready for it. And the other is, if I could give someone I love whos suffering from degenerative disease a pill to stop their pain or to reverse the damage, I would in a heartbeat, no question. And to not feel that way is kind of to be against progress.

Anjana AhujaI think there are some really important issues that may well become more important in the decades ahead. I dont know how close any of this is to fruition, this work about, you know, radical life extending. Could I live to 200? I dont know. And Im not sure that I would necessarily be able to make that decision today.

Lilah RaptopoulosYeah.

Anjana AhujaI think I would want to see what state the science was in, what state the research was in, what state I was in, and what kind of life I felt I could have, how I felt psychologically about it, what my family feel about it. You know, do they want me hanging around for a hundred years (laughter)?

Lilah RaptopoulosWould the people around you also be hanging around for an extra 100 years?

Anjana AhujaExactly. You know, we are going to get horribly bored with each other. So who knows? I mean, these are really big issues, but I hope that the piece is open to debate and we should talk about these things. Theyre always good because you never know how fast science is going to progress. Yeah. And sometimes, as weve seen with, you know, gene editing and CRISPR, sometimes these things hit before weve had a chance to think about them.

Lilah RaptopoulosMmhmm.

Anjana AhujaAnd I think its always really useful for us to just take a step back and reflect on how we live, how science might change things, and on what we feel comfortable with and, and, you know, the future of our species and our society.

Lilah RaptopoulosAnjana, youve given me so much to think about and probably our listeners too. Thank you so much for being on the show.

Anjana AhujaOh, its been my pleasure, Lilah. Thank you for having me!

[MUSIC PLAYING]

Lilah RaptopoulosAnd a final thought. We may be doing some of this life extension work already. We do live in a world of optimisation. We have apps to help us meditate. Our phones count our steps. We have strange little tools we attach to the back of our necks to help our posture. My watch tells me to stand up and breathe. My friends have a bed that heats up and cools down according to their optimal body temperature. There are start-ups that make vitamins specifically for your personal constitution. This isnt just scientists in a lab testing proteins on mice. This is kind of already happening.

Tiffany DarkeSo actually, what these tools, all the good tools for longevity that are coming into the market do is they help increase your health span as opposed to your life span.

Lilah RaptopoulosThats Tiffany Darke. Shes a regular contributor to the FTs luxury magazine, How to Spend It. She just wrote a piece on what the really rich are doing now to optimise their health. And shes pretty into it.

Tiffany DarkeIm a bit of a luxury junkie. Ive always, like, appreciated fashion. And I think that the science and the thought leadership around the luxury wellness industry has sort of increased exponentially in recent years.

Lilah RaptopoulosLets be clear. Living long is a luxury. The difference between being wealthy and poor can translate to living 10 or 20 years longer or shorter. And living long well, thats an even bigger luxury. In the UK, 20 per cent of mens lives are spent in poor health, a number thats increasing. And for women, thats even higher. Its 23 per cent. But for those that can afford it, there are a lot of new options. Were going to take you through a few of them here. The first is called RoseBar. Its a destination longevity programme and its marketing offers you a pretty bold promise.

Tiffany DarkeIt says a year from now, you can be younger. So they are promising reversal of ageing.

Lilah RaptopoulosThe RoseBar programme is a year-long programme. First they run longevity diagnostics and your bloodwork to see if youre on any negative health trajectories. And if you are, they put you on antidotes, which could be plasma treatments or even stem cell manipulation. From there, they give you fitness and diet advice and monthly check-ins. And the first programme launches this month at a resort in Ibiza. Its got a hyperbaric chamber, cryotherapy and IV facilities and literal shamans. Its like buying a souped-up life coach.

Tiffany DarkeYes, yes, life coach but with lots of kind of doctors and clinicians and all the sort of fun toys that surround the longevity industry as well.

Lilah RaptopoulosThe cost is, base, 15,000.

Tiffany DarkePlus the actual residential costs, plus getting there, plus the cost of the nutraceuticals, plus all the treatments.

Lilah RaptopoulosIf thats a bit too steep for you, theres a start-up called Thriva. Its an app that sends you a blood sample kit. The cost starts around $30 and can go as high as almost $200 per test, depending on your add-ons.

Tiffany DarkeIm warning you, its totally addictive. So you download this app on to your phone and then they send you a blood test and you do your blood test every three months. And its really easy at home, pinprick in the end of your finger.

Lilah RaptopoulosThey test what your doctor does at a normal check-up: your cholesterol, kidney and liver function, testosterone, vitamin levels. But they test it way more frequently and they put the results in an app, gamified. Next are the supplements. Lima sells supplements with nine scientifically backed ingredients: D3, keratin, ashwagandha, turmeric, stuff like that, but branded to look cool. You may have heard them referred to as the supermodel supplements: four pills a day, $300 a month, and you even get a luxe copper vessel to store them in.

Tiffany DarkeTheres a lot of hocus-pocus in the supplement market and, you know, a lot of good marketing, but actually there are supplements out there that do use good, patented adaptive medicines and at the dosages that your body needs to really thrive.

Lilah RaptopoulosWhich begs the question, are these just high-tech tools reminding us to do the obvious? Eat vegetables, avoid processed foods, take your vitamins, drink water, get sleep, exercise. Its all advice thats as old as time, but its a lot easier to follow when you can afford to get real-time data. And it doesnt hurt to have a shaman reminding you on a beach in Ibiza.

[MUSIC PLAYING]

Lilah RaptopoulosThats it for this week. Youve been listening to FT Weekend, the podcast from the Financial Times. Please keep in touch, say hi, tell me what you like, what issues you want to hear us explore. You can email us at ftweekendpodcast@ft.com. Were on Twitter @FTWeekendPod and Im on Instagram and Twitter @LilahRap. Ill put some photos of Leos family adventure on my feeds and, really, reach out. We love to put listeners on the show. In our show notes, as always, are links to everything mentioned. Theres also a special discount there on an FT Weekend subscription or even an FT.com trial. Weve got the best discounts collected for you in that link, which you can also get to at ft.com/weekendpodcast. Please leave us a review and share the show on your Twitter or Instagram story or with a few friends. This really is the best way you can help support the show.

Im Lilah Raptopoulos. Katya Kumkova and George Drake Jr are our senior producers. Lulu Smyth and Josh Gabert Doyan are our assistant producers, and Breen Turner is our sound engineer, with original music by Metaphor Music. Cheryl Brumley and Manuela Saragosa are our executive producers, and we have editorial direction from ReneKaplan. Well find each other again next week.

See the article here:
How to live forever - Financial Times

Recommendation and review posted by Bethany Smith

This is Geek Week, my newsletter about whatever nerdy things have happened to catch my eye over the past seven days. Heres me, musing about something I dont fully understand in an attempt to get my head around it: I imagine thats how most editions will be. If youd like to get this direct to your inbox, every single week,you can sign up here.

As is my right and privilege, I want to write an entire newsletter off the back of a single sentence I read in a BBC Futures article several months ago.

The article was this one: Apparently, its the next big thing. What is the metaverse? Its about (obviously) the metaverse: the idea of a virtual-reality internet where we all walk around inside a 3D world and have meetings and so on.

And the line that caught my interest was: Hype about digital worlds and augmented reality pops up every few years, but usually dies away.

This is the sort of thing that might end me up in Pseuds Corner, but: Scottish philosopher David Hume would have loved that sentence.

Hume pointed out (Im writing this from dusty memories of philosophy seminars in the early 2000s, so it wont be perfect, but I think its basically about right) that we never see one thing cause another thing. We see a thing, and then we see the next thing, and we infer cause. We see a billiard ball hit another billiard ball, and we see the other billiard ball move, but we never see one thing cause the other.

So how do we decide what causes what? For Hume, we have to use induction: if every time we see Event A, it is followed by Event B, but if we dont see Event A we dont see Event B, then we can start to think that A causes B.

But theres a problem with induction. Philosophers loved to prove stuff. All men are mortal; Socrates is a man; ergo Socrates is mortal, that sort of thing. All bachelors are unmarried. No power of two is divisible by three. These things are logical truths: If you accept the premises, you cant help but accept the conclusion.

That doesnt work with induction, though. You see the sun rise a thousand times, but you can never logically prove that it will rise tomorrow. The turkey notices that the farmer feeds him 364 days in a row, and is thus taken entirely by surprise on the 365th, when the farmer slaughters him and roasts him for Christmas.

Hume points out that you can only think of inductive reasoning in terms of probability. I think its likely that the sun will come up tomorrow: but I cant prove it, in mathematical/formal Aristotelian logic terms.

OK, so the metaverse. Hype about digital worlds and augmented reality pops up every few years, but usually dies away.

Every time you have seen the sun rise in the past, its risen the next day too. Every time the farmer fed the turkey, he fed it the next day too. Every time hype about virtual reality pops up, it dies away. But can you actually draw any conclusions from those things? After all, if you said The sun has always come up before, ergo I predict it will come up tomorrow, youd be making a correct prediction. If you said The farmer has always fed me before, ergo hell feed me tomorrow, youd be wrong (eventually, but importantly). Is Tech hype has always faded away before, ergo itll fade away again like the sun, or like the turkey?

Well, lets look at some other things. Video-calling technology is the obvious example. There was hype about that every few years. I learn from Wikipedia that it was first mooted in the 1870s, basically immediately after the invention of the telephone. The German Reich had closed-circuit television technology which allowed video calls in 1936. In the 70s AT&T released the Picturephone to great fanfare. In the 90s it started to work over the internet.

There have been various waves of hype about it. And each one died away, because the tech wasnt quite there, or it was too expensive, or not enough people had the kit to make it work. And you could reasonably have drawn the conclusion Hype about video-telephones pops up every few years, but usually dies away. And then the pandemic happened and suddenly a large percentage of us are doing it every day. No one is ever going to talk about video-calling hype again, because its just something we do and itd be weird to hype it in the same way itd be weird to hype, I dunno, bookshelves. Its just a technology that we have and that works and that is useful.

On the other hand, 3D glasses. Everyone thought that was the future of cinema, and then it died away, and then it came back (Avatar!) and then there was that brief 3D television thing, and that died away. And I dont think thats a product of the tech not being there polarised glasses are cheap, using two cameras instead of one isnt exactly ground-breaking stuff I think its that its basically a novelty, and the inconvenience and discomfort of having to wear the silly glasses outweigh the gains to your Viewing Experience of seeing things in 3D. Sometimes hype cycles really are just hype cycles.

Whats the difference between video-conferencing and 3D glasses? Whats the difference between the sun rising and the farmer killing the turkey?

The fundamental difference is one of theory. We have a really good theory to explain why we should predict the sun to rise tomorrow: Newtonian physics (we can do even better if we use relativity, but Newtons laws are fine). You predict that the sun will rise tomorrow because your theory says that the Earth spins on its axis once every 24 hours. That theory predicts lots of previous data, makes sense in the light of other theories, and generally seems pretty sound. Predicting that the sun wont rise tomorrow would mean rewriting a lot of what we think we know about the universe.

Whereas whats the turkeys theory for why the farmer is feeding him? Because he loves me and wants me to be happy, maybe, which is nice, but there are lots of equally plausible theories that could explain the data just as well.

The point is that you cant just look at the fact that there have been hype cycles and say from that that the thing will never happen. There have been AI winters before times when AI research stopped being fashionable, and funding into it slowed but I dont think there will be any more, because now AI is making people money. Theres a current hype cycle around fusion power, and maybe itll die away like the last several (fusion is 30 years away and always will be), but maybe one day itll just become profitable. [This thing] is coming and itll change the world will always be wrong every single time until its right.

So you need to look at the theory behind it and decide as best you can, not just on the hype cycle, whether you think its likely.

This isnt just true of new technology, by the way. Its true of disasters as well (every warning of an apocalypse will be false apart from one). Experts told us swine flu/bird flu/SARS/MERS would be a devastating global pandemic, and they were wrong every time, so we dont need to worry about this novel coronavirus.

There are various up-and-coming technologies that get repeatedly hyped and then die away again. Artificial general intelligence: people have thought that was on its way many times. Fusion energy. Life extension. Space colonies. Virtual reality.

For what its worth, I think true artificial intelligence and fusion energy probably will happen in the next few decades nature has proved theyre both possible (you can make an intelligent being out of neurons, you can make a fusion reactor in a star), obvious progress has been made towards them, and crucially people will be able to make lots of money out of both of them.

(Cheap energy is obviously valuable; really, really clever machines that can do exactly what you ask of them will have an incredibly wide array of uses if we manage to stop them from killing us all.)

Life extension seems to be plausible and, lets face it, rich people will pay for it once its available but super expensive, so I suspect theres a good chance of that happening. Space colonies are not likely to be profitable, but the worlds two richest people are interested in them and keep pushing money into technology that could make it happen, so I can see how that might happen.

And the metaverse I dont know. It always seems like a pain in the arse to me. The headsets are uncomfortable and I dont know if most of the use cases (conferencing etc) are so much better than a Zoom call that itd make it worthwhile. Maybe theyll get less clunky over time, but its pretty unlikely theyll ever get less clunky than a pair of 3D glasses. But Mark Zuckerberg obviously thinks its worth betting heavily on, and hes probably looked into it more closely than me.

But you cant know any of that just from looking at whether the hype has come and gone in the past. We do that too often. The climate has always changed! [So we shouldnt worry about it changing now.] Fusion is 30 years away and always will be! [So its not coming soon.]

Instead you have to actually look at the details. Its not enough to say that the farmer feeds you every day, so he always will. Sometimes Christmas happens.

Why do so many people believe things that are patently untrue? The point of believing things, surely, is to help us navigate the world: if there is a big hole in the ground in front of us, it is useful to believe that there is a big hole in the ground in front of us, so that we dont fall into it and break our legs. But lots of us all of us, probably believe things that are clearly untrue. A few that are probably relatively uncontroversial among Geek Week readers: astrology can predict your future; vaccines cause autism; there was a paedophile conspiracy involving Hillary Clinton run out of a Washington pizza restaurant.

(I dont know which of my beliefs are clearly untrue if I did Id stop believing them but it seems overwhelmingly likely that some of them are.)

Kevin Simler makes the case that beliefs have several roles. Some beliefs help us navigate the world. But others help us maintain social standing. Whether or not I believe in climate change will have very little effect on the actual outcomes of climate change, but it will have a huge effect on my ability to enjoy nice dinner parties in north London (or chats with rural Republicans in the American Midwest). He compares it to employees in a company in a corrupt, nepotistic town:

Consider the case of Acme Corp, a property development firm in a small town called Nepotsville. The unwritten rule of doing business in Nepotsville is that companies are expected to hire the city councils friends and family members. Companies that make these strategic hires end up getting their permits approved and winning contracts from the city. Meanwhile, companies that refuse to play ball find themselves getting sued, smeared in the local papers, and shut out of new business.

In this environment, Acme faces two kinds of incentives, one pragmatic and one political. First, like any business, it needs to complete projects on time and under budget. And in order to do that, it needs to act like a meritocracy, that is, by hiring qualified workers, monitoring their performance, and firing those who dont pull their weight. But at the same time, Acme also needs to appease the city council. And thus it needs to engage in a little cronyism, that is, by hiring workers who happen to be well-connected to the city council (even if theyre unqualified) and preventing those crony workers from being fired (even when they do shoddy work).

It might make sense to hire the mayors useless nephew, even though you know he wont pull his weight, because it will make your companys life easier. By comparison, it might make sense to believe things that arent true, as a signal that youre part of Team We Believe That Stuff. Sometimes those beliefs will actually be true.

Ive used relatively uncontroversial examples above. But I bet you could think of more mainstream beliefs that are clearly untrue (I cant face the row). And the real trick is to try to work out which of your own beliefs are held at least partly for crony reasons, because its just not plausible that there arent any.

This is Geek Week with Tom Chivers, a subscriber-only newsletter from i. If youd like to get this direct to your inbox, every single week,you can sign up here.

Read more:
Is the metaverse the next Zoom or the next 3D TV? Look beyond the hype - iNews

Recommendation and review posted by Bethany Smith

Twenty years ago, there wasn't all that much of a difference between the public view of rejuvenation research and the cryonics field. Both were mocked by the mainstream media, marginal areas of human endeavor out on the fringes of society, supported by very little funding and a handful of dedicated supporters. Yet in both cases, compelling research existed to support the goals - of the treatment of aging, of reversible cryopreservation - and was largely ignored, or even actively derided by the academic mainstream, worried about appearances.

A great deal has changed since then for the field of rejuvenation research. In the early 2000s, patient advocates were delighted and surprised by the rare occasion on which a six or seven figure check arrived from a philanthropist. It didn't happen often! Twenty years down the line, however, and billions in funding from philanthropists, research institutions, and venture funds are now devoted to the development of in vivo epigenetic reprogramming as an approach to the treatment of aging. Similarly, hundreds of millions have been invested in the development of senolytic therapies to clear senescent cells. The treatment of aging as a medical condition and the goal of reversal of aging is no longer mocked, it is taken seriously, and both funding and the number of ventures are increasing at a rapid pace.

How did this change happen? It was a mix of networking, advocacy, philanthropy, and compelling advances in the science, such as the development of the first senolytics and many consequent studies showing rapid, profound rejuvenation in mice. A tipping point was reached after years of a long, slow grind of bootstrapping: a little more progress, a little more support, a little more progress. Once past that tipping point, matters moved much more rapidly year after year, and the acceleration continues today.

I recently attended the 50th anniversary conference for the Alcor Life Extension Foundation, celebrating the lengthy run of one of the oldest cryonics providers. A good deal of the discussion there orbited around the usual questions asked by a small and passionate community: how does the cryonics field become larger, more robust? How does it achieve greater funding and faster progress towards widespread use? Fifty years on from the very early days of improvised equipment, ad hoc science, and regulatory opposition, the field of cryonics now looks a lot like the field of rejuvenation biotechnology did fifteen or twenty years ago. Slow progress is underway, the organizations are far more professional, and a few visionary philanthropists are putting in six or seven figure checks occasionally. Compelling advances in research exist, and are not receiving the widespread attention that they deserve. New organizations for advocacy and research are being founded with small budgets and big visions. Some of the technology waiting in the wings, such as reversible vitrification of human organs, may help to reach the tipping point once they are fully realized and in widespread use.

Given this, I would not be surprised to see the cryonics field becoming much larger and more commercial, growing suddenly and rapidly, in the mid-to-late 2030s. By that time, I would expect that reversible vitrification of organs will be a going concern, radically changing the economics and viability of organ donation, and adopted as a core enabling technology by the new industry focused on manufacturing patient-matched organs to order. The widespread recognition of this technological capability will bring many more people to the realization that cryopreservation on clinical death is a viable approach to saving lives that would otherwise be lost, and matters will proceed ever more rapidly from there on.

View post:
When Will the Cryonics Industry Arrive at a Tipping Point in Growth ...

Recommendation and review posted by Bethany Smith

Walt Disney World reopens to the public after coronavirus closure

Walt Disney World has reopened to the public but with many new precautions to help prevent the spread of COVID-19.

USA TODAY, Wochit

In the decades following American animator and director Walt Disneys death in November 1966, pop culture conspiracy theorists have promoted a myth that his cryogenically frozen corpse is stored away in a hidden vault.

Over the years, the legend has taken different forms online. Some have speculated his frozen body is located under the Pirates of Caribbean ride, while others have claimed Disney named the movie Frozen sostories about his frozen head would stop showing up on Google.

Now, people are asserting that Disneys frozen body will be thawedin December in an attempt to resurrect him.

55 Years After His Death, Walt Disneys Frozen Body Will Be Thawed December 2021 In An Attempt To Bring Him Back To Life, reads a screenshot of a news headline shared to Facebook on Sept. 23 by the page Disney After Dark.

The post accumulated more than 1,700 shares and reactions in less than a day.The same claim has made its way to Instagram, blog pages and YouTube. On TikTok, a video about the article gained more than 92,000 likes in less than a week.

Fact check: Sony Group still owns Spider-Man film rights, despite online claims

But Disneys body isn't frozen. And the screenshot of the headline circulating online originated on a satirical website, which the posts fail to mention.

USA TODAY reached out to the social media users who shared the claim for comment.

The headline first appeared in a Sept. 15 article from Daily News Reported, which bills itself as a fabricated satirical newspaper and comedy website.

Daily News Reported uses invented names in all its stories, except in cases when public figures are being satirized, reads a disclaimer on the sites about page. Any other use of real names is accidental and coincidental.

The disclaimer is not included in the screenshots shared to social media.

Fact check: Image of bleeding Indigenous person at Met Gala is altered

It's an example of what could be called "stolen satire," where storieswritten as satire and presented that way originally are captured via screenshot and reposted in a way that makes them appear to be legitimate news.As a result, readers of the second-generation post are misled, as was the case here.

Dennis Kowalski, president oftheCryonics Institute a company that cryogenically freezes bodies and was mentioned in the Daily News Reported article- told USA TODAY the company is not bringing Disney back to life.

"We have heard of this rumor as well and we can confirm that it is not true," Kowalski said via email.

The claim that Disneys body is frozenisbased on the theory of cryonics, an experimental process in whichpatients bodiesare frozen with the hope that future technology will bring them back to life.

But scientists have criticized the cryonics industry and researchers say the theory is based on faith, not science.

"Reanimation or simulation is an abjectly false hope that is beyond the promise of technology and is certainly impossible with the frozen, dead tissue offered by the 'cryonics'industry," Michael Hendricks of McGill University wrote for MIT Technology Reviewin 2015.

Fact check: Claim that Biden is withholding benefits from unvaccinated veterans originated as satire

Regardless, Disney's body was notfrozen.His death certificate says he was cremated,the Los Angeles Times reportedin 2003. His ashes were interred at a family mausoleum at Forest Lawn Cemetery in Glendale, California, per PBS.

People close to Disney have also refuted the conspiracy theory.

There is absolutely no truth that my father, Walt Disney, wished to be frozen," Disney's daughter, Diane, wrote in her 1972 biography."I doubt that my father had ever heard of cryonics.

Based on our research, we rate FALSE the claim that Disneys body will be thawed in December to bring him back to life. The claim originated on a satirical website. Disneys body was cremated and his asheswere interred at Forest LawnCemetery in Glendale, California.

Thank you for supporting our journalism. You can subscribe to our print edition, ad-free app, or electronic newspaper replica here.

Our fact-check work is supported in part by a grant from Facebook.

Visit link:
Fact check: Walt Disney's frozen body will not be thawed in December

Recommendation and review posted by Bethany Smith

What happened

The downtrodden biotech space has kicked off the second half of 2022 with a boom. Hard-hit gene-editing and gene therapy companies in particular have started the back half of the year on the right foot. Underscoring this point, Bluebird Bio (BLUE 6.97%) stock has already risen by 17% over the holiday-shortened week as of Thursday's closing bell, according to data provided by S&P Global Market Intelligence.

What's more, shares of CRISPR Therapeutics (CRSP 0.21%) have gained 22.6% over the same period, and fellow gene editor Editas Medicine (EDIT -0.20%) also saw its equity rise in price by a healthy 20.7% this week. By contrast, Bluebird and Editas shares both fell by over 50% over the first six months of 2022, while CRISPR's stock price stumbled by a noteworthy 20% during the first half of the year.

Image Source: Getty Images.

What's behind this sudden trend reversal? The most likely explanation is simply short-sellers covering their positions (buying back their borrowed shares). In keeping with this theme, Bluebird, Editas, and CRISPR all saw a sharp rise in their short interest during the first six months of 2022. Short-sellers piled into these three names earlier this year due to the fact that they are all cash flow negative, which is a tough spot to be in during a persistent bear market and an era of rising interest rates. Bluebird, in fact, is staring down a serious cash crunch at the moment.

Short-sellers, for their part, are probably backing away at this stage for no other reason than to play it safe in the event that big pharma starts to go bargain shopping.

Why might big pharma target beaten-down gene-editing and gene therapy companies in the second half of the year? The key reason is that these high-value fields are starting to move beyond the research stage of their life cycle and into the realm of commercially available therapies.

Speaking to this point, Bluebird's gene therapies for beta thalassemia and cerebral adrenoleukodystrophy appear to be on their way toward a formal approval from the Food and Drug Administration (FDA) following a pair of positive advisory committee votes last month. What's more, CRISPR is also expected to file for regulatory approval for its Vertex Pharmaceuticalspartnered blood disorder candidate, exa-cel, later this year.

Are any of these three biotech stocks still worth buying? CRISPR is arguably the most attractive bargain among the three. The company's ex-vivo gene-editing platform has posted stellar trial results so far, and Vertex could very well decide to buy its partner as a result.

Bluebird, on the other hand, is a tough call. The company ought to have a compelling buyout case if the FDA does grant it a pair of approvals soon. The bad news is that the biotech's balance sheet may force a sale at a heavily discounted price (relative to the commercial potential of its lead assets).

Finally, Editas might simply get lost in the mix when everything is said and done. There are several gene-editing companies vying for the spot of top dog, and Editas' clinical pipeline lags in several key areas at the moment. Time will tell.

George Budwell has no position in any of the stocks mentioned. The Motley Fool has positions in and recommends CRISPR Therapeutics, Editas Medicine, and Vertex Pharmaceuticals. The Motley Fool recommends Bluebird Bio. The Motley Fool has a disclosure policy.

See more here:
Why Shares of Bluebird Bio, CRISPR Therapeutics, and Editas Medicine Soared This Week - The Motley Fool

Recommendation and review posted by Bethany Smith

Can gene-editing technology CRISPR create new crops that help fight climate change as they grow? Thats what a group of researchers hopes to do with $11 million in funding from the Chan Zuckerberg Initiative. The funding will go toward efforts to enhance plants starting with rice and soil so that theyre better at trapping carbon dioxide. The effort, which was announcedlast week, is being led by the Innovative Genomics Institute, which was founded byNobel laureateand co-inventor of CRISPR Jennifer Doudna.

[Jennifer] and I saw eye to eye on climate and how big of a problem it is in the world. And we just didnt want to sit on the sidelines anymore, says Innovative Genomics Institute (IGI) executive director Brad Ringeisen.

Follow the latest news and policy debates on agricultural biotech and biomedicine? Subscribe to our newsletter.

The rice genome is easier to manipulate than other crops, according to Ringeisen, in part because its already been studied a lot and iswell understood. One of the scientists involved in IGIs initiative is Pamela Ronald, whose research is widely known for leading to thedevelopment of rice varietiesthat tolerate flooding for much longer than other types using a different type of genetic engineering thats more likeprecision breeding. That rice is now grown by more than 6 million farmers across India and Bangladesh,according toRonalds laboratory at the University of California, Davis.

Read the original:
Climate change-fighting rice? Plants trap carbon dioxide as they grow and CRISPR gene editing can optimize this process - Genetic Literacy Project

Recommendation and review posted by Bethany Smith

In a trio of studies published on June 27 in the journalNature Microbiology, researchers at The University of Texas at Austin have discovered "fingerprints" of mysterious viruses hidden in an ancient group of microbes that may include the ancestors of all complex life on Earth: from fungi to plants to humans.

Ths discovery is significant; it explores the hypothesis that viruses were imperative to the evolution of humans and other complex life forms.

These microbes known as Asgard archaea after the abode of the gods in Norse mythology are usually found in the frigid sediments deep in the ocean and in boiling springs, and existed on Earth before the firsteukaryoticcells, which carry theirDNAinside a nucleus.

Some scientists have hypothesized that viruses may have played in role in how life forms first came to be by infecting the Asgard archaea. They may have even given rise to some of the first precursors to the nucleus. But, no Asgard-infecting viruses had been discovered hitherto. The latest research by Ian Rambo (a former doctoral student at UT Austin) and other members of Brett Baker's lab sheds light on how viruses might have played a role in this billions-year-old history.

"These are the first studies investigating Asgard archaeal viruses; there was nothing known before," Susanne Erdmann, group leader of the archaeal virology research group at the Max Planck Institute for Marine Microbiology in Bremen, Germany, who was not involved in the studies, toldLive Science. In the future, this line of research may reveal if and how viruses were involved in the emergence of eukaryotic cells on Earth, she said.

In the new research, scientists searched for evidence of viral infection embedded in the DNA of Asgard archaea - which comes in the form of viral DNA called "CRISPR spacers."

According to Rambo, most people who think of CRISPR relate it to the famous gene-editing tool that allows scientists to easily manipulate genetic sequences. This tool was originally adapted from the natural defense mechanisms of bacteria and archaea.

CRISPR refers to a region of DNA made up of short, repeated sequences with "spacers" sandwiched between each repeat. Interestingly, bacteria and archaea swipe these spacers from viruses that infect them, and the cells maintain a memory bank of viral DNA that helps them recognize the viruses should they attack again.

"It's an adaptive immune system that remembers these previous infections," said Rambo, who is now a postdoctoral scholar with the USDA's Agricultural Research Service.

Rambo and his colleagues had hunted in the Guaymas Basin in the Gulf of California the body of water between Baja California and mainland Mexico for such DNA spacers in Asgard archaea specimens collected from sediments near hydrothermal vents, roughly 1.25 miles (2 kilometers) beneath the water's surface.

The team matched the spacers they found to longer stretches of viral DNA gathered from the deep-sea environment.

The researchers could infer the kinds of proteins the various genes code for and how the viruses might function, working with viral DNA.

But, eventually, they could only figure out the functions of some of the viruses' genes; the functions of the vast majority of the genes are still unknown, Erdmann said. Also, because CRISPR doesn't work against all viruses, many more Asgard-infecting viruses are yet to be discovered, she said.

These hidden viruses could be found by growing Asgard archaea in the lab. "However, culturing Asgard archaea has been proven very difficult," Erdmann said. Until now, only one research group has managed to culture Asgard archaea, and it took them 12 long years to do it as archaeal cells take weeks to replicate.

But until more Asgards can be grown in the lab, CRISPR spacer matching is probably the most efficient way to find more viruses, Krupovic said. As more viruses are found, their role in the emergence of eukaryotes, including humans, may gain more clarity, added Rambo.

Read the original post:
Newly discovered viruses can offer clues about the rise of complex life on Earth - Interesting Engineering

Recommendation and review posted by Bethany Smith

Male hypogonadism, also known as testosterone deficiency, is a failure of the testes to produce the male sex hormone testosterone, sperm, or both.

It can be due to a testicular disorder or the result of a disease process involving the hypothalamus and pituitary gland.

Hypogonadism can affect many organ functions and it can have a negative impact on quality of life.

The signs and symptoms depend on when it starts, how severe the deficiency is, and whether or not there is a decrease in the major functions of the testes.

A lack of testosterone can cause a wide range of symptoms.

These depend on:

Adolescents and young adults who have not yet completed puberty appear younger than their chronological age.

They may also have small genitalia, a lack of facial hair, failure of the voice to deepen, and difficulty gaining muscle mass, even with exercise.

Puberty-onset hypogonadism can lead to:

Symptoms of adult-onset hypogonadism include:

Hypogonadism in a male refers to a decrease in either or both of the two major functions of the testes: sperm production and testosterone production.

This can happen for a number of reasons.

In primary hypogonadism, the testicles do not respond to hormone stimulation. This can be due to a congenital disorder such as Klinefelters syndrome, or acquired as a result of radiation treatment, chemotherapy, mumps, tumors or trauma to the testes.

In secondary hypogonadism, a disease state interferes with either the hypothalamus or pituitary gland, the main glands that release hormones to stimulate the testes to produce testosterone.

Situations that can cause secondary hypogonadism include:

Andropause is sometimes used to describe decreased testosterone due to the normal aging process. Testosterone levels in males increase until the age of 17 years. Then, starting at approximately 40 years of age, testosterone levels begin to decline at 1.2-2 percent per year.

Risk factors for hypogonadism include type 2 diabetes, obesity, renal failure, HIV, hypertension, chronic obstructive pulmonary disease (COPD) and taking glucocorticoid (steroids), opioid or antipsychotic medication therapy.

Testosterone replacement therapy (TRT) is the recommended treatment for male hypogonadism.

It is normally given as a topical gel, transdermal patch, or by injection. Oral forms of testosterone are not used due to the high risk of side effects, such as upset stomach.

TRT can eliminate many, if not all, of the signs and symptoms of male hypogonadism.

Benefits include:

However, there are a few risks associated with it.

It may lead to worsening of benign prostatic hyperplasia (BPH), acceleration of pre-existing prostate cancer, and worsening of both sleep apnea and congestive heart failure. TRT should not be started without first attending to these conditions.

All males who are using TRT require ongoing medical evaluation to determine adequate response to treatment. This will include regular blood tests and periodic digital rectal exams.

TRT is contraindicated in men with erythrocytosis, a condition involving a high volume percentage of red blood cells in the blood.

The response to TRT is individualized, and testosterone levels are not an indicator of who will respond to TRT and who will not. It is also worth noting that while it can relieve symptoms of hypogonadism, TRT does not restore fertility.

Hypogonadism can also affect females. In women with hypogonadism, the ovaries produce low levels of female sex hormones. This affects the functioning of the ovaries and the reproductive system.

Symptoms include delayed puberty and a lack of menstruation or irregular menstruation. Breasts may not develop fully and height may be affected. This may be due to a genetic problem, an autoimmune condition, or a range of environmental factors.

After puberty, a wide range of factors can lead to hypogonadism, including tumors, eating disorders, genetic problems, and surgery, such as a hysterectomy.

Symptoms will include hot flashes, mood changes, changes in energy levels, and discontinued menstruation.

Some lifestyle changes can help boost testosterone levels.

These include:

The measures can help maintain normal testosterone levels.

If an individual is at risk of or may have hypogonadism, a doctor will take a thorough medical history taken and carry out a physical examination, including blood tests.

Two key blood tests must be carried out to confirm the presence of hypogonadism:

The normal range of these blood tests has some variability, but a reading of between 300 and 1,000 nanograms per deciliter (ng/dL) is considered normal. Levels will be below the normal range in a person with hypogonadism.

For accuracy, the blood test should be drawn between the hours of 7.00 and 11.00 in the morning on at least two occasions. Additional testing may be necessary to confirm a diagnosis of hypogonadism.

Awareness of male hypogonadism is growing, but many adult men with the condition remain undiagnosed and untreated. This may negatively influence both their quality of life in men and their life span.

Any male who thinks he may have low testosterone levels should seek medical advice, as treatment can reverse most of the symptoms and risks of male hypogonadism.

However, before starting treatment with TRT, all men should discuss the risks and benefits with their health care provider.

Go here to see the original:
Male hypogonadism: Symptoms, causes, and treatment - Medical News Today

Recommendation and review posted by Bethany Smith